Open-access Alelle number and heterozigosity for microsatellite loci in different stingless bee species (Hymenoptera: Apidae, Meliponini)

Número de alelos e heterozigose para locos de microssatélites em diferentes espécies de abelhas sem ferrão (Hymenoptera: Apidae, Meliponini)

Abstract

In the present study we compare genetic characteristics (allele diversity and observed heterozygosity) of microsatellite loci, from three stingless bee species (Plebeia remota Holmberg, Partamona mulata Moure In Camargo and Partamona helleri Friese), amplified by using heterospecific primers originally designed for Melipona bicolor Lepeletier and Scaptotrigona postica Latreille. We analyzed 360 individuals of P. remota from 72 nests, 58 individuals of P. mulata from 58 nests, and 47 individuals of P. helleri from 47 nests. The three species studied showed low level of polymorphism for the loci amplified with primers derived from M. bicolor. However, for the loci amplified with primers derived from S. postica, only P. remota presented low level of polymorphism.

Plebeia remota; Partamona mulata; Partamona helleri; heterozygosity; polymorphism


Resumo

No presente trabalho compararam-se as características de locos de microssatélite, como diversidade alélica e taxa de heterozigose observada, de três espécies de abelhas sem ferrão (Plebeia remota Holmberg, Partamona mulata Moure In Camargo e Partamona helleri Friese), amplificados com oligonucleotídeos heteroespecíficos originalmente desenhados para Melipona bicolor Lepeletier e Scaptotrigona postica Latreille. Foram analisados 360 indivíduos de P. remota de 72 ninhos, 58 indivíduos de P. mulata de 58 ninhos e 47 indivíduos de P. helleri de 47 ninhos. As três espécies apresentaram baixo nível de polimorfismo para locos amplificados com oligonucleotídeos derivados de Melipona bicolor. Entretanto, para os locos amplificados com oligonucleotídeos derivados de S. postica, somente P. remota apresentou baixo nível de polimorfismo.

Plebeia remota; Partamona mulata; Partamona helleri; taxa de heterozigose; polimorfismo


SYSTEMATICS, MORPHOLOGY AND PHYSIOLOGY

Alelle number and heterozigosity for microsatellite loci in different stingless bee species (Hymenoptera: Apidae, Meliponini)

Número de alelos e heterozigose para locos de microssatélites em diferentes espécies de abelhas sem ferrão (Hymenoptera: Apidae, Meliponini)

Flávio de O. Francisco; Rute M. Brito; Maria C. Arias

Depto. Genética e Biologia Evolutiva, Instituto de Biociências, Univ. São Paulo, 05508-090, São Paulo, SP mcarias@ib.usp.br

ABSTRACT

In the present study we compare genetic characteristics (allele diversity and observed heterozygosity) of microsatellite loci, from three stingless bee species (Plebeia remota Holmberg, Partamona mulata Moure In Camargo and Partamona helleri Friese), amplified by using heterospecific primers originally designed for Melipona bicolor Lepeletier and Scaptotrigona postica Latreille. We analyzed 360 individuals of P. remota from 72 nests, 58 individuals of P. mulata from 58 nests, and 47 individuals of P. helleri from 47 nests. The three species studied showed low level of polymorphism for the loci amplified with primers derived from M. bicolor. However, for the loci amplified with primers derived from S. postica, only P. remota presented low level of polymorphism.

Key words:Plebeia remota, Partamona mulata, Partamona helleri, heterozygosity, polymorphism

RESUMO

No presente trabalho compararam-se as características de locos de microssatélite, como diversidade alélica e taxa de heterozigose observada, de três espécies de abelhas sem ferrão (Plebeia remota Holmberg, Partamona mulata Moure In Camargo e Partamona helleri Friese), amplificados com oligonucleotídeos heteroespecíficos originalmente desenhados para Melipona bicolor Lepeletier e Scaptotrigona postica Latreille. Foram analisados 360 indivíduos de P. remota de 72 ninhos, 58 indivíduos de P. mulata de 58 ninhos e 47 indivíduos de P. helleri de 47 ninhos. As três espécies apresentaram baixo nível de polimorfismo para locos amplificados com oligonucleotídeos derivados de Melipona bicolor. Entretanto, para os locos amplificados com oligonucleotídeos derivados de S. postica, somente P. remota apresentou baixo nível de polimorfismo.

Palavras-chave: Plebeia remota, Partamona mulata, Partamona helleri, taxa de heterozigose, polimorfismo

Currently, the term microsatellite is widely accepted to assign sequence repeats involving a small number of bases (Hancock 1999). These repeated sequences are randomly distributed along the euchromatic regions (Schlötterer & Wiehe 1999), but are rare in coding regions (Hancock 1999). Microsatellites have been described in all organisms studied (Hancock 1999), and are also present in plasmids, mitochondrial, and plastidial genomes (Filutowicz et al. 1994, Powell et al. 1995, Soranzo et al. 1999).

Usually microsatellites are PCR amplified by using primers located in conserved regions flanking the repeats (Weber & May 1989, Strassmann et al. 1996). According to Goldstein & Schlötterer (1999), they can be classified as: perfect (sequence of bases repeated with no interruption - CTCTCTCTCT); imperfect (one or more repeats having a different base pair of the repeat structure - CTCTCACTCT); interrupted (insertion of a small number of base pairs different from the repeat structure - CTCTCAAACTCT); and compound (two or more adjacent microsatellites with different repeat sequences - CTCTCTCTCTGATGATGATGAT).

It has been postulated that interrupted microsatellites are more stable than the perfect ones, and in consequence they present less alleles (Chung et al. 1993, Pépin et al. 1995). This is explained by the presence of extra bases in the repeat, which would contribute to diminish the possible error during the DNA replication (Weber 1990). However the mutation rate of microsatellites is highly variable and depends either on the number and type of repeats and on their base composition (Chakraborty et al. 1997, Estoup & Cornuet 1999). Moreover, the genome type and organism where the microsatellites are located also seem to interfere. Microsatellites in nuclear chromosomes showed more stable than identical microsatellites in plasmids (Henderson & Petes 1992, Eisen 1999); in humans the mutation rate can reach 1.5 ´ 10-2 per locus per gamete per generation (Aiciolu et al. 2004) or even 3.5 ´ 10-3 (Nikitina et al. 2005), and in Drosophila, 6.3 ´ 10-6 (Schug et al. 1997). Although different types of mutation may occur in the microsatellite sequence, changes in the number of repeats are the most frequent (Eisen 1999).

Microsatellite is a molecular marker considered codominant, selectively neutral, highly polymorphic, and show mendelian inheritance (Strassmann et al. 1996). Due to these characteristics they have been extremely useful in gene mapping studies, relatedness, parentage, intraspecific variation, species hybridization, population dynamic, and phylogeography (Moritz & Hillis 1996, Chakraborty & Kimmel 1999). Also they have been used to evaluate the impact of the reproductive behavior, social structure, and dispersion in endangered populations (Beaumont & Bruford 1999). At population level the microsatellite high polymorphism is considered as a consequence of new mutations, genetic drift, and selection in genes linked to the repetitive sequences (Schlötterer & Wiehe 1999).

In bees, primers for microsatellite loci and respective amplifications were first described for Apis mellifera L. and Bombus terrestris L. (Estoup et al. 1993). Later, microsatellite primers for three stingless bee species, Melipona bicolor (Peters et al. 1998), Scaptotrigona postica (Paxton et al. 1999a), and Trigona carbonaria Smith (Green et al. 2001) were described. Subsequently, population, ecological and evolutionary studies were developed (Paxton et al. 1999b, Tóth et al. 2003, Cameron et al. 2004, Franck et al. 2004).

Most of the biological inferences derived from microssatelite data are based on allele and genotype diversity and heterozygosity index. In this work we compared the number of microsatellite alleles and observed heterozygosity (HO) among three stingless bee species (Plebeia remota Holmberg, Partamona mulata Moure In Camargo and Partamona helleri Friese) and also with data from other Meliponini species already described in the literature (Peters et al. 1998, Paxton et al. 1999a). Considering that most of the loci are amplified by heterospecific primers, although all from bees, the level of information differs from locus to locus and also among the species. The compilation of these data provides guidance for the use of these loci in other bee species.

Material and Methods

The species studied were P. remota (360 individuals from 72 nests), P. mulata (58 individuals from 58 nests), and P. helleri (47 individuals from 47 nests). The collecting sites are presented in Table 1. DNA template for PCR reactions was extracted by Chelex method (Walsh et al. 1991).

The bees were scored using heterospecific microsatellite primers described for M. bicolor: Mbi28AAG, Mbi32GAG, Mbi33AAG, Mbi201AAG, Mbi215AAG, Mbi218AAG, Mbi254AAG, Mbi259AAG, Mbi278AAG, Mbi522CAG (Mbi set) (Peters et al. 1998), and S. postica: T3-32, T4-171, and T7-5 (T set) (Paxton et al. 1999a).

Amplifications were performed through PCR in 10 µl reaction volume using 2 µl of DNA template, 1 µl of PCR buffer, 0.3 µl of MgCl2 (50 mM), 0.2 µl of each primer (20µM), 0.5 µl of dNTPs (2 mM each), 1 U of Taq DNA polymerase (Gibco-BRL) and sterile water to achieve the final volume. The PCR amplifications consisted of an initial denaturation at 93°C/4 min, followed by 30 to 40 cycles at 93°C/40 s for denaturing the DNA, 50 s at the appropriate temperature for annealing (Table 2) and 72°C/40 s for elongation. An additional final extension step of 72°C/5 min was performed. The PCR products for Mbi and T primer sets were separated by electrophoresis on 5.6% and 9% polyacrylamide gels, respectively. Size of the amplified microsatellite alleles was estimated by comparison with standard molecular weight marker (10 bp ladder).

Results and Discussion

Table 3 presents the observed heterozygosity (HO) values and number of alleles, for the loci amplified with primers described for M. bicolor, verified in P. remota, P. mulata, P. helleri, and in other four meliponini species (Peters et al. 1998). It is worth to point out that Mbi28AAG and Mbi33AAG heterozygotes were reported only in M. bicolor and P. helleri, respectively. All seven species showed heterozygotes for the locus Mbi259AAG and no heterozygotes were found for the locus Mbi522CAG. P. mulata presented HO = 0 for all loci but Mbi201AAG and Mbi278AAG. The highest number of alleles (six) was found in P. remota for the loci Mbi259AAG and Mbi278AAG.

Table 4 shows HO values and number of alleles observed in P. remota, P. mulata, P. helleri, and in other seven meliponini species (Paxton et al. 1999a) for the loci derived from S. postica (Paxton et al. 1999a). All individuals of P. helleri were heterozygotes for the locus T4-171. The locus T7-5 was monomorphic in P. remota and, in general, no high number of alleles was found in any species but in S. postica and P. mulata.

The number of individuals and nests did not interfere in the number of alleles found (Tables 3 and 4), although, according to Nei (1987), a high number of alleles is detected when high number of individuals is analyzed. In general, the number of alleles and the HO values were higher on the species for which the microsatellite primers were designed from.

As already mentioned, perfect microsatellites have more alleles than interrupted ones with a similar number of repeats (Chung et al. 1993, Pépin et al. 1995). The interruptions seem to stabilize the microsatellites, diminishing the error possibility during the replication (Weber 1990). However, two loci (Mbi259AAG and Mbi278AAG) classified as compound and interrupted, presented the highest number of alleles in Plebeia remota. In this species, the loci Mbi254AAG and T7-5 (perfects in the original species) were monomorphic.

The alleles from loci T3-32, T4-171, and T7-5 are two bases repeat. According to Chakraborty et al. (1997), this type of repeat evolves in a higher rate than those of three and four bases. This means that these loci should have more alleles than the others analyzed. In fact this is observed for P. helleri and P. mulata, and also in S. postica (Paxton et al. 1999a).

In a general view, none of the three species studied here showed high level of polymorphism for the primers designed for M. bicolor. Nonetheless for the primers derived from S. postica, P. remota was the only species that did not present high level of polymorphism.

One factor that leads to a low level of polymorphism or to a heterozygote deficit would be the occurrence of null alleles (Callen et al. 1993). The use of heterospecfic primers may contribute to this (Pépin et al. 1995). According to Callen et al. (1993), null alleles and population subdivision are the main factors that lead to a heterozygotes deficiency under the premises of Hardy-Weinberg equilibrium.

Size homoplasy can lead to polymorphism reduction either. Viard et al. (1998) observed that in A. mellifera and B. terrestris, size homoplasy is more common between than within populations. These authors showed also that the presence of size homoplasy can modify phylogenetic reconstructions. According to Estoup et al. (1995) not perfect microsatellites would be less susceptible to size homoplasy and more polymorphic than the perfect ones. This latter evidence contradicts other authors (Chung et al. 1993, Pépin et al. 1995). Considering that the loci amplified for the species studied here present the same repeat characteristics as described in the original species, the results obtained from P. remota are in agreement with postulated by Estoup et al. (1995), and the results from P. mulata and P. helleri are in concordance with Chung et al. (1993) and Pépin et al. (1995).

Nowadays, microsatellites are being applied in a great variety of studies mainly because of their high polymorphism, however the effectiveness of this marker depends on HO values. Several evolutionary inferences like extinction probability or effective population size are made based on these values. Therefore, it is important to be aware if heterozygote lack is a reflex of the natural population history or just an "artifact" due to the marker chosen.

We conclude that heterospecific primers can be used but with caution since the genetic variability found here, for the three stingless bees, was low when compared to the polymorphism detected in other organisms by using homospecific primers (Simonsen et al. 1998, Widmer et al. 1998, Franck et al. 2001). Despite the low variability detected, this molecular marker is already contributing to our understanding of genetic structure and dynamics of natural populations of stingless bees (data not shown). The design of homospecific primers, which implies in genomic library construction, and also additional data from other molecular markers such as RFLP of mitochondrial DNA, would certainly improve the knowledge of population dynamics and evolution of stingless bees.

Acknowledgements

We thank Sebastião Gonzaga, Geraldo Moretto, Lauro Muegge, Carlos Chociai, Eduardo Mattos, Lucio A. O. Campos, Jaime Martina, João Lousano, Odilon Rabelo and Laboratório de Abelhas-IBUSP for providing the bees, and Susy Coelho for technical assistance. We are grateful to Núcleo de Estudo da Fauna (NIEFA) – Universidade Federal de Mato Grosso for the great cooperation. This work was supported by FAPESP.

Received 23/VIII/05.

Accepted 21/II/06.

References

  • Asicioglu F., F. Oguz-Savran & U. Özbek. 2004. Mutation rate at commonly used forensic STR loci: Paternity testing experience. Dis. Markers 20: 313-315.
  • Beaumont, M.A. & M.W. Bruford. 1999. Microsatellites in conservation genetics, p.165-182. In D.B. Goldstein & C. Schlötterer (eds.), Microsatellites: Evolution and applications. Oxford University Press, New York, 368p.
  • Callen, D.F., A.D. Thompson, Y. Shen, H.A. Phillips, R.I. Richards, J.C. Mulley & G.R. Sutherland. 1993. Incidence and origin of "null" alleles in the (AC)n microsatellite markers. Am. J. Hum. Genet. 52: 922-927.
  • Cameron, E.C., P. Franck & B.P. Oldroyd. 2004. Genetic structure of nest aggregations and drone congregations of the southeast Asian stingless bee Trigona collina Mol. Ecol. 13: 2357-2364.
  • Chakraborty, R. & M. Kimmel. 1999. Statistics of microsatellite loci: Estimation of mutation rate and pattern of population expansion, p.139-150. In D.B. Goldstein & C. Schlötterer (eds.), Microsatellites: Evolution and applications. Oxford University Press, New York, 368p.
  • Chakraborty, R., M. Kimmel, D.N. Stivers, L.J. Davison & R. Deka. 1997. Relative mutation rates at di-, tri-, and tetranucleotide microsatellite loci. Proc. Natl. Acad. Sci. USA 94: 1041-1046.
  • Chung, M., L.P.W. Ranum, L.A. Duvick, A. Servadio, H.Y. Zoghbi & H.T. Orr. 1993. Evidence for a mechanism predisposing to intergenerational CAG repeat instability in spinocerebellar ataxia type I. Nat. Genet. 5: 254-258.
  • Eisen, J.A. 1999. Mechanistic basis for microsatellite instability, p.34-48. In D.B. Goldstein & C. Schlötterer (eds.), Microsatellites: Evolution and Applications. Oxford University Press, New York, 368p.
  • Estoup, A. & J.-M. Cornuet. 1999. Microsatellite evolution: Inferences from population data, p.49-65. In D.B. Goldstein & C. Schlötterer (eds.), Microsatellites: Evolution and Applications. Oxford University Press, New York, 368p.
  • Estoup, A., M. Solignac, M. Harry & J.-M. Cornuet. 1993. Characterization of (GT)n and (CT)n microsatellites in two insect species: Apis mellifera and Bombus terrestris Nucleic Acids Res. 21: 1427-1431.
  • Estoup, A., C. Tailliez, J.-M. Cornuet & M. Solignac. 1995. Size homoplasy and mutational processes of interrupted microsatellites in two bee species, Apis mellifera and Bombus terrestris (Apidae). Mol. Biol. Evol. 12: 1074-1084.
  • Filutowicz, M., S. Dellis, I. Levchenko, M. Urh, F. Wu & D. York. 1994. Regulation of replication of an iteron-containing DNA molecule. Prog. Nucleic Acid Res. Mol. Biol. 48: 239-273.
  • Franck, P., E. Cameron, G. Good, J.-Y. Rasplus & B.P. Oldroyd. 2004. Nest architecture and genetic differentiation in a species complex of Australian stingless bees. Mol. Ecol. 13: 2317-2331.
  • Franck, P., L. Garnery, A. Loiseau, B.P. Oldroyd, H.R. Hepburn, M. Solignac & J.-M. Cornuet. 2001. Genetic diversity of the honeybee in Africa: Microsatellite and mitochondrial data. Heredity 86: 420-430.
  • Goldstein, D.B. & C. Schlötterer. 1999. Microsatellites: Evolution and Applications. Oxford University Press, New York, 368p.
  • Green, C.L., P. Franck & B.P. Oldroyd. 2001. Characterization of microsatellite loci for Trigona carbonaria, a stingless bee endemic to Australia. Mol. Ecol. Notes 1: 89-92.
  • Hancock, J.M. 1999. Microsatellites and other simple sequences: Genomic context and mutational mechanisms, p.1-9. In D.B. Goldstein & C. Schlötterer (eds.), Microsatellites: Evolution and Applications. Oxford University Press, New York, 368p.
  • Henderson, S.T. & T.D. Petes. 1992. Instability of simple sequence DNA in Saccharomyces cerevisiae Mol. Cel. Biol. 12: 2749-2757.
  • Moritz, C. & D.M. Hillis. 1996. Molecular systematics: Context and controversies, p.1-13. In D.M. Hillis, C. Moritz & B.K. Mable (eds.), Molecular systematics, 2nd edition. Sinauer Associates, Massachusetts, 655p.
  • Nei, M. 1987. Molecular evolutionary genetics. Columbia University Press, New York, 512p.
  • Nikitina, T.V., I.N. Lebedev, N.N. Sukhanova & A.S. Nazarenko. 2005. Germline mutations of tetranucleotide DNA repeats in families with normal children and reproductive pathology. Rus. J. Genet. 41: 770-778.
  • Paxton, R.J., N. WeibSchuh & J.J.G. Quezada-Euán. 1999a. Characterization of dinucleotide microsatellite loci for stingless bees. Mol. Ecol. 8: 690-692.
  • Paxton, R.J., N. WeibSchuh, W. Engels, K. Hartfelder & J.J.G. Quezada-Euán. 1999b. Not only single mating in stingless bees. Naturwissenschaften 86: 143-146.
  • Pépin, L., Y. Amigues, A. Lépingle, J.-L. Berthier, A. Bensaid & D. Vaiman. 1995. Sequence conservation of microsatellites between Bos taurus (cattle), Capra hircus (goat) and related species. Examples of use in parentage testing and phylogeny analysis. Heredity 74: 53-61.
  • Peters, J.M., D.C. Queller, V.L. Imperatriz-Fonseca & J.E. Strassmann. 1998. Microsatellite loci for stingless bees. Mol. Ecol. 7: 784-787.
  • Powell, W., M. Morgante, R. McDevitt, G.G. Vendramin & J.A. Rafalski. 1995. Polymorphic simple sequence repeat regions in chloroplast genomes: applications to the population genetics of pines. Proc. Natl. Acad. Sci. 92: 7759-7763.
  • Schlötterer, C. & T. Wiehe. 1999. Microsatellites, a neutral marker to infer selective sweeps, p.238-248. In D.B. Goldstein & C. Schlötterer (eds.), Microsatellites: Evolution and applications. Oxford University Press, New York, 368p.
  • Schug, M.D., T.F.C. Mackay & C.F. Aquadro. 1997. Low mutation rates of microsatellite loci in Drosophila melanogaster Nature Genet. 15: 99-102.
  • Simonsen, B.T., H.R. Siegismund & P. Arctander. 1998. Population structure of African buffalo inferred from mtDNA sequences and microsatellite loci: High variation but low differentiation. Mol. Ecol. 7: 225-237.
  • Soranzo, N., J. Provan & W. Powell. 1999. An example of microsatellite length variation in the mitochondrial genome of conifers. Genome 42: 158-161.
  • Strassmann, J.E., C.R. Solís, J.M. Peters & D.C. Queller. 1996. Strategies for finding and using highly polymorphic DNA microsatellite loci for studies of genetic relatedness and pedigrees, p.163-178, 528-549. In J.D. Ferraris & S.R. Palumbi (eds.), Molecular methods in zoology and evolution. Wiley-Liss, New York, 580p.
  • Tóth, E., J.E. Strassmann, V.L. Imperatriz-Fonseca & D.C. Queller. 2003. Queens, not workers, produce the males in the stingless bee Schwarziana quadripunctata quadripunctata Anim. Behav. 66: 359-368.
  • Viard, F., P. Franck, M.-P. Dubois, A. Estoup & P. Jarne. 1998. Variation of microsatellite size homoplasy across electromorphs, loci, and populations in three invertebrate species. J. Mol. Evol. 47: 42-51.
  • Walsh, P.S., D.A. Metzeger & R. Higuchi. 1991. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 10: 506-513.
  • Weber, J.L. 1990. Informativeness of human (dC-dA)n×(dG-dT)n polymorphisms. Genomics 7: 524-530.
  • Weber, J.L. & P.E. May. 1989. Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. Am. J. Hum. Genet. 44: 388-396.
  • Widmer, A., P. Schmid-Hempel, A. Estoup & A. Scholl. 1998. Population genetic structure and colonization history of Bombus terrestris s.l. (Hymenoptera: Apidae) from the Canary Islands and Madeira. Heredity 81: 563-572.

Publication Dates

  • Publication in this collection
    11 Dec 2006
  • Date of issue
    Oct 2006

History

  • Received
    23 Aug 2005
  • Accepted
    21 Feb 2006
location_on
Sociedade Entomológica do Brasil Sociedade Entomológica do Brasil, R. Harry Prochet, 55, 86047-040 Londrina PR Brasil, Tel.: (55 43) 3342 3987 - Londrina - PR - Brazil
E-mail: editor@seb.org.br
rss_feed Acompanhe os números deste periódico no seu leitor de RSS
Ir para o topo Reportar erro