Wheat blast and phenylalanine ammonia-lyase gene expression in young plantsAbstract
The objective of this work was to quantify the expression of the PAL gene, designed from TraesCS1D03G0078900 (Chr1D), in young plants of the BRS Louro wheat cultivar challenged with Pyricularia oryzae. The first symptoms of blast were observed at 48 hours after inoculation (HAI). At 120 HAI, severity was 90%. The expression of the PAL gene was upregulated in infected plants at 48, 72, 96, and 120 HAI. After 48 HAI, there was a reduction in gene expression, which continued until 120 HAI. The PAL gene located on chromosome 1D is upregulated in BRS Louro cultivar; however, it is not efficient in restricting the colonization by P. oryzae.
Index terms:
Pyricularia oryzae; biotic stress; reverse transcription-quantitative polymerase chain reaction (RT-qPCR).
Resumo
O objetivo deste trabalho foi quantificar a expressão do gene PAL, desenhado de TraesCS1D03G0078900 (Chr1D), em plantas jovens da cultivar de trigo BRS Louro desafiadas com Pyricularia oryzae. Os primeiros sintomas de brusone foram observados às 48 horas após a inoculação (HAI). Às 120 HAI, a severidade foi de 90%. A expressão do gene PAL nas plantas infectadas foi regulada positivamente às 48, 72, 96 e 120 HAI. Após 48 HAI, houve redução da expressão do gene, que continuou até 120 HAI. O gene PAL localizado no cromossomo 1D é regulado positivamente na cultivar BRS Louro; no entanto, não é eficiente em restringir a colonização por P. oryzae.
Termos para indexação:
Pyricularia oryzae; estresse biótico; reação em cadeia da polimerase com transcrição reversa quantitativa (RT-qPCR).
Phenylalanine ammonia-lyase (PAL, EC:4.3.1.5) is the first in the phenylpropaoids metabolism pathway. It produces secondary metabolites such as lignin, phytoalexins, and phenolic compounds, including flavonoids, isoflavonoids, coumarins, and stilbenes. PAL activity in plants is induced in response to tissue injury, the presence of pathogens, hormones, and changes in environmental factors, such as light and temperature (Ferrer et al., 2008; Huang et al., 2010).
In grasses such as barley, the PAL gene expression has been found to be higher in resistant cultivars inoculated with Pyrenophora teres and Pyrenophora graminea than in susceptible cultivars, despite the variation of the expression level depending on the pathogen (Arabi et al., 2020).
OsPAL1 and OsPAL6 genes were upregulated in the resistant rice cultivar Shennong 9819, when challenged with Rhizoctonia solani. According to the authors, the PAL genes contribute to the cultivar’s resistance response, along with PR genes and the transcription factor OsWRKY30 (Yang et al., 2022).
In a study on the wide wheat (Triticum aestivum L.) genome, Rasool et al. (2021) identified 37 PAL genes distributed across chromosomes 1, 2, 6 ABD, 4A, and 5B; and high levels of PAL expression levels were verified in the roots of drought-tolerant wheat genotypes; however, a variation in the PAL gene expression was observed between genotypes. In a study on the wheat genome for PAL gene expression and biotic stress, Zhan et al. (2022) found that different PAL genes are upregulated or downregulated in wheat plants challenged with Fusarium graminearum or Puccinia striiformis; among the 54 genes identified, TaPAL32 and TaPAL42 were observed as being involved in stripe rust resistance (Zhan et al., 2022).
Wheat blast, caused by Pyricularia oryzae, is one of the most damaging diseases affecting wheat crops. In Brazil, the disease was identified first in Paraná state, in 1985, and it has since been reported in different regions worldwide, most recently in Zambia, Africa (Ceresini et al., 2019; Torres et al., 2022). Climatic changes, including prolonged rainy and warm periods, create an environment more favorable for the development of the pathogen and contribute to the spread of wheat blast in regions previously free from the disease. A disease simulation data projected the spread of wheat blast for the Southern Hemisphere and Tropics by 2040-2070 as potentially resulting in a 13% annual reduction in global wheat production (Pequeno et al., 2024). Few cultivars show a lasting resistance to the disease, which is nonexistent at the young plant stage (Cruz et al., 2010; Torres et al., 2022). There is no correlation between the severity of blast in young and adult plants. Nonetheless, recognizing PAL gene and understanding the changes in its expression during infection could be promising for the development of new strategies, to contain the spread of wheat blast.
The aim of this work was to quantify the expression of the PAL gene, designed from TraesCS1D03G0078900 (located on Chr1D), in young wheat plants challenged with Pyricularia oryzae.
The work was carried out at the Universidade Federal do Pampa, in the municipality of Itaqui, RS, Brazil (29º09'22"S, 56º33'03"W, at 57 m altitude). Seed of the wheat cultivar BRS Louro were surface-disinfected in NaOCl (10%) for 3 min, rinsed thoroughly in sterilized water, and sown in plastic pots (400 mL) filled with substrate composed of biosynthesized Pinnus bark, vermiculite, charcoal mill, water and phenolic foam. The plants were fertilized weekly with Hoagland & Arnon (1950) nutrient solution. Plants with three fully expanded leaves at stage 13 (Zadoks et al., 1974) were inoculated with a conidial suspension at 1 x 105 conidia mL-1 P. oryzae. Thirty minutes after inoculation, the plants were transferred to a growth chamber set to 25±2 ºC, at 90±5% relative humidity, and darkness for 24 hours. After that, the plants were transferred to the laboratory and kept under ambient condition (±23 ºC) until the end of the experiment.
For gene expression analyses, the sections showing blast symptoms on the third leaf of each plant were collected at 48, 72, 96, and 120 HAI. Leaves were frozen in liquid nitrogen, and total RNA was extracted using the SV Total RNA Isolation System kit (Promega, Madison, WI, USA), following the manufacturer’s recommendations. The concentration of total RNA was measured using a NanoVue Plus spectrophotometer (GE Healthcare Ltd, Little Chalfont, Buckinghamshire, UK), and RNA quality was assessed by examining the integrity of ribosomal RNA bands in 1.5% agarose gel. First-strand cDNA synthesis was performed from 5 µg of total RNA, using the GoScript reverse transcriptase (Promega) and an Oligo (dT)12-18 primer, according to the manufacturer’s recommendations. The PAL (E4.3.1.24) gene sequence was obtained from the literature (Zhang et al., 2011). The forward (5-3) primer sequence was CGTCAAGAGCTGTGTGAAGATGG, and the reverse (5-3) primer sequence was GGTAGTTGGAGCTGCAAGGGTC. These primers were designed based on the accession TraesCS1D03G0078900, transcript TraesCS1D03G0078900.1, located on Chr1D20552688.20561537 reverse. Ubiquitin was used as the internal reference gene (Van Riet et al., 2006). The forward (5-3) primer sequence for ubiquitin was CCTTCACTTGGTTCTCCGTCT, and the reverse (5-3) primer sequence was AACGACCAGGACGACAGACACA. Reactions using RT-qPCR (20 µL) were prepared with the following components: 10 µL of 2x SYBR Green PCR Master Mix (Qiagen, Germantown, MD, USA), 5 µL cDNA (20 ng µL-1), 2 µL ROX, 0.8 µL PAL primers (10 µmol L-1), 1.2 µL of UBI primers (10 µ mol L-1), and water, to reach the final volume. The amplification conditions were performed according to the manufacturer’s recommendations on a StepOne Real-Time PCR System instrument (Life Technologies, Carlsbad, CA, USA). Single-fragment amplification was verified by dissociation curve analysis. Relative expression levels were calculated using the 2∆∆ct method (Livak & Schmittgen, 2001). The experiment was carried out in a completely randomized design, with four replicates. Each replicate consisted of six plants in a plastic pot. Noninoculated plants were designated as the control. Gene expression data were subjected to the analysis of variance. To study the relationship between HAI (x) and gene expression (y), the exponential nonlinear regression model was used, whose equation is y = a × exp (b × x), where the constants a and b are parameters estimated by the least squares method. The model adjustment and the parameter estimations were done using the R software (R Core Team, 2024). Blast severity was evaluated on the third leaf from the base of the plant, using a diagrammatic scale with severity values from 0 to 100%. The experiment was repeated once.
At 48 HAI, plants exhibited 10% to 15% of the leaf area with chlorotic lesions, which gradually evolved into necrotic lesions, covering approximately 90% of the leaf area by 120 HAI (Figures 1A and 1B). The expression of the PAL gene was higher in plants inoculated with P. oryzae than the noninoculated control plants. No significant difference in the PAL gene expression (ranging from 3.6 to 0.84 fold) was observed across the collection periods of the experiment. However, an exponential reduction of the expression was noted as the HAI increased (Figure 1 C). For each additional HAI, the expression decreased by 0.0291, approximately 3%. At 48 HAI, the first blast symptoms appeared on the leaves, and the PAL expression increased (3.6 fold).
Wheat (Triticum aestivum) BRS Louro cultivar inoculated with Pyricularia oryzae at the following times: A, 48 hours after inoculation (HAI); B, 120 HAI; C, relative quantification of the PAL gene expression on leaves, from 48 to 120 HAI. Photos by Maria Fernanda Antunes da Cruz.
According to Cruz et al. (2016) the infection process by P. oryzae on wheat is characterized by the germination of conidia around 6 HAI, appressorium differentiation at 12 HAI, and degradation of waxes on the leaves surface, caused by enzymes released by the fungus. And, from 36 HAI to 72 HAI, conidium and appressorium were dehydrated and withered (Cruz et al., 2016). At 48 HAI, the percentage of colony formation of P. oryzae oryzae in the leaves of the wheat cultivars Anahuac (susceptible), Ônix, BRS 229, and BR 18 was 71%, 43%, 18%, and 2%, respectively (Chaves et al., 2022). Therefore, the expression at 48 HAI is closely linked to the recognition of the pathogen by the plant and to the plant attempt to activate its defense pathways to prevent or reduce colonization, even in a susceptible genotype.
Rios et al. (2014) verified an increase in PAL enzyme activity at 48 HAI in young plants of the BR 18 (susceptible) and BRS 229 (moderately resistant) wheat cultivars. This observation indicates that the gene expression is effectively translated into protein, at the beginning of the infectious process in both cultivars, especially in the susceptible one.
Using scanning electron microscopy (SEM), Cruz et al. (2016) observed an extensive colonization of P. oryzae on wheat leaf tissues, and the initiation of leaf degradation at 96 HAI, and by 120 HAI, numerous conidiophores and conidia occupied part of the necrotic tissue, along with germinated conidia.
In the present study, the expression levels were downregulated, after 48 HAI, by approximately 2.5 fold until the end of the experiment 120 HAI, suggesting that the reduced expression correlates with a greater extent of pathogen colonization and disease severity in the BRS Louro. This cultivar shows variation for the degree of severity in young plants, when challenged with different Pyricularia isolates (Lorenset et al., 2021); however, in the present study, it was highly susceptible.
Recently, Zhan et al. (2022) conducted a multigenome analysis of the PAL gene family in wheat, and they verified different expression patterns for various diseases. When subjected to the inoculation of Fusarium graminearum, Puccinia striiformis, and powdery mildew, ten PAL genes were highly induced, which were identified as TaPAL3, TaPAL10, TaPAL13, TaPAL14, TaPAL17, TaPAL30, TaPAL31, TaPAL32, TaPAL42, and TaPAL48.
The gene used in the present experiment corresponds to the TaPAL11 from the study conducted by Zhan et al. (2022), whose RNA-seq analysis showed that this gene was not differentially expressed in the following situations: in wheat spikelets at anthesis, inoculated with F. graminearum at 3, 6, 12, 24, 36, and 48 HAI; and in 7-day-old leaves inoculated with rust and powdery mildew at 24, 48, and 72 HAI.
Similar results were found in the present study from young plants inoculated with P. oryzae. Putative cis-regulatory elements were identified in the promoter region of TaPAL genes (Zhan et al., 2022). In TaPAL11, regulatory elements were associated with growth and development (33), biotic and abiotic stress (6), and phytohormones (10).
In the present work, no differential expression was observed for PAL gene in young plants. However, in an experiment with adult plants, Cruz et al. (2015) observed differential expression of the gene in the flag leaves of the BR 18 wheat cultivar challenged with Pyricularia at 24, 48, 72, 96 HAI, in comparison with control plants.
BR 18 Terena is a Brazilian wheat cultivar that has shown quantitative resistance to blast in adult wheat, and it has been widely used in breeding programs since its release in 1986 (Ceresine et al., 2019; Goddard et al., 2020; Torres et al., 2022). When analyzing the transcriptome of 14-day-old wheat seedlings inoculated with adapted and nonadapted Pyricularia isolates, Tufan et al. (2009) found differential expression of PAL only at 4 HAI, in seedlings challenged with the nonadapted isolates. There was a difference in the expression between the adapted isolates at sampling times, and the highest expression occurred between 18 and 24 HAI. However, there was no difference in the expression of the PAL gene at 48 and 72 HAI, in the genotype considered partially resistant to blast (Tufan et al., 2009). Early induction of PAL may indicate the deposition of phenolic compounds in the halo structure, beneath the non-virulent isolate only. Our research data corroborates with the observations made by Tufan et al. (2009) at 48 and 72 HAI in the genotype BRS Louro.
According to Rasool et al. (2021) and Zhan et al. (2022), more than 50 PAL genes have been identified in wheat. However, it is not yet known which specific genes they are or what expression patterns to expect in their interactions with different pathogens.
The PAL gene sequence on 1D chromosome used in the present study was upregulated, comparison with the control plants. Even in susceptible plants, there was an increase in the gene transcription above basal levels up to 120 HAI with Pyricularia. The reduction of the gene expression after 48 HAI reflects an increased tissue colonization by the pathogen. In other words, without the activation of the phenylpropanoid pathway, which leads to the production of flavonoids and lignin, the fungal hyphae can spread more easily through the tissue, causing extensive areas of necrosis.
Although PAL genes are not the only ones involved in plant defense responses to pathogens, their activation in young wheat plants at the beginning of Pyricularia infection appears to be related to a potential resistance response to blast (Tufan et al., 2009). In young plants, wheat genotypes resistant to blast have limited the defense mechanisms, which are related to the inhibition of conidial germination, as well as to the growth of infective structures, the formation of appressoria, and the production of physical and chemical barriers (Chaves et al., 2022). In this context, some questions still need further investigation, such as follows: Which genes from the PAL family are involved in the wheat blast resistance? Would these genes be efficient for selecting resistant cultivars at different stages of plant development? What are the transcription factors involved in PAL gene expression in the wheat-Pyricularia interaction? How do these transcription factors modulate the expression of the PAL gene? Are these transcription factors present in both young and adult plants?
Therefore, the PAL gene located on chromosome 1D is upregulated in BRS Louro cultivar; however, it is not efficient in restricting Pyricularia oryzae colonization.
Declaration of use of AI technologies
No generative artificial intelligence (AI) was used in this study.
Acknowledgments
To Universidade Federal do Pampa, Prorectorate of Research and Posgraduation, for assistance in acquiring the reagents.
Disclaimer/Publisher’s note
The statements, opinions, and data contained in all texts published in Pesquisa Agropecuária Brasileira (PAB) are solely those of the individual author(s) and not of the journal’s publisher, editor, and editorial team, who disclaim responsibility for any injury to people or property resulting from any referred ideas, methods, instructions, or products.
The mention of specific chemical products, machines, and commercial equipment in the texts published in this journal does not imply their recommendation by the publisher.
Data availability statement
The data supporting the findings of this study are available in the article. Should any raw data be needed, they will be provided by the corresponding author upon reasonable request.
References
-
ARABI, M.I.E.; ALEK, H.; JAWHAR, M.; AL-SHEHADAH, E. Expression of PAL and PR2 pathogenesis related genes in barley plants challenged with closely related Pyrenophora species. Cereal Research Communications, v.48, p.211-216, 2020. DOI: https://doi.org/10.1007/s42976-020-00033-0
» https://doi.org/10.1007/s42976-020-00033-0 -
CERESINI, P.C.; CASTROAGUDÍN, V.L.; RODRIGUES, F.Á.; RIOS, J.A.; AUCIQUE-PÉREZ, C.E.; MOREIRA, S.I.; CROLL, D.; ALVES, E.; CARVALHO, G. de; MACIEL, J.L.N.; MCDONALD, B.A. Wheat blast: from its origins in South America to its emergence as a global threat. Molecular Plant Pathology, v.20, p.155-172, 2019. DOI: https://doi.org/10.1111/mpp.12747
» https://doi.org/10.1111/mpp.12747 -
CHAVES, M.S.; ANTUNES, M.B.; SILVA, G.B.P. da; GRAICHEN, F.A.S.; TORRES, G.A.M.; MARTINELLI, J.A. Pre and post stage of infection of Magnaporthe oryzae Oryza in wheat leaves with different resistance levels. Brazilian Journal Microbiology, v.53, p.1091-1100, 2022. DOI: https://doi.org/10.1007/s42770-022-00749-7
» https://doi.org/10.1007/s42770-022-00749-7 -
CRUZ, M.F.A.; DEBONA, D.; RIOS, J.A.; BARROS, E.G.; RODRIGUES, F.A. Potentiation of defense-related gene expression by silicon increases wheat resistance to leaf blast. Tropical Plant Pathology, v.40, p.394-400, 2015. DOI: https://doi.org/10.1007/s40858-015-0051-7
» https://doi.org/10.1007/s40858-015-0051-7 -
CRUZ, M.F.A.; PRESTES, A.M.; MACIEL, J.L.N.; SCHEEREN, P.L. Resistência parcial à brusone de genótipos de trigo comum e sintético nos estádios de planta jovem e de planta adulta. Tropical Plant Pathology, v.35, p.24-31, 2010. DOI: https://doi.org/10.1590/S1982-56762010000100004
» https://doi.org/10.1590/S1982-56762010000100004 -
CRUZ, M.F.A.; RIOS, J.A.; ARAUJO, L.; RODRIGUES, F.A. Infection process of Pyricularia oryzae on the leaves of wheat seedlings. Tropical Plant Pathology, v.41, p.123-127, 2016. DOI: https://doi.org/10.1007/s40858-016-0068-6
» https://doi.org/10.1007/s40858-016-0068-6 -
FERRER, J.-L.; AUSTIN, M.B.; STEWART JR., C.; NOEL, J.P. Structure and function of enzymes involved in the biosynthesis of phenylpropanoids. Plant Physiology and Biochemistry, v.46, p.356-370, 2008. DOI: https://doi.org/10.1016/j.plaphy.2007.12.009
» https://doi.org/10.1016/j.plaphy.2007.12.009 -
GODDARD, R.; STEED, A.; CHINOY, C.; FERREIRA, J.R.; SCHEEREN, P.L.; MACIEL, J.L.N.; CAIERÃO, E.; TORRES, G.A.M.; CONSOLI, L.; SANTANA, F.M.; FERNANDES, J.M.C.; SIMMONDS, J.; UAUY, C.; COCKRAM, J.; NICHOLSON, P. Dissecting the genetic basis of wheat blast resistance in the Brazilian wheat cultivar BR 18-Terena. BMC Plant Biology, v.20, art.398, 2020. DOI: https://doi.org/10.1186/s12870-020-02592-0
» https://doi.org/10.1186/s12870-020-02592-0 - HOAGLAND, D.R.; ARNON, D.I. The water culture method for growing plants without soil Berkeley: University of California, 1950. 32p. (California Agricultural Experiment Station. Circular, 347).
-
HUANG, J.; GU, M.; LAI, Z.; FAN, B.; SHI, K.; ZHOU, Y.-H.; YU, J.-Q; CHEN, Z. Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Physiology, v.153, p.1526-1538, 2010. DOI: https://doi.org/10.1104/pp.110.157370
» https://doi.org/10.1104/pp.110.157370 -
LIVAK, K.J.; SCHMITTGEN, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆CT method. Methods, v.25, p.402-408, 2001. DOI: https://doi.org/10.1006/meth.2001.1262
» https://doi.org/10.1006/meth.2001.1262 -
LORENSET, M. da S.; CANABARRO, R.; BERGMANN, M.; CRUZ, M.F.A. da. Diversity of virulence of Pyricularia oryzae isolates obtained from a single lesion of wheat. Revista Ceres, v.68, p.115-119, 2021. DOI: https://doi.org/10.1590/0034-737X202168020004
» https://doi.org/10.1590/0034-737X202168020004 -
PEQUENO, D.N.L.; FERREIRA, T.B.; FERNANDES, J.M.C.; SINGH, P.K.; PAVAN, W.; SONDER, K.; ROBERTSON, R.; KRUPNIK, T.J.; ERENSTEIN, O.; ASSENG, S. Production vulnerability to wheat blast disease under climate change. Nature Climate Change, v.14, p.178-183, 2024. DOI: https://doi.org/10.1038/s41558-023-01902-2
» https://doi.org/10.1038/s41558-023-01902-2 - R CORE TEAM. R: a language and environment for statistical computing. Vienna: R Foundation for Statistical Computing, 2024.
-
RASOOL, F.; UZAIR, M.; NAEEM, M.K.; REHMAN, N.; AFROZ, A.; SHAH, H.; KHAN, M.R. Phenylalanine ammonia-lyase (PAL) genes family in wheat (Triticum aestivum L.): genome-wide characterization and expression profiling. Agronomy, v.11, art.2511, 2021. DOI: https://doi.org/10.3390/agronomy11122511
» https://doi.org/10.3390/agronomy11122511 -
RIOS, J.A.; RODRIGUES, F.Á.; DEBONA, D.; RESENDE, R.S.; MOREIRA, W.R.; ANDRADE, C.C.L. Induction of resistance to Pyricularia oryzae in wheat by acibenzolar-S-methyl, ethylene and jasmonic acid. Tropical Plant Pathology, v.39, p.224-233, 2014. DOI: https://doi.org/10.1590/S1982-56762014000300006
» https://doi.org/10.1590/S1982-56762014000300006 -
TORRES, G.A.M.; FERREIRA, J.R.; BINNECK, E.; MACIEL, J.L.N.; CONSOLI, L. Blast disease and wheat production in Brazil. Pesquisa Agropecuária Brasileira, v.57, e02487, 2022. DOI: https://doi.org/10.1590/S1678-3921.pab2022.v57.02487
» https://doi.org/10.1590/S1678-3921.pab2022.v57.02487 -
TUFAN, H.A.; MCGRANN, G.R.D.; MAGUSIN, A.; MOREL, J.-B.; MICHÉ, L.; BOYD, L.A. Wheat blast: histopathology and transcriptome reprogramming in response to adapted and non-adapted Magnaporthe isolates. New Phytologist, v.184, p.473-484, 2009. DOI: https://doi.org/10.1111/j.1469-8137.2009.02970.x
» https://doi.org/10.1111/j.1469-8137.2009.02970.x -
VAN RIET, L.; NAGARAJ, V.; VAN DEN ENDE, W.; CLERENS, S.; WIEMKEN, A.; VAN LAERE, A. Purification, cloning and functional characterization of a fructan 6-exohydrolase from wheat (Triticum aestivum L.). Journal of Experimental Botany, v.57, p.213-223, 2006. DOI: https://doi.org/10.1093/jxb/erj031
» https://doi.org/10.1093/jxb/erj031 -
YANG, X.; GU, X.; DING, J.; YAO, L.; GAO, X.; ZHANG, M.; MENG, Q.; WEI, S.; FU, J. Gene expression analysis of resistant and susceptible rice cultivars to sheath blight after inoculation with Rhizoctonia solani BMC Genomics, v.23, art.278, 2022. DOI: https://doi.org/10.1186/s12864-022-08524-6
» https://doi.org/10.1186/s12864-022-08524-6 -
ZADOKS, J.C.; CHANG, T.T.; KONZAK, C.F. A decimal code for the growth stages of cereals. Weed Research, v.14, p.415-421, 1974. DOI: https://doi.org/10.1111/j.1365-3180.1974.tb01084.x
» https://doi.org/10.1111/j.1365-3180.1974.tb01084.x -
ZHAN, C.; LI, Y.; LI, H.; WANG, M.; GONG, S.; MA, D.; LI, Y. Phylogenomic analysis of phenylalanine ammonia-lyase (PAL) multigene family and their differential expression analysis in wheat (Triticum aestivum L.) suggested their roles during different stress responses. Frontiers in Plant Science, v.13, art.982457, 2022. DOI: https://doi.org/10.3389/fpls.2022.982457
» https://doi.org/10.3389/fpls.2022.982457 -
ZHANG, H.; WANG, C.; CHENG, Y.; WANG, X.; LI, F.; HAN, Q.; XU, J.; CHEN, X.; HUANG, L.; WEI, G.; KANG, Z. Histological and molecular studies of the non-host interaction between wheat and Uromyces fabae Planta, v.234, p.979-991, 2011. DOI: https://doi.org/10.1007/s00425-011-1453-5
» https://doi.org/10.1007/s00425-011-1453-5
-
Chief editor:
Edemar Corazza
-
Edited by:
Célia Tremacoldi
