Abstract
Objective The aim of the present study was to examine the relation between the PON1 polymorphisms and recurrent pregnancy loss (RPL).
Methods In a cross-sectional study, blood samples were collected from 100 females. DNA was extracted and PON1 genotypes were determined by polymerase chain reaction (PCR) amplification.
Results Regarding PON1 L55M, the mutated allele (M) frequency was found in 70.5% in RPL and in 53.5% in controls; theMallele was significantly associated with an increased risk of RPL (adjusted odds ratio [ORadj]=2.07; 95% confidence interval [CI]; p<0.001). However, regarding PON1 Q192R, the R mutated allele frequency was found in 28.5% in RPL and in 33% in controls. The R allele did not show any risk for RPL (ORadj 0.81; 95%CI; p=0.329).
Conclusion The present study suggests that there is an effect of genetic polymorphism on RPL and provides additional evidence that combines with the growing information about the ways in which certain PON1 genotypes can affect the development of the fetus in the uterus.
Keywords:
recurrent pregnancy loss; paraoxonase 1; organophosphate; pesticides; oxidative stress
Resumo
Objetivo O objetivo deste estudo foi examinar a relação entre os polimorfismos PON1 e perda recorrente de gravidez PRG.
Métodos Em um estudo transversal, foramcoletadas amostras de sangue de 100 mulheres. O DNA foi extraído e os genótipos PON1 foram determinados por amplificação por PCR.
Resultados Com relação ao PON1 L55M, a frequência do alelo mutado (M) foi encontrada em 70,5% no PRG e em 53,5% nos controles; o alelo M foi significativamente associado a um risco aumentado de PRG (odds radio ajustado [ORadj] =2,07; intervalo de confiança [IC] 95%; p<0,001). No entanto, em relação ao PON1 Q192R, a frequência do alelo mutado R foi encontrada em 28,5% no PRG e em 33% nos controles. O alelo R não mostrou qualquer risco para PRG (ORadj 0,81; IC 95; p=0,329).
Conclusão O presente estudo sugere que há um efeito do polimorfismo genético sobre PRG e fornece evidências adicionais que se combinam com as informações crescentes sobre asmaneiras pelas quais certos genótipos PON1 podemafetar o desenvolvimento do feto no útero.
Palavras-chave:
perda de gravidez recorrente; paraoxonase 1; organofosfato; pesticidas; estresse oxidativo
Introduction
Recurrent pregnancy loss (RPL) is defined as the occurrence of three or more spontaneous miscarriages. It is a diverse condition that involves various etiological factors. Still the precise reason remains ambiguous in more than half of the cases.1 Between 30 and 50% of conceptions are said to be missed during the 1st trimester of pregnancy. Most miscarriages occur around the time of implantation and many times go unnoticed by the pregnant women themselves, who often mistake them for delayed menstruations. Also, between 10 and 12% of all the clinically recognized pregnancies end up as miscarriages during the 1st trimester.2 Despite the fact that chromosomal abnormalities are implicated in ∼ 50% of all miscarriages, the etiology of the other 50% is not exactly identified and may involve anatomic, genetic, endocrine, immunological, and environmental factors.3 Even after a complete evaluation, 50% of couples remain without a diagnosis for their RPL. Oxidative stress is one of the crucial factors that play a prominent role in the toxicity of various chemical families of pesticides, including organophosphate pesticides.4 The most largely distributed environmental toxin is pesticides. Even though each one of us is exposed to these xenobiotics to an extent, a few people, like farmers and floriculturists, are much more exposed to these toxins. These pesticides are extremely noxious to humans. Considerable morbidity and mortality is associated with pesticide poisoning, particularly in developing countries like India, where the pattern of pesticide use is different.5 The genetic polymorphisms as modifiers of human health diseases have gained attention in recent years, and there is an increased interest in conducting studies to explore the gene-environment interactions to detect susceptible populations prone to develop health problems due to chemical exposure.6
Amongst the candidate genes which aim to modify vulnerability to pesticides is the one coding for the paraoxonase 1 enzyme (PON1). The PON1 enzyme is an arilesterase class A enzyme that catalyzes the hydrolysis of a wide range of aromatic esters and phosphoesters, which play a multifunctional role in various biochemical pathways such as guarding against oxidative damage and lipid peroxidation, involvement in innate immunity, detoxification of reactive molecules, bioactivation of drugs, modulation of endoplasmic reticulum stress, and regulation of cell proliferation/apoptosis. As they can execute manifold self-governing and often unrelated functions, they are considered “moonlighting proteins.”78
A few findings proposed that several individuals with peculiar genotypes for PON1 have low plasma levels of this enzyme.910 The PON1 gene comprises a family which incorporates PON2 and PON3, positioned on the long arm of the human chromosome 7(q21.3–22.1). The PON1 gene contains two polymorphisms in the coding region, one in position Q192R and the other in position L55M. The polymorphism at Q192R gives rise to two alloenzymes which show evident difference in hydrolyzing organophosphate compounds.11 The activity of PON1 is substrate dependent; in-vitro analysis revealed that the pace of paraoxon hydrolysis by alloenzyme Q is slower when compared with alloenzyme R, while the rate of diazoxon hydrolysis by alloenzyme R is lower than that of alloenzyme Q.12 Moreover, the PON1 enzyme assists in the detoxification of certain organophosphate pesticides (OP), which are prominent endocrine disruptors and efficiently cross the placental barrier, influencing fetal development.13 Certain studies have investigated the role of PON1 enzyme activity or genotype and OP pesticide exposure on birth outcomes.141516 However, the potential association between PON1 polymorphisms, pesticide exposure, and the risk of miscarriage has not been documented. Hence, the present study aims to evaluate the role of PON1 gene polymorphism in recurrent pregnancy loss.
Methods
This was a case control study conducted at Queen Mary's Hospital, King George's Medical University, Lucknow, UP, India, from January 2016 to December 2018. A total of 100 women (cases) with a history of at least three recurrent pregnancy losses before the 20th week of gestation were included in the present study. An equal number of women (100) undergoing normal vaginal labor at term with live healthy birth were recruited for the control group. All subjects were informed and gave written consent to participate in the study. The present study was conducted in accordance with the guidelines set up by the institutional Ethical committee. (ECR/262/Inst/UP/2013).
Venous blood (2 ml) was drawn from each subject at the time of recruitment and collected in tubes with ethylenediaminetetraacetic acid (EDTA) (1mg/ml). The plasma was immediately separated by centrifugation at 3,500rpm for 15 minutes at 4°C. The cell pack was stored at -70°C until DNA extraction.
Genomic DNA was extracted using the phenol-chloroform method and purified DNA was stored at -20°C until further polymerase chain reaction (PCR) analysis. The PON1 genotypes were determined by PCR amplification using primers PON1192 (forward) 5′TATTGTTGCTGTGGGACCTGAG3′; PON1192 (reverse) 5′CACGCTAAACCCAAATACATCTC3; PON155 (forward) 5′CCTGCAATAATATGAAACAACCTG3′; and PON155 (reverse) 5′ TGAAAGACTTAAACTGCCAGTC3′. The amplification cycle was performed on a thermal cycler under the following conditions: denaturation for 5 minutes at 94°C, followed by 30 cycles of 30 seconds at 94°C, 30 seconds at 61°C, 1 minute at 72°C and, finally, 7 minutes at 72°C. The PCR products were digested with BspPI for P PON1192 and HinIII for PON155.
Results
Demographic Characterization
There were 100 subjects each in cases and controls group. Both groups were similar regarding age, body mass index (BMI), source of drinking water, and socioeconomic status. There was no significant difference in the mean age between cases and controls (p > 0.05). There was no statistically significant difference in the sociodemographic variables between cases and controls (Table 1).
The PON1 gene acts as important guardian against cellular damage from toxic agents, such as organophosphates and oxidized lipids in the plasma low-density lipoproteins.
PON1L55M Polymorphism and RPL
The genotype frequencies of PON1 L55M were conformed to the Hardy-Weinberg equilibrium both in cases and controls. For the PON1 L55M polymorphism, the genotype frequencies of homozygous (LL), heterozygous (LM), and homozygous mutated (MM) were 19, 21, and 60% in patients with RPL, respectively; and 35, 23, and 42% in controls, respectively. The mutated allele (M) frequency was found in 70.5% in RPL patients and in 53.5% in controls. Regarding the risk of development of RPL, the LL wild type genotype and L wild type allele were taken as references. The analysis showed that the M allele was significantly associated with an increased risk of RPL (adjusted odds ratio [ORadj] = 2.07, 95% confidence interval [CI], p < 0.001). The homozygous mutant genotype (MM) significantly increased the risk of RPL (ORadj = 2.07; 95%CI,; p = 0.011). No significant association was observed between (LM) genotype and RPL risk (ORadj = 0.88; 95%CI; p = 0.729). The distributions of the genotype and allele frequencies for PON1 L55M polymorphism in patients and controls are represented in Table 2.
PON1 Q192R Polymorphism and RPL
For the PON1 Q192R polymorphism, the genotype frequencies of homozygous (QQ), heterozygous (QR), and homozygous mutated (RR) were 51, 41, and 8% in RPL patients, respectively; and 46, 42, and 12% in controls, respectively. The R mutated allele frequency was found in 28.5% in RPL patients and in 33% in controls. Regarding the risk of development of RPL, the QQ wild type genotype and Q wild type allele were taken as references. The analysis showed that the women who were QR heterozygotes (ORadj = 0.96; 95%CI; p = 0.887) or RR homozygotes (ORadj = 0.64; 95%CI; p = 0.480), and R allele did not show any risk for RPL (ORadj = 0.81; 95%CI; p = 0.329). The distributions of the genotype and allele frequencies for the PON1 L55M polymorphism in patient and controls are represented in Table 3.
Discussion
The key finding of our analysis is the association between PON1 genotypes and RPL. To our information, this is the first study evaluating the outcome of polymorphisms that are involved in the genetic variability of the PON1 enzyme on RPL in north India. Toy et al.17 approximated the relationship between the PON1enzyme and early loss of pregnancy (before the 12th week of gestation) in pregnant women whose exposure to pesticides was unknown and found out that basal and salt-stimulated paraxonase activity were significantly lower in women who had suffered an early pregnancy failure when compared with women who continued their pregnancy beyond the 12th week. Blanco-Muñoz et al.18 established that the probability of miscarriage with the PON1192RR genotype was 2.2-fold higher than with the PON1192QR/ PON1192QQ genotypes. The possibility was close to 4-fold higher with the PON155MM/ PON155LM genotypes than with the PON155LL genotype.
Certain authors have documented the role of PON1 polymorphisms on other reproductive consequences, mainly gestational age, and anthropometric measures. Chen et al.9 reported that the probability of premature delivery increases with PON1 RR genotype in newborns while studying the role of genetic polymorphism on pregnancy outcomes.
Lawlor et al.,19 in a retrospective analysis, observed that the incidence of women who complained of at least 1 spontaneous preterm delivery increased with every R allele at position 192. In Norway, Ryckman et al.20 reported that the risk of premature birth in infants is 32% higher with the PON1–108 genotypes (OR = 1.32; 95%CI: 1.13–1.53) than in infants with PON1108CC/PON1108CT genotypes. However, no PON1 maternal genotype was related with this.
The PON1 gene exerts its role in lipid metabolism too, besides playing a major role in the detoxification of organophosphorus compounds; the R isoform of the PON1enzyme shows decreased capability to hydrolyze oxidated lipids.212223 On the other hand, another study established that the level of oxidative stress increases with the QQ192 genotype.24 Chen et al.,9 and Lawlor et al.,19 allocated the role of the RR genotype on preterm birth to damage in placental circulation coupled with lipid peroxidation. Similarly, a few studies have discovered that the presence of pesticides boosts oxidative stress and encourage the creation of oxidated lipids.252627 Accordingly, it is feasible that the RR genotype might amplify the possibility of low birthweight, mediated by placental hypoperfusion. All these studies cannot be completely compared with each other as a few focused on the genotype of the mother, while a few focused on the genotype of the infant, and others on the genotypes of both. A few evaluated the activity of the paroxonase enzyme and a few did not pay attention to it. In a few cases, the information on the exposure of the mother (either occupational or via biomarkers) was accessible, but a few studies were deficient of this variable. Nevertheless, all studies in general indicated the presence of PON1 gene polymorphism upon adverse reproductive events and imply the existence of an interaction between miscarriage and pesticide exposure.
In contrast with a few authors who established an association between agricultural work and miscarriage,282930 we did not find an independent effect of exposure to pesticides on the risk of RPL. However, we did find an independent effect of maternal PON1 on the risk of RPL.
Despite its limitations, the present study is one of the first in North India to evaluate the effect of PON1 genetic polymorphism on RPL and to provide additional evidence to the increasing information regarding certain PON1 genotypes that may affect the development of the fetus. More research is required to confirm these findings and overcome the limitations of the present study.
Conclusion
The reduced variability in exposure of women to pesticides might explain the absence of association observed between the exposure and RPL. One limitation of our study is that we have no information available on the PON1 enzyme. This is important because even in individuals with the same genotype, this kind of activity may vary up to 13 times.10 A large sample size might have made it possible to reach statistical significance between the genotypes and risk of RPL, as well as to show interactions between the genes and the environment.
References
- 1 Badawy SZ,Westpfal EM. Frequency of etiological factors and cost effectiveness of the work up for patients with history of recurrent pregnancy loss. Early Pregnancy. 2000;4(04):253-260
- 2 Simpson JL, Carson S. Biological causes of fetal loss. In: Gray R, Leridon L, Spira F, editors. Biomedical and demographic determinants of reproduction. Oxford: Clarendon Press; 1993:237-49
-
3 Cramer DW, Wise LA. The epidemiology of recurrent pregnancy loss. Semin Reprod Med. 2000;18(04):331-339. Doi: 10.1055/s-2000-13722
» https://doi.org/10.1055/s-2000-13722 -
4 Possamai FP, Fortunato JJ, Feier G, Agostinho FR, Quevedo J, Wilhelm Filho D, et al. Oxidative stress after acute and sub-chronic malathion intoxication inWistar rats. Environ Toxicol Pharmacol. 2007;23(02):198-204. Doi: 10.1016/j.etap.2006.09.003
» https://doi.org/10.1016/j.etap.2006.09.003 - 5 Abdollahi M, Ranjbar A, Shadnia S, Nikfar S, Rezaie A. Pesticides and oxidative stress: a review. Med Sci Monit. 2004;10(06): RA141-RA147
- 6 Hanke W, Jurewicz J. The risk of adverse reproductive and developmental disorders due to occupational pesticide exposure: an overview of current epidemiological evidence. Int J Occup Med Environ Health. 2004;17(02):223-243
-
7 Martinelli N, Consoli L, Girelli D, Grison E, Corrocher R, Olivieri O. Paraoxonases: ancient substratehunters and their evolving role in ischemic heart disease. Adv Clin Chem. 2013;59:65-100. Doi: 10.1016/b978-0-12-405211-6.00003-6
» https://doi.org/10.1016/b978-0-12-405211-6.00003-6 -
8 James RW. A long and winding road: defining the biological role and clinical importance of paraoxonases. Clin Chem Lab Med. 2006;44(09):1052-1059. Doi: 10.1515/CCLM.2006.207
» https://doi.org/10.1515/CCLM.2006.207 -
9 Chen D, Hu Y, Chen C, Yang F, Fang Z,Wang L, et al. Polymorphisms of the paraoxonase gene and risk of preterm delivery. Epidemiology. 2004;15(04):466-470. Doi: 10.1097/01.ede.0000129509.59912.b2
» https://doi.org/10.1097/01.ede.0000129509.59912.b2 -
10 Costa LG, Cole TB, Furlong CE. Polymorphisms of paraoxonase (PON1) and their significance in clinical toxicology of organophosphates. J Toxicol Clin Toxicol. 2003;41(01):37-45. Doi: 10.1081/clt-120018269
» https://doi.org/10.1081/clt-120018269 -
11 Tsatsakis AM, Tutudaki M, Tzatzarakis MN, Dawson A, Mohamed F, Christaki M, et al. Is hair analysis for dialkyl phosphate metabolites a suitable biomarker for assessing past acute exposure to organophosphate pesticides? Hum Exp Toxicol. 2012;31 (03):266-273. Doi: 10.1177/0960327111403171
» https://doi.org/10.1177/0960327111403171 -
12 Blanco-Muñoz J, Morales MM, Lacasaña M, Aguilar-Garduño C, Bassol S, Cebrián ME. Exposure to organophosphate pesticides and male hormone profile in floriculturist of the state of Morelos, Mexico. Hum Reprod. 2010;25(07):1787-1795. Doi: 10.1093/humrep/deq082
» https://doi.org/10.1093/humrep/deq082 -
13 Perera FP, Rauh V, Tsai WY, Kiney P, Camann D, Barr D, et al. Effects of transplacental exposure to environmental pollutants on birth outcomes in a multiethnic population. Environ Health Perspect. 2003;111(02):201-205. Doi: 10.1289/ehp.5742
» https://doi.org/10.1289/ehp.5742 -
14 Berkowitz GS, Wetmur JG, Birman-Deych E, Obel J, Lapinski RH, Goodbold JH, et al. In utero pesticide exposure, maternal paraoxonase activity, and head circumference. Environ Health Perspect. 2004;112(03):388-391. Doi: 10.1289/ehp.6414
» https://doi.org/10.1289/ehp.6414 -
15 Wolff MS, Engel S, Berkowitz G, Teitelbaum S, Siskind J, Barr DB, et al. Prenatal pesticide and PCB exposures and birth outcomes. Pediatr Res. 2007;61(02):243-250. Doi: 10.1203/pdr.0b013e31802d77f0
» https://doi.org/10.1203/pdr.0b013e31802d77f0 -
16 Moreno-Banda G, Blanco-Muñoz J, Lacasaña M, Rothenberg SJ, Aguilar-Garduño C, Gamboa R, et al. Maternal exposure to floricultural work during pregnancy, PON1 Q192R polymorphisms and the risk of low birth weight. Sci Total Environ. 2009;407(21): 5478-5485. Doi: 10.1016/j.scitotenv.2009.06.033
» https://doi.org/10.1016/j.scitotenv.2009.06.033 - 17 Toy H, Camuzcuoglu H, Celik H, Erel O, Aksoy N. Assessment of serumparaoxonase and arylesterase activities in early pregnancy failure. Swiss Med Wkly. 2009;139(5-6):76-81
-
18 Blanco-Muñoz J, Aguilar-Garduño C, Gamboa-Avila R, Rodríguez- Barranco M, Pérez-Méndez O, Huesca-Gómez C, et al. Association between PON1 genetic polymorphisms and miscarriage in Mexican women exposed to pesticides. Sci Total Environ. 2013;449:302-308. Doi: 10.1016/j.scitotenv.2013.01.034
» https://doi.org/10.1016/j.scitotenv.2013.01.034 -
19 Lawlor DA, Gaunt TR, Hinks LJ, Smith GD, Timpson N, Day INM, et al. The association of the PON1 Q192R polymorphism with complications and outcomes of pregnancy: findings from the British Women's Heart and Health cohort study. Paediatr Perinat Epidemiol. 2006;20(03):244-250. Doi: 10.1111/j.1365-3016.2006.00716.x
» https://doi.org/10.1111/j.1365-3016.2006.00716.x -
20 Ryckman KK, Morken NH, White MJ, Velez DR, Menon R, Fortunato SJ, et al.Maternal and fetal genetic associations of PTGER3 and PON1 with preterm birth. PLoS One. 2010;5(02):e9040. Doi: 10.1371/journal.pone.0009040
» https://doi.org/10.1371/journal.pone.0009040 -
21 Aviram M, Rosenblat M, Bisgaier CL, Newton RS, Primo-Parmo SL, La Du BN. Paraoxonase inhibits high-density lipoprotein oxidation and preserves its functions. A possible peroxidative role for paraoxonase. J Clin Invest. 1998;101(08):1581-1590. Doi: 10.1172/JCI1649
» https://doi.org/10.1172/JCI1649 -
22 Mackness MI, Arrol S, Abbott C, Durrington PN. Protection of lowdensity lipoprotein against oxidative modification by high-density lipoprotein associated paraoxonase. Atherosclerosis. 1993; 104(1-2):129-135. Doi: 10.1016/0021-9150(93)90183-u
» https://doi.org/10.1016/0021-9150(93)90183-u - 23 Cao H, Girard-Globa A, Berthezene F, Moulin P. Paraoxonase protection of LDL against peroxidation is independent of its esterase activity towards paraoxon and is unaffected by the Q->R genetic polymorphism. J Lipid Res. 1999;40(01): 133-139
-
24 Bhattacharyya T, Nicholls SJ, Topol EJ, Zhang R, Yang X, Schmitt D, et al. Relationship of paraoxonase 1 (PON1) gene polymorphisms and functional activity with systemic oxidative stress and cardiovascular risk. JAMA. 2008;299(11):1265-1276. Doi: 10.1001/jama.299.11.1265
» https://doi.org/10.1001/jama.299.11.1265 -
25 Milatovic D, Gupta RC, Aschner M. Anticholinesterase toxicity and oxidative stress. ScientificWorldJournal. 2006;6:295-310. Doi: 10.1100/tsw.2006.38
» https://doi.org/10.1100/tsw.2006.38 - 26 Amer M, MetwalliM, Abu el-Magd Y. Skin diseases and enzymatic antioxidant activity among workers exposed to pesticides. East Mediterr Health J. 2002;8(2-3):363-373
-
27 Gultekin F, Ozturk M, Akdogan M. The effect of organophosphate insecticide chlorpyrifos-ethyl on lipid peroxidation and antioxidant enzymes (in vitro). Arch Toxicol. 2000;74(09):533-538. Doi: 10.1007/s002040000167
» https://doi.org/10.1007/s002040000167 -
28 Settimi L, Spinelli A, Lauria L, Miceli G, Pupp N, Angotzi G, et al. Spontaneous abortion and maternal work in greenhouses. Am J Ind Med. 2008;51(04):290-295. Doi: 10.1002/ajim.20556
» https://doi.org/10.1002/ajim.20556 -
29 Arbuckle TE, Lin Z, Mery LS. An exploratory analysis of the effect of pesticide exposure on the risk of spontaneous abortion in an Ontario farmpopulation. Environ Health Perspect. 2001;109(08): 851-857. Doi: 10.1289/ehp.01109851
» https://doi.org/10.1289/ehp.01109851 -
30 Crisostomo L, Molina VV. Pregnancy outcomes among farming households of Nueva Ecijawith conventional pesticide use versus integrated pest management. Int J Occup Environ Health. 2002;8 (03):232-242. Doi: 10.1179/107735202800338812
» https://doi.org/10.1179/107735202800338812
