Open-access

Vectors 412 - 421
422 - 431
432 - 441
442 - 451 452 - 461
462 - 471
472 - 481 482 - 491
492 - 501
502 - 506

HEMOCYTES FROM UNIFECTED T. INFESTANS CAN PROTECT PARTIALLLY MICE FROM TRYPANOSOMA CRUZI INFECTIONS

Levy, AM1, Toledo Jr, RS, Hoshino Shimizu, , S2, Lourenço AML, Pereira-chioccola, VL1 & Maifrino, LBM

1. Inst. Dante Pazzancse de Cardiologia CP5l2; 2 Inst. Adolfo Lutz São Paulo

2. Hemocytes (HC) of uninfected T infestans were previously shown to be recognized specifícally by sera from patients with chronic Chagas disease in an indirect immunofiuorescence assay (UFA), indicating that infective parasites and HC share common epitopes. Now we found that HC can partially protect niice from a chailenge with T. cruzí. HC were collected from uninfected 5úinstar T. infestans nymphs with an anticoagulant solution and centrifuged. The cell sediment and also the supematant mixed with alumen's adjuvant were inoculated i.p. in three groups of female A/Sn núce, three times at 10-15 days intervals. The first group of mice (HC) receveid 2, 3 and 4 x 106 HC/ml, the second group (BL) receveid 188-200 mgl/o proteins of the hemolymph supcmatant, and the third group which was a control group (C). was inoculated only with alumen's adjuvant (O.5mg/ml). ln order to check the immune response, blood was collected from tail vein and their serum assayed by IFA using HC as antigen. Nfice from the HC group exhibited high lgG antibodies to plasmatocytes and granulocytes. All animais were challenged intraperitoneally with 5 Xlo2 bloodstream trypomastigotes (Y strain) 15 days after the last immunization. Parasiteniia was monitored by Brenner method from 6h just 15'h day after infection, time when circulating parasites were no longer observed in the blood. Parasitemia peaks of the HL and HC groups were observed one or two days after the C group. ln these same period of time both HL and HC groups had significantly low parasitenúa, i.e. ~ 63% lower in comparison to the C group. However the mortality shown by HC and HL groups differed 45 days after infection, being 14% and 43'/o, respectively, though being lower than 56% of the C group. Thus epitopes of hemocytes, which confer partial inununoprotection to the T cruzi infection in mice require to be further identifled and characterized. supportedpartially by CNPQ

DISTURBANCE STRIDULATIONS IN FIVE SPECIES OF TRIATOMINAE

Manrique, G. & Schilman, P.E.

Laboratorio de Fisiología de Insectos, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires. Ciudad Universitaria, (1428) Buenos Aires, Argentina. E-mail: gabo@bg.fcen.uba.ar

Triatomine bugs, like other reduviids, posses a prosternal stridulatory organ which consists of a cuticular, longitudinal groove composed of a number of transverse ridges. Stridulation is produced when the tip of the proboscis is rubbed against the groove. It has been observed that individuals stridulate when disturbed or handled. In addition females stridulate to reject copulatory attempts performed by a male. In this work, disturbance stridulations of Triatoma infestans, T. sordida, T. gusayana, Rhodnius prolixus and Dipetalogaster maximus were compared. The stridulations were produced under restrained conditions, when bugs were clasped with forceps, and slightly pressed dorsally on an accelerometer. The accelerometer output voltage was connected to a charge amplifier and its output was stored on the sound-track of a video recorder. In all cases, the stridulations consisted of long series of repetitive syllables, each composed of two chirps, a long and a short one. The temporal pattern of the stridulations and power spectra for the five species are showed in the table below.

Short-chirp
(ms) Inter-chirp
(ms) Long-chirp
(ms) Intersyllable
(ms) Repetition rate
(syl/sec) Power spectra
(Hz) T. infestans 23.23 ± 0.71 9.08 ± 0.56 33.10 ± 0.95 17.04 ± 1.38 12.29 ± 0.24 1600-3200 R. prolixus 9.29 ± 1.67 10.52 ± 1.41 39.70 ± 1.72 31.67 ± 7.27 11.34 ± 1.64 1900-2900 T. sordida 36.86 ± 2.03 7.42 ± 0.79 55.56 ± 2.28 15.18 ± 2.20 9.64 ± 0.33 1800-2400 D. maximus 11.19 ± 0.70 12.32 ± 0.62 89.01 ± 1.92 60.52 ± 1.99 5.78 ± 0.13 1800-2600 T. guasayana 71.00 ± 1.52 8.61 ± 0.40 98.93 ± 2.53 10.39 ± 0.88 5.22 ± 0.09 1800-2000

Despite of these species having different sizes and also different temporal patterns in their vibrational signal, their power spectra were similar, reaching the main carrier frequency at about 2000 Hz. We consider that disturbance stridulations are defensive responses to attacks from predators. This hypothesis had been postulated for other insects and there is behavioural evidence that they indeed deter predators.

Supported by CONICET, Univ. Buenos Aires/Argentina and UNDP/World Bank/WHO (TDR).

MALE-DETERRING AND DISTURBANCE STRIDULATIONS IN RHODNIUS PROLIXUS

Schilman, P. E. & Manrique, G.

Laboratorio de Fisiología de Insectos, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, (1428) Buenos Aires, Argentina. E-mail: Pablo@bg.fcen.uba.ar

In this study we recorded the substrate-borne stridulatory vibrations produced by Rhodnius prolixus females in two different contexts. Firstly, in the natural context of sexual communication, when females spontaneously stridulate to reject copulatory attempts performed by a male (henceforth called "male-deterring stridulations"). Secondly, in the context of defensive behaviour, when the bugs stridulate if they are clasped or restrained (henceforth: "disturbance stridulations"). In addition, we compared their temporal structure and spectrum. The disturbance stridulations were produced under restrained conditions, when bugs were clasped with forceps, and slightly pressed dorsally on an accelerometer. To record male-deterring stridulations produced by a female, one male and one female were put in a container and allowed to interact freely. The accelerometer was attached to the bottom of the container in order to record the substrate-borne stridulatory vibrations. It was connected to an amplifier, and the signal stored on the sound-track of a video-recorder. The behavioural interactions of bugs were simultaneously videotaped. Copula in Rhodnius prolixus is typically initiated by a jump or mounting of the male on the female, and followed by the introduction of the male's genitalia. In all 25 mating attempts recorded, the female stridulated as soon as it was contacted by the male. The male was either observed to remain immobile on the female for several seconds, or to give up and leave. Such male-deterring stridulations were fully effective: out of 25 attempts, no copulations occurred. Male-deterring stridulations consisted of short series of repetitive syllables, while disturbance stridulations consisted of long ones. Moreover, each syllable of disturbance stridulations was composed by two chirps, a short and a long one. Our results do not evince the existence of two different chirps in the male-deterring stridulations. Both male-deterring and disturbance stridulations differed in their power spectra, with a main carrier frequency of about 1700 Hz and 2600 Hz respectively. Based on these results, we suggest that the frequency of male-deterring stridulations in Rhodnius prolixus would play a role in intraspecific communication, while, high-frequency disturbance stridulations, would be shaped to deter predators and therefore play no role in intraspecific communication.

Supported by CONICET, Univ. Buenos Aires/Argentina and UNDP/World Bank/WHO (TDR).

CEPHALIC MECHANORECEPTORS PROJECT INTO THE VENTRAL NERVE CORD IN TRIATOMA INFESTANS.

Insausti, T.C and Lazzari, C.R.

Laboratorio de Fisiología de Insectos, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, (1428) Buenos Aires, Argentina. E-mail: lazzari@bg.fcen.uba.ar

The projections of mechanosensory hairs located on dorsal and lateral head were analysed in the adult Triatoma infestans by cobalt filling. The axons run into the anterior and posterior tegumentary nerve and project through the brain to the ventral nerve cord The fibres are small in diameter and run as a fascicle. Some of them branch into subesophageal and prothoracic centres and others as far as the mesothoracic ganglion. The comparative analysis of our results in T. infestans and those obtained by other authors in different insect species suggests that direct descending projections of cephalic mechanoreceptors could be evolved for serving a given function that requires the fast processing of sensory information. An alternative hypothesis is that cephalic mechanoreceptors would be a part of a general mechanical sense, distributed all over the integument, which integrative centres are located along the ventral cord. T. infestans could represent a primitive undifferentiated state, where all mechanoreceptors exhibit identical morphology and are gathered together in given nervous pathways. Wind receptors, interommatidial and head hairs of other insects would represent morphological and functional adaptations to certain tasks, such as flight, grooming, etc. The functional role of these mechanoreceptors in T. infestans could be related to thigmotaxis. This response is mediated by mechanoreceptive inputs, coming from the whole body surface and induces physiological changes in the bugs, such as a decrease in the heart rate. Therefore, head hairs could play a role in maintaining thigmotaxis and triggering physiological responses associated to this behavioural response. In addition, our results and those from other authors suggest that the median ventral tract is an area for the association of somatosensory inputs, and indicate the extent of the direct connection between different neuromeres by populations of primary afferents.

Supported by CONICET, Univ. Buenos Aires/Argentina and WHO (TDR).

THE ROLE OF THE OCELLI IN THE PHOTOTACTIC BEHAVIOUR OF TRIATOMA INFESTANS

Lazzari, C.R.; Reisenman, C.E. and Insausti, T.C.

Laboratorio de Fisiología de Insectos, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, (1428) Buenos Aires, Argentina. E-mail: lazzari@bg.fcen.uba.ar

In addition to compound eyes, most adult insect posses two or three simple eyes, the ocelli. The function of these photoreceptors remains elusive in most cases. Several hypothesis ascribe them a role in flight control and as modulating organs of the compound eyes sensitivity. Triatomine bugs possess two well developed ocelli, located in a latero-dorsal position, behind compound eyes. We tested the role of the ocelli in the phototactic behaviour of T. infestans, by measuring the time spent by adult males in the dark half of an experimental arena (25 cm X 5,5 cm), whose another half was illuminated by 11.2 lux white light from an halogen lamp (OSRAM 41860 WF, 12 V/20 W). Each trial lasted for 5 min and insects from the following groups were tested in an individual fashion: a, intact insects; b, insects having their ocelli occluded by a thick layer of black acrylic paint; c, insects having their compound eyes occluded and d, insects with ocelli and compound eyes covered (k=4, n=10). The statistical analysis revealed a significant variation between groups ANOVA test, p<0.0002). Multiple contrasts performed a posteriori evinced that the occlusion of the ocelli or the compound eyes alone had little effect on the phototactic response of the bugs (Tukey test, n.s.). Only those insects whose ocelli and compound eyes had been occluded showed a significant reduction in their phototactic response, that differed from all the other groups (p<0.01), but not from a random distribution. Results are consistent with neuroanatomical evidence revealing direct connections between the ocellar neuropile and the lamina at the optic lobe of the protocerebrum by first-order interneurons. The ability of the ocelli of T. infestans in mediating the phototactic response by themselves (i.e., not through the modulation compound eyes sensitivity), constitutes the first report on this function in insects and stress the adaptive value of this response in triatomines. In addition, the probable existence of parallel sensory pathways from different kinds of photoreceptors serving the same function, reveals these insects as a valuable model system for the study of the ocellar function.

Supported by WHO (TDR), Univ. of Buenos Aires, CONICET and Fundación OSDIC (Argentina).

A CIRCADIAN RHYTHM OF SENSITIVITY IN THE EYE OF TRIATOMA INFESTANS AS EVINCED BY A BEHAVIOURAL ASSAY

Reisenman C.E. & Lazzari C.R.

Laboratorio de Fisiología de Insectos, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, (1428) Buenos Aires, Argentina. E-mail: carolina@bg.fcen.uba.ar

A rhythmic nightly increase in visual sensitivity is well documented in nocturnal arthropods. In all cases, the visual sensitivity was measured through electrophysiological techniques. The purpose of this communication is to test this hyphotesis in Triatoma infestans, a nocturnal insect, but using a different approach, i.e., a behavioural response. Phototaxis is a convenient expression of visual capacities in insects, because this behaviour is easily elicited and relatively stable. A modification of a bioassay that we described previously (Mem. Inst. Oswaldo Cruz 91, Suppl.: 138, 1996) was used to measure the scototaxis of bugs. Before the experiments, bugs were trained to a discrete 12:12 hs L:D illumination cycle during five days. After that, half of the insects were tested during the photophase and the remaining half during the second hour of the scotophase for their phototactic response. Several light intensities were used (0, 1.1, 11.2 and 179.5 lux). These daytimes were chosen because at these moments T. infestans displays minimal and maximal activity, respectively (J. Insect Physiol. 38: 895-903, 1992). We found that the negative phototactic response changes according to the intensity of light (two-way ANOVA, p<0.00001). Furthermore, the response varied according to the time of the day, i.e., it was stronger at night (p<0.0001). Thereafter, we tested if this differential response was due to the adaptation of the eye to current light conditions or to an endogenous control. Bugs were transferred from LD to continuous darkness (DD) or continuous light (LL) and were tested at the subjective night or day. Insects from DD and LL groups displayed the same variation in the phototactic response that the LD group did, i.e., in both cases, the scototaxis of bugs tested at the subjective night was stronger than that the insects tested at the subjective day (ANOVA, p<0.00001). These results demonstrate that an endogenous circadian system controls the phototactic behaviour of T. infestans, which does not depend on environmental illumination. In addition, the period of enhanced visual sensitivity coincides with the period of maximal behavioural activity of bugs. This is the first report that evinces an endogenous rhythm of sensitivity to light in insect eyes, by measuring a behavioural response.

Supported by WHO (TDR), Univ. of Buenos Aires, CONICET and Fundación OSDIC (Argentina).

CAPTURE OF TRIATOMA INFESTANS USING YEAST-BAITED TRAPS UNDER NATURAL CLIMATIC CONDITIONS

Lorenzo, M.G.; Reisenman, C.E. and Lazzari, C.R.

Laboratorio de Fisiología de Insectos, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, (1428) Buenos Aires, Argentina (e-mail: marcelo@bg.fcen.uba.ar )

The effectiveness of a trap for triatomines baited with yeast cultures has been previously demonstrated in laboratory assays (Experientia, 51:834-837, 1995). We report here results from assays performed under natural climatic conditions with the same traps. All assays were conducted at experimental chicken corrals colonised by Triatoma infestans, situated at an endemic area of Chagas disease in Argentina. Two different models of traps were tested, for use either on the floor, or attached to walls. Assays, performed throughout the night, consisted of presenting an experimental trap and a control one, at each of two corrals. At the next morning the number of insects captured by each trap were counted. The results obtained during five consecutive nights at two different corrals clearly demonstrate that yeast-baited traps are effective for capturing triatomine bugs. Floor traps, when baited, captured significantly more bugs than their controls (t-test, P=0.0008, k=10). In addition, experimental wall traps were also more effective when compared to their controls (t-test, P=0.011, k=10). The maximum capture by a single trap were 39 bugs in one night. Traps captured significantly more bugs at nights when maximum temperature was above 18°C (t-test, P=0.0002). Results indicate that yeast traps are capable of capturing significant numbers of free insects in one night. Moreover, it should be stressed that temperature is to be considered in order to determine the use of detection tools for triatomines.

Supported by CONICET, Univ. Buenos Aires/Argentina and UNDP/World Bank/WHO (TDR).

AGGREGATION BEHAVIOUR AND INTERSPECIFIC RESPONSES IN RHODNIUS PROLIXUS

Lorenzo Figueiras, Alicia

Laboratorio de Fisiología de Insectos, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, (1428) Buenos Aires, Argentina. E-mail: aliciaf@bg.fcen.uba.ar

Most triatomine species are active at night and spend daylight hours assembled in shaded places. In some species this behaviour showed to be mediated by the convergence of several factors, i.e., thigmotaxis, scototaxis and chemical assembling signals. The last belong to two categories, faecal aggregating factors, and chemical footprints of non-faecal origin. In addition to their role for intraspecific communication, interspecific responses have been described in some triatomines. This dual function becomes relevant for the analysis of the ecological and phylogenetic relationships between triatomine species, provided that excrement act as chemical landmarks helping insects to find suitable refuges. This study examines the response of R. prolixus to aggregation substances present in their excrement, as well as the cross-responses to signals belonging to Triatoma infestans. Larvae of R. prolixus and T. infestans reared in the laboratory were used throughout and dry faeces of both species were collected without contact with the insects. Behavioural tests of aggregation response were performed using a circular arena, where three folded filter papers were placed, one impregnated with excrement and two clean controls. The inter and intraspecific aggregation responses of larvae of both species were recorded. The results showed that an assembling substance is present in the dry faeces of R. prolixus (G-test, P<0.001). The faeces of this species were also attractive to larvae of T. infestans (G-test, P<0.001). However, larvae of R. prolixus did not respond assembling on excrement that belong to T. infestans (G-test, n.s.). Further statistical analysis revealed a significant difference in the response intensity of both species to faeces of R. prolixus (t= 2.78, df= 11, P=0.02), being the aggregation response of T. infestans stronger than that of R. prolixus. This fact could explain the lack of discrimination of the first named species between own and heterospecific signals. The dual role of the aggregation factor as both, a pheromone that mediates the aggregation of conspecifics and as a kairomone for insects belonging to other species, opens new questions on the chemicals nature and origin of the signal, as well as on eventual interactions between of both species in geographic areas where they live in sympatry (e.g., some areas in Bolivia). More research is necessary to reveal the chemical identity of the signal in different triatomines.

Supported by CONICET, Univ. Buenos Aires/Argentina and UNDP/World Bank/WHO (TDR).

CHICKEN NESTS AS RISK FACTORS FOR CHAGAS DISEASE

Lopez,A; Crocco, L.; Morales, G.; Catalá, S.

FCEFN. U.N.C.Velez Sarsfield 299. Córdoba 5000. ARGENTINA.

Peridomestic structures play an important role on Chagas disease. Corrals, nests and other constructions frequently maintain triatomine populations that can invade the domiciles. Chicken nests are, in general, close to the house and keep high densities of bugs. The goal of this work was to evaluate how risky are bugs populations associated to chicken nests, in terms of bites to human, infectivity and capacity to sustain vectors.

Materials and methods. The project was carried out in houses of the central endemic area of Argentina, where 30 structures associated with chickens were evaluated. The bugs collected (Triatoma infestans) using a pirethroid were kept at low temperature and analysed in the laboratory. All the insects were weighed and the rectal material collected in order to evaluate either Trypanosoma cruzi infection and number of bugs fed the last night. Females were dissected to count corionated eggs. The stomach content was used to recognise the host by inmunodiffusion on gel .

Results. 1. The analysis of the physiological status (weigh and -in females-number of corionated eggs) showed an excellent weigh and many corionated eggs in mated females. During spring month, mainly November, the physiological status was higher than in March. 2. The number of bugs in each habitat was a function of the number of host present (Number of bugs= 13.3 * number of host - 22.1; r=0.82, p<0.0005). 3. The number of bites per night was a function of the number of bugs (Number of bites= 0.39 * number of host + 0.73; r=0.99, p< 0.0001). 4. More than 30% of habitats located 12m or less from the house, showed bites on human (40% when the nest was 6m or less from the house). 5. Trypanosoma cruzi had been detected more frequently when chicken shared the habitat with mammals (15% of nymphs and 29 % of adults infested).

Conclusions. Chickens nests provide a good habitat for triatomine bugs and also as a reservoir of T.cruzi. The bugs attain a good nutritional and gonadotrophic status and when the nest is placed close to the house it constitutes a direct risk as the vectors bite humans and could transmit the parasite. Spring months seems to be specially important in terms of probability of dispersal from the chicken nest to houses.

* The project was carried out with grants from WHO/TDR/UNDP World Bank, CONICOR and SECYT, UNC.

PREDICTION OF TRIATOMA INFESTANS BITES' NUMBER IN NATURE, THROUGH MEAN DAILY TEMPERATURE.

Catalá, S.*; Crocco, L.*; Morales, G.*; Paulone, I.+; Giraldez,E.+; Candiotti, C.+; Ripol, C.**; Muñoz,A.*

* FCEFN. U.N.C.Velez Sarsfield 299. Córdoba 5000. + Inst.E.Coni, Fac.C.Químicas, Servicio Provincial de Chagas, Santa Fé. **Servicio Provincial de Chagas, Jujuy. ARGENTINA.

Knowledge about the number of vector bites in nature can contribute to understand the transmission dynamics of Trypanosoma cruzi. Based on previous results from experimental chicken houses and guinea pig houses, we investigated the proportion of Triatoma infestans fed each night, in natural populations from the central Argentinean endemic zone.

The work was carried out on areas of Córdoba, Santiago del Estero and Santa Fé provinces. We considered that domiciles with very low populations of Triatoma infestans were not convenient for the analysis so that although we sampled 126 houses, we only selected 31 of them which showed 30 to 344 T. infestans (adults and old nymphs) when the sample was obtained. During the morning, the domiciles were treated with fumigant canisters and the knocked down insects were collected and kept at 4ºC. In the laboratory, we analysed the rectal material and according with Catalá (1991), we considered the presence of colourless urine as an indicator of recent feeding (less than 12 hours). The proportion of insects with colourless urine constitutes the PFV or Proportion of Fed Vectors. Daily temperature of the previous day, was obtained from Meteorological Service data. Results: The regression analysis of PFV on mean daily external temperature (log PFV= 1.88* log temperature - 3.25) revealed a high association between these two variables (r= 0.65; p< 0.0001) and allowed to confirm that external temperature affects the proportion of vectors biting each night in each house. This relationship will allow the estimation of Triatoma infestans PFV from human houses in any region where the vector is present. As an example, we calculated the PFV for several regions of Argentina where T. infestans lives, using average temperature records over 10 years (1982-1992). The analysis showed how different the PFV behaves on several localities of the whole endemic area of Argentina. A strong seasonallity is obvious in all localities but, even in winter, PFV values are considerable high for some localities while is almost zero for the southern regions. Conclusion: In nature, the proportion of Triatoma infestans feeding each night (PFV) is significantly affected by temperature changes. The function fitted for this relationship predicts the percent of Triatoma infestans bites that can be produced with different external temperatures. As a predictor variable, PFV would be useful in general planning of vector control, and would help to establish priorities in insecticide spraying of different regions.

*The project was carried out with a grant from WHO/TDR/UNDP World Bank .

SELECTION OF REFUGES TRIATOMA INFESTANS IN AN EXPERIMENTAL MODEL: I. PREFERENCES FOR DIFFERENT TYPES OF SUBSTRATES

De Marco R.J.1, Salomón O.D.2, Chuit R.3, & Gürtler R.E. 1

Lab. de Ecologia General, Fac. Cs. Exactas v Naturales. Universidad de Bucnos Ajrcs,Ciudad Universitaria, (I 428) Buenos Aires, Argentina (e-mail: gurtler@bg.fcen.uba.ar ).ANLIS "Dr. Carlos G. Malbráin', Buenos Aires, Argentina.'Dirección de Epidemiología, Ministerio de Saludy Acción Social de Ia Nación, Buenos Aires, Argentina.

The aim of this study was to evaluate the preferences of Triatoma infestans for different substrates under laboratory conditions. We used various type of materiais that may affect thc thigmotactic response of insects: paper, corrugated cardboard, metal, glass. plastic. cane and leather- Twenty T infestans 3rd-4th-5th instar nymphs, starved for 12 ± 3 days after ecdysis, were placed in the centre of an experimental arena that offered two similar or different refuges. The refuges were 10 em long and, 3 em diametered tubes. Insects were subect to a 12:12 light-darkness cycle and were released one hour before the beginning of the, scotophase. After the, beginning, of the- photophase, the number of nymphs in each refuge was counted. Each trial was replicated four times in the presence and absence of a restrained female mouse equidistant to both refuges. Leather was significantly preferred to the rest of the materiais both in the presence and absence of a host. The cane Guadua trinii followed leather in the- observcd preferences. Leather refuges had a coarse and smooth type of surface. ln paired trials, the coarse surface was significantl.y prefeffed to the smooth olie. These, results suggest that the bug's thigmotactic response might be a key factor explaining the observed preferences for leather. Hoçvever, our experimental model- does not allaw the exclusion of other clucs, such as chemical attractants, associated with thc test materiais that mav affect the selection of refuges. Our study suggest that leather would be a useful material to optimize the detection devices for T infestans, devices that are being developed.

This study was suportei by UNDP/World Bank/WUO (TDR).

SELECTION OF REFUGES TRIATOMA INFESTANS IN AN EXPERIMENTAL MODEL: II: INTERACTION BETWEEN SUBSTRATE TYPPE AND DISTANCE TO THE HOST

De Marco R.J.1, Salomón O.D.2, Chuit R.3, & Gürtler R.E. 1

' Lab. de Ecologia General, Fac. Cs. Exactas y Naturales, Universidad de Buenos Aires,

Ciudact Universitaria, (l428) Buenos Aires Argentina- (e-mail: gurtler@bg.fcen.uba.ar ) .

ANLIS "Dr. Carlos G. Malbrán", Buenos Ajres, Argentina. ' Dirección de Epideniiología,,

Ministerio de, Salud v Acción Social de Ia Nación, Buenos Aires- Argentina.

Schofield (Bull. ent. Res. 69, 363-379, 1979) stated: "The distribution of bugs within a habitat- depetids cluefiy on the substrate, quality anct on the proximity of hosts". However. there are no published data that substantiate the relative value of each of these factors. Our objectives were to evaluate- if Triatoma infestans nymphs prefer to shelter next to a potential host. and if there is a trade-off between the substrate typc and the distance from the refuge to the host. The refuges were I 10 cm long and 3 cm diarmetered tubes made of leather or cane. ln previous trials leatlicr rcsulted significantly preferred to cane. Thi T. infestaiis 3rd-4th instar nymphs, sta ed for 15 ± 3 days after ecdysis, were releascd in the centre of an experimental arena with a restrained female mouse. Two refuges were located within the arena, one iiext to the host (20 cm) and-the other- farther amay (l50 cm). The insects were subject to a 12:12 liglit-darkness cycle and were released one hour before the beginnnng of the . scotophase, ln the next moming, the- number of nymphs in each refuge was counted. The nymphs showed a significant preference for the refuge located next to the host when both refuges were mad of leatherr. However, when the refuge close to the host was made of cane and the remote one of leather, a significantly greater number of insects was found within thee leather refuge. The evidence suggests a trade-off between substrate type and proximity to the host.

This studyy was supported by UNDP/World Bank/WHO (TDR).

POPULATION DYNAMICS OF TRIATOMA INFESTANS IN EXPERIMENTAL HUTS.

Cecere MC1, Canale DM2 & Gürtler RE1.

1 Lab. Ecología Gral., Facultad de Cs. Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, (1428) Buenos Aires, Argentina; 2 Servicio Nacional de Chagas, 9 de Julio 356, (5000) Córdoba, Argentina. carla@bg.fcen.uba.ar

We tested whether variations in host and refuge availability affect the population dynamics of T. infestans. In Córdoba Province (Argentina), we built 16 experimental huts with autochthonous materials similar to those found in endemic rural areas. Eight huts had maximum availability of refuges, with roofs of "jarilla" (Larrea sp, a shrub) and unplastered mud-bricked walls; whereas the other 8 huts had minimum availability of refuges, with roofs of "simbol" (Pennisetum sp, a grass) and plastered mud-bricked walls. Four of the huts hosted 3 chickens whereas the other 4 hosted one chicken per hut. Each hut (»1 m3 ) was colonized with 4 adults, 296 nymphs and 88 eggs of T. infestans in February 1996, which developed as a closed population under natural climatic conditions. The huts were disarmed each month to count the number of live and dead insects by stage and mark new individuals.

The density and fecundity of T. infestans population differed among treatments (four levels, P<0.001) and months (P<0.001); the interaction was not significante. After a 12-month follow-up, the mean density of bugs per hut was greater in huts with maximum availability of refuges and 3 chickens (1296), than among other treatments (range, 652-844). The median fecundity of bug populations under maximum availability of refuges or chickens was greater than among those with minimum refuge or host availability. These results are the first to show that refuge availability affects fecundity. Environmental management measures based on reduction of refuge and domestic animal availability in rural houses may exert a strong impact on T. infestans population dynamics.

BIOLOGY OF TRIATOMA BRASILIENSIS NEIVA, 1911 UNDER LABORATORY CONDITIONS - LIFE CYCLE AND FEEDING ASPECTS.

Laranja, LS1, Soares, RPP1,2 & Diotaiuti, L1.

1Centro de Pesquisas René Rachou-FIOCRUZ, Caixa Postal 1743, 30.190-002, Belo Horizonte, MG, Brazil.

2Departamento de Parasitologia, Universidade Federal de Minas Gerais, Caixa Postal 2486; 31270-901, Belo Horizonte, MG, Brazil.

Triatoma brasiliensis is the most important species of Triatominae in the northeast of Brazil. It may be captured in the wild, peridomestic and domestic environments with high antropophily. Based on these ecological behavior this work had the objective of studying the life cycle and some feeding aspects in order to provide a better understanding of its biology under laboratory conditions. The insects were captured in the state of Piauí, municipality of Simplício Mendes, being the first generation studied. Observations were made using Ryckman apparatus and anaesthetized mice. Blood meal was given daily and those who had fed would feed again after seven days. The insects were observed individually for the following parameters: the incubation period, the interval between hatching (or moulting) and the first feeding, the number of blood meals in each stage, blood ingestion capacity, the time-lapse before the bite, the length of feeding and the defecation occurrence during or immediately after feeding for 4th, 5th and adults only. Average length of the egg incubation was 24,6 ± 0,8 days, being 92,5% of eggs viable. The time interval between hatching/moulting and the first feeding was 4, 3, 2, 2, 3 and 6 days for 1st, 2nd, 3rd, 4th, 5th instars and adults, respectively. The number of the blood meals necessary for the occurrence of moulting was 3 for the 1st instar and 2 for the others instars. The blood meal intake ratios were calculated by the formula (R=Wf-Wi/Wi), where Wf is the after feeding weight and Wi is the before feeding weight. The results showed that the proportion of blood ingestion was 4 times their initial weight to the 2nd and 3rd instars and 5 to the others. The time-lapse before the bite was the same for all the instars (3'30± 3'00") and less than those observed for adults (6'00"±3'00"). The blood-sucking period arose according to the instars and decreased in adults. Defecation during or immediately after feeding occurred in 59%, 65,5% and 55,6% of the cases for 4th, 5th and adults, respectively. The life cycle period was about five months (160 ± 13,6 days), suggesting the occurrence of two generations per year. The feeding behavior showed that T. brasiliensis was able to ingest blood until five times of its initial weight. Although defecation was often observed, the long time periods of blood ingestion could bother the host, difficulting Trypanosoma cruzi transmission.

DEVELOPMENT OF TRIATOMA RUBROVARIA (BLANCHARD, 1843) (HEMIPTERA, REDUVIIDAE) FED ON BOVINES

Galvão,C.; Silva, D.A.; Rocha, D.S. & Jurberg, J.

Instituto Oswaldo Cruz, Departamento de Entomologia, Laboratório Nacional e Internacional de Referência em Taxonomia de Triatomíneos, Av. Brasil 4365, 21045-900, Rio de Janeiro, RJ, Brasil.

Triatoma rubrovaria is a sylvatic species although is being found in peridomiciliary environments by technicians fo the FNS in localities of the State of Rio Grande do Sul where Triatoma infestans (Klug, 1834) has been controlled. This could be a tendency of that species to invade those niches previously occupied by T. infestans. Bovines are animals frequently found in those environments and we decided to study the development of T. rubrovaria fed on them and to evaluate their vector capacity, with these parameters and objectives: time between offering of the blood source and biting; length of time of feeding; interval between the end of the blood feeding and defecation; number of blood meals and time required for moulting in each instar. Eggs were collected in the National and International Reference Laboratory for Triatominae Taxonomy and after hatching, the 46 nymphs obtained were reared individually in centrifugue tubes with a paper strip to facilitate insect movements. Tubes were closed with a nylon tissue and located on shelves; specimens were kept at the environmental temperature. The calf employed as feeding source was locally shaved on the area where the tube was placed; duration of the observed parameters were watched with a chronometer. At present, results related to first instar nymphs were obtained, with a developing time of 41 to 92 days and a mean of 58.35. The number of blood meals necessary to get the ecdysis vary between 2 and 6 with a mean of 3.4. In 77.09% of the observed meals, the feeding source was accepted during the 3 minutes of offering; the act of feeding last between 5 and 15 minutes in 79.17% of observations. The time between the end of feeding and defecation was of 5 to 6 minutes in 60.42%, and of less than 1 minute in 37.5%.

Supported by CNPq, agreement Fiocruz/FNS and European Comission contract IC18-CT96-0042

RESISTANCE TO STARVATION OF TRIATOMA RUBROFASCIATA (DE GEER, 1773), UNDER LABORATORY CONDITIONS (HEMIPTERA: REDUVIIDAE: TRIATOMINAE).

Cortéz, M.G.R. & Gonçalves, T.C.M.

Departamento de Entomologia, Instituto Oswaldo Cruz, Caixa Postal 926, Rio de Janeiro, 21040-900, Rio de Janeiro, RJ, Brasil.

The resistance to starvation is a biological aspect of epidemiological importance not only because contributes to the colonization of the domicile but also with the programs of vigilance and control.

The aim of the present work is to know the starvation between the moult/death and the loss of weight until the death.

The 300 nymphs observed were obtained from couples captured in São Luíz, Maranhão State, Brazil. The nymphs were kept, separately, in Borrel flasks and properly listed. The blood-meal was performed in rats (Rattus norvegicus), although the insects were kept without feeding as soon as moulted.

The starvation and the loss of weight was directly related with the developmental stage: 1st stage - 21,64 days; 2nd - 24,12 days and 3rd - 46,80 days and 1st stage - 0,58mg; 2nd - 2,03mg and 3rd - 5,38mg, respectively.

It was observed a pronounced loss of weight in the first days, followed by a gradative loss until the death. However, in some intervals it was observed an increase of the weight, which is probably related with the individual weight of each insect, changing consequently the average.

Comparing this results with others in the literature, T. rubrofasciata seems to be a species with low resistance to starvation.

The results of the 4th and 5th instars and adults are being concluded.

The experiment have been carried out for 11 months, in BOD incubator with 29±1°C, 70±10%HR and a fotoperiod of 12 h.

Supported by BIRD/FNS/FIOCRUZ.

INFLUENCE OF DIET IN THE RESISTANCE TO STARVATION ON RHODNIUS PICTIPES STAL, 1872 (HEMIPTERA, REDUVIIDAE, TRIATOMINAE)

Borgerth, S.P.S.; Rocha, D.S.; Silva, L.F.; Jurberg, J. & Galvão,C.

Instituto Oswaldo Cruz, Departamento de Entomologia, Laboratório Nacional e Internacional de Referência em Taxonomia de Triatomíneos. Av. Brasil 4365, 21045-900 Rio de Janeiro, RJ, Brasil.

Rhodnius pictipes was already found in artificial ecotopes (Serra et al., 1980; Silva et al., 1992) as well as infected with Trypanosoma cruzi. In relation to its portential vector capacity, Rocha et al. (1994) observed that this species, during the whole life cycle, defecated inmediately after feeding in 35% of observations, 52.5% of them on the animal that served as feeding source. The objective of this work is the avaluation of the resistence of this species to starvation, according to different feeding sources under controlled laboratory conditions, searching for the possibility of using these informations either in control programs with residul-effect insecticides or to stablish patters for feeding of colonies in the laboratory. Insects were obtained from the insectary of the National and International Reference Laboratory on Triatominae Taxonomy, IOC, and kept in ovens B.O.D. at 28C +/-1C and 80% +/- 5% of RH, using a photoperiod of 12 hours. 50 specimens of each stage were separated in crystallizers, fed every week on pigeon. As soon as ecdysis occur insects were individually transferred to Borrel flasks. After moulting, an analytical balance was used to weigh the specimens; that study was repeated every 5 days until the insect death to evaluate the weight loss during the period. Fifth instar nymphs resisted starvation during a mean of 91 days, while males resisted 50 days. Both stages had the most significative weight loss during the first 20 days.

Supported by CNPq, agreement Fiocruz/FNS and European Comission contract IC18-CT96-0042

FEEDING AND DEFECATION PATTERNS OF TRIATOMA RUBROFASCIATA (DE GEER, 1773) (HEMIPTERA, REDUVIIDAE), UNDER LABORATORY CONDITIONS.

Marina Vianna Braga & Marli Maria Lima

Lab. de Biologia e Controle de Insetos Vetores, Depto. de Biologia, IOC, Fundação Oswaldo Cruz, Rio de Janeiro, Brazil. E-mail: mvbraga@gene.dbbm.fiocruz.br

Triatoma rubrofasciata is occasionally found naturally infected by Trypanosoma cruzi (Lent & Wygodzinsky, 1979; Sherlock, 1979; Brazil & Da Silva, 1983; Brazil, 1985). However, this species is not considered an important vector of Chagas' disease. Aiming to understand the role of T. rubrofasciata in the transmission of Chagas' disease, the feeding and defecation patterns of each instar nymphs were observed. They were fed individually on swiss mouse and the following parameters were observed: time spent to reach the source, time spent to feed, number of intervals during the feeding, number of times that the nymphs defecated and urinated during and after feeding. The results are shown in the Table.

Instar Number
of
nymphs Time
to begin
feeding
(min.) Duration
of feeding
(min.) Number
of
intervals Nymphs
that
defecated Nymphs
that
urinated During After During After 1st 30 7.6 ± 6.7 19.9 ± 9.9 1.0 ± 1.7 3% 7% 7% 0% 2nd 30 11.0 ± 11.1 16.1 ± 5.6 0.9 ± 1.3 3% 7% 13% 20% 3rd 22 8.6 ± 9.4 14.5 ± 9.9 0.9 ± 1.4 0% 9% 0% 9% 4th 21 10.7 ± 13.4 19.4 ± 12.8 1.5 ± 3.1 0% 0% 0% 5% 5th 20 7.3 ± 5.0 24.9 ± 8.2 1.0 ± 0.9 5% 15% 10% 5%

Some nymphs of T. rubrofasciata urinated and defecated during the feeding, however most of them defecated far the food source, after having finished feeding. In conclusion, T. rubrofasciata does not seem to be a good vector for T. cruzi since it prefers to defecate far from the food source.

FEEDING AND DEFECATION PATTERNS OF ADULTS OF FIVE SOUTH AMERICAN SPECIES OF GENUS TRIATOMA LAPORTE, 1832

Rocha, D.S.; Galvão, C.; Cunha, V.; Carcavallo, R.U. & Jurberg, J.

Laboratório Nacional e Internacional de Referência em Taxonomia de Triatomíneos, Departamento de Entomologia, Instituto Oswaldo Cruz, Av. Brasil 4365, 21045-900, Rio de Janeiro, RJ, Brasil.

Triatoma delpontei Romaña & Abalos, 1947, T. platensis Neiva, 1913 and T. rubrovaria (Blanchard, 1843) are included in a specific group with great affinity with T. infestans (Klug, 1834), the principal vector of Chagas' disease in the South Cone of the Americas. More recently, Lent et al. (1994) included another species in this specific group, T. melanosoma Martínez, Olmedo & Carcavallo, 1987, found in the peridomestic environment on the extreme NE of Argentina, morphologically similar to T. infestans but totally black. T. delpontei and T. platensis are mainly sylvatic and ornithophyllic species, even though they were found several times in peridomestic areas.

T. rubrovaria, another wild species, related to vertebrates living in stony grounds, has also been found sometimes in peridomestic environment; in fact, it is eclectic, feeding in many sources, including other arthropods. The real epidemiological importance of the sylvatic species of this group could be restricted to adults, in relation to the active dispersion that could permit the house invasion. Taxonomists have shown interest in this specific group and its phylogenetic relationships have motivated discussions and controversial opinions (Usinger et al., 1966; Dias, 1986; Schofield, 1994; Panzera et al., 1995). We are studying 60 specimens of each species looking for characterizing them under a biological point of view and for evaluating the potential vector capacity of the wild species. Adult specimen are maintained since moulting from the last nymphal stage under starvation, during 10 to 15 days and then fed only once on pigeon (Columba livia). Parameters observed are: time between the blood source offer and the beginning of feeding; lasting of repast; time and place of defecation; and the weigh increase. Preliminary results in three species, related to means of time for acceptance of the feeding source and means of feeding lastingness showed a great similarity between T. delpontei (X= 6'02'' and 10'41'') and T. platensis (X=6'30'' and 15'20''), while T. rubrovaria separates from these values (X=4'10'' and 29'27''). Even though these results are considered preliminary, we could consider that these biological and ethological studies could be a contribution to understand, under laboratory conditions, the significance of each species in the T. cruzi transmission as well as some phylogenetic relationships and evolutionary trends.

With support of CNPq, Agreement FNS/FIOCRUZ.

PERIDOMICILIARY INFESTATION OF TRIATOMA SORDIDA IN THE MUNICIPALITY OF SERRA DO RAMALHO, BAHIA STATE, BRAZIL.

Pires, HHR1, Borges, EC1, Lorosa, ES2, Andrade, RE2 & Diotaiuti L1.

1Centro de Pesquisas René Rachou/FIOCRUZ, Caixa Postal 1743, Belo Horizonte, 30190-002, MG, Brazil, E-mail: tim@netra.cpqrr.fiocruz.br

2Laboratório de Precipitina, FIOCRUZ-RJ.

At present, Triatoma sordida, a peridomiciliary species, is one of the most triatomine captured in Brazil. In order to know the factors involved in the peridomiciliary infestation of this species, the locality Agrovila 12, municipality of Serra do Ramalho, Bahia state, not trated with insecticides for more than 4 years, was submitted in July/95 to a triatominic infestation research, followed by the spraying of the positive domiciliary units (DUs). In the 378 DUs investigated, 209 were infested.There were captured 1937 insects, and were made new evaluations in the 4th, 8th and 12th months after spraying. In these subsequent trials, this population was reduced to 47,2%, 36,4%, and 47,8%, respectively. 49,3% of the peridomiciliary ecotopes were positive. Among them, the most frequently infested were those made of wood (92,1%), where 95,2% of the insects were captured, followed by those made by mud (6,2%), where 3,8% of the insects were capture, and finally those made by several materials (1,8%), where 1,1% of the insects were captured. Chicken houses corresponded to 46,7% of this ecotopes, 9,3% were pigsty, 33,9% fences, 0,9% baths, 9,3% others, being captured, respectively, 69,3; 5,4; 19,4; 0,7 and 5,2% of the insects. In the peridomiciliary area, 2934 domestic animals were presented, being chickens the most frequent (78,7%), pigs (12,5%), dogs (5,2%), cats (3,1%) and sheep (0,5%). These animals were present respectively in 82,4; 46,6; 51,5; 28,9 and 1,5%, of the DUs studied. The food sources, identified through precipitin reaction, were in percentile values:

Bird Man Dog Horse Rodent Opossum Cat Sheep/
Cattle not
identified Evaluation 1 60,2 2,4 1,5 7,4 3,9 0,4 0 0 27,2 Evaluation 2 64 1,3 0,6 7,5 8,1 1,0 1,0 0 24,4 Evaluation 3 47,7 2,9 4,4 5,2 12,5 3,5 0 0,9 33,4 Evaluation 4 31 0,5 0,5 8,9 17,3 0,5 0 0 45,3 Total 1375 53 42 176 164 22 3 3 712

Among the insects, 114 were positive for more than one anti-sera tested. In the house, 11 were positive for birds, 3 for rodents, 3 for horses, 1 for man and 17 were negative. From those Trypanosoma cruzi positive, 5 had fed on bird, 4 on horse, 1 on rodent, 1 on bird\horse and 6 were negative. The slow reconstitution of the triatominic population demonstrates that the control of this species can be made with only one insecticide spraying/year associated to adequate peridomiciliary dealing.

Supported by FIOCRUZ, FNS and SINTYAL IND.

ENZYME IMMUNOASSAY FOR THE IDENTIFICATION OF THE FOODSOURCE OF HEMATOPHAGOUS INSECTS

Duarte, R & Marzochi, M.C.A.

Lab. Imunodiagnóstico - Escola Nacional de Saúde Pública/FIOCRUZ. C.P. 926, CEP 21041-210 R.J. Brasil

The Enzyme-Linked Immunossorbent Assay (ELISA) was used for the identification of the intestines' contents of triatomines fed by the blood of different hosts. Six groups with 40 fourth stage nymphs of Panstrongylus megistus in each, fed by the blood of fowl, caprines, canines, equines, humans and rodents. At each 7 days after the repast, 5 nymphs of each group was sacrificed and the intestine' contents of each one of them, collected and submitted to ELISA for the evaluation of the sensitivity, specificity, reliability, positive predictive value (PPV), negative predictive value (NPV) of the test. Parallelly, the precipitin test was carried out by means of copositivity comparison, conegativity, gross and fit agreement. The precipitin was chosen since it is currently used in studies of foodsource. Protein electrophoresis an Western Blot were also carried out to evaluate the proteins that acted as main antigens and were recognized by the antibodies after the blood was submitted to the digestive system of the insects. The results of the sensitivity to ELISA reached levels, which varied between 90 and 100%, the specificity between 93,3 and 96,6%, reliability from 93,8 to 96,6%. The PPV varied between 74,3 and 84,3%, and the NPV from 98,6 to 100%. The agreement analysis indicated copositivity values, which varied between 41,8 and 100% and the conegativity between 84,3 and 100%. The minimum value of gross agreement was 85% and fit agreement of 49,4%. The electrophoresis and Western Blot indicated an intense protein digestion in which only the immunoglobulin fractions remain integral allowing its recognition by the antibodies. Based on these results, one can infer that the ELISA presents adequate specificity and reability. Enabling it to be used for the studies of identification of the foodsource of hematophagous insects. Owing to the high sensitivity, this test is suitable mainly in the cases in which the material is very diluted, or when we are dealing with small sized species that offers a small amount of sample.

STUDY OF NATURAL INFECTION AND FEEDING SOURCES THROUGH PRECIPITINE TEST OF TRIATOMA SORDIDA (STAL, 1859) (HEMIPTERA-REDUVIIDAE) IN THE NORTH REGION OF MINAS GERAIS

Lorosa,E.S.; Andrade, .R.E; Menezes, S. S. & Pereira, C.A.

Laboratório Nacional e Internacional de Referência em Taxonomia de Triatomíneos. Departamento de Entomologia. Instituto Oswaldo Cruz

Authors give information about the feeding sources and natural infection of Triatoma sordida in the North of Minas Gerais (Curvelo, Montes Claros and Januaria). 722 specimens collected during 1996 in domiciliary and peridomiciliary environments were examined to study the sources of blood meals and the natural infection by Trypanosoma cruzi-like parasites. 118 out of these samples did not contain enough material to be studied and 76 did not react against the battery of antisera used for this trial (against human, bird, dog, cat, horse, goat/cow, pig, rodent, opossum, armadillo, sheep, lizard and toad). From the 528 samples that reacted with these antisera, 459 had a single feeding source corresponding 52.48% to bird; 6.79% to rodent; 4.14% to dog; 3.64% to toad; 2.81% to lizard; 2.65% to opossum; 1.99% to horse and 1.49% to human. 69 samples fed more than once: bird/rodent 5.63%; bird/lizard 0.83%;human/bird 0.66%; bird/toad 0.66%; dog/rodent 0.66%; bird/dog/rodent 0.50%; human/rodent 0.33%; bird/opossum 0.16%; horse/toad 0.16%; rodent/lizard 0.16%; rodent/toad 0.16%. None of the samples reacted with antisera of cat, goat/cow, pig, armadillo and sheep.

Authors have observed that the highest incidence of positive reactions were with bird antisera, followed by rodent antisera when the feeding source was only one, maintaining the same result of reactions in cases of more than one blood meal.

Natural infections by Trypanosoma cruzi-like parasites were found in 7 out of 79 specimens from Curvelo (8.86%), 19 out of 325 from Montes Claros (5.84%) and 14 out of 200 from Januaria (7.0%). From a total of 604 studied specimens of Triatoma sordida, 6.62% have been infected.

Com auxílio FAPERJ; European Comission ICIB-CT96-0042, Convênio FIOCRUZ/FNS.

TRYPANOSOMA CRUZI PERIDOMICILIAR TRANSMISSION BY TRIATOMA SORDIDA IN THE MUNICIPALITY OF PATIS, NORTH OF MINAS GERAIS STATE, BRAZIL.

Castro, GB*, Machado EMM*, Borges, EC*, Lorosa, ES**, Andrade, RE**, Diotaiuti, L* & Azeredo, BVM***.

*Centro de Pesquisas René Rachou, FIOCRUZ. CP 1743, 30.190-002, Belo Horizonte, MG, Brasil. **FIOCRUZ, Dep. Entomologia, IOC, Rio de Janeiro. ***FNS/Coordenação MG, Belo Horizonte, MG, Brasil.

In the North of Minas Gerais state, the T.sordida density increase at the artificial environments is related to the deforestation caused by the cotton plantation expansion. Although this is the most captured triatomine in Minas Gerais, its occurrence is not considered related to human Chagas disease transmission, since it is predominantly peridomiciliar, associated to birds and presenting infection rates bellow 0,5%. Nevertheless, it was observed in the municipality of Patis, at the routine activities of the Chagas Disease Control Program/FNS, higher infection rates, suggesting to investigate the epidemiological relationship that could determine this fact. At the first semester/97 it was carried out a triatominic inquiry at 145 dwelling units, in which 40 (27,6%) were infested by T.sordida. Among them, 3 dwellings were infested with only one triatomine/house. At the peridomicile, 134 triatomines (97,8%) were captured, being 65 adults and 72 nymphs. These triatomines were found at the chicken houses (45%), grain storage (35%), pigsties (7,5%) and at other peridomiciliar ecotopes not identified (12,5%). Six triatomines (4 nymphs/5th and 2 adults) were infected by the T.cruzi (4,4%), all captured at the peridomicile. The blood meal source were investigated in 49 triatomines by the precipitin test. Twelve insects did not react against the anti-sera utilised (24,5%). For the other insects, there were identified blood of bird (36,7%), dog (8,2%), horse (8,2%), sheep or cattle (6,1%), rodent (4,1%), opossum (2,0%), human (2,0%); some insects presented double blood sources as bird + rodent (4,1%), human + opossum (2,0%) and bird + opossum (2,0%).For 6 infected triatomine the blood meal source were: 2/bird, 2/dog, 1/bird + rodent and 1/horse. Although it is a peridomiciliary species, the triatomine has some contact with human (4,1% of the reactive precipitin test). As showed for other regions, these results reinforce the T.sordida importance for the T.cruzi peridomiciliary cycle maintenance under some special conditions, involving some reservoirs like the dog, rodent and the opossum.

Supported by CNPq, FNS and CPqRR/FIOCRUZ.

EVALUATION OF PARASITEMIA, BY TRYPANOSOMA CRUZI, IN THE EXPERIMENTAL INFECTION OF TRIATOMA INFESTANS BREEDING IN DIFFERENT RHYTHM OF FEEDING

Guilherme, CS, Nunes, EV, Oliviera Jr., OC, Westphalen, SR, Marei, SST, Ferreira, MA & Tolezano, JE

Seção de Parasitoses Sistêmicas-Instituto Adolfo Lutz - Av. Dr. Arnaldo, 351-São Paulo-SP

Some researches have attracted attention to the possibility of use of parasitemia rate, revealed by the number of infected triatomines in xenodiagnosis, as parameter for clinical prognosis of Chagas' disease in situation of T. cruzi/HIV coinfection. In this study we tried to evaluate the level of parasitemia with T. cruzi in groups of triatomines fed by means of 'in vivo" and "in vitro" procedures with blood of experimentally infected mice. It were constituted by four experimental groups (I, II, III and IV) with 100 T. infestans, between third and fourth instar of development. For each group it was offered a meal with mice blood in the seventh day of infection with Y strain of T. cruzi. Two groups (I and II) were fed "in vivo" and two others (III and IV) "in vitro". Since then, one group of each kind of feeding (I and III) stayed in fasting until the end of the study, while the other (II and IV) had continued being fed semimonthly in no infected mice. We analysed the rates of mortality and parasitemia, the last was expressed by the number of T. cruzi-infected bugs in each experimental condition (I, II, III and IV). The insects were individually examined at 20, 30, 60 and 90 days after contaminated blood meal. The results do not indicate any statistical significance, at level of P<0.05 for differences observed for mortality and parasitemia rates respectivelly, when considered groups fed "in vivo" (I with II) or between those fed "in vitro" (III with IV). Meanwhile, when compared the values of parasitemia and mortality between groups fed "in vivo" (I and II) with those fed "in vitro" (III and IV), 45 and 22% respectivelly, we obtained high statistical significance, at level of P<0.001. From this results, the authors concluded that attempts in demonstrating levels of parasitemia, by the number of infected triatomines after suspected T. cruzi-contamined blood meal as prognostic marker for Chagas' disease, the meal (xenodiagnosis) performed "in vivo" technical procedure will be most adequate for this purpose.

PERFORMANCE OF XENOCULTURE FOR TRYPANOSOMA CRUZI ISOLATION FROM CHAGASIC OR HIV COINFECTED PATIENTS

Bisugo, MC, Araújo, MFL, Ramirez, LP, Nunes, EV, Cunha, EA, Oliveira Jr., OC, Guilherme, CS & Tolezano, JE

Seção de Parasitoses Sistêmicas - Instituto Adolfo Lutz - São Paulo-SP

The isolation and preservation of aetiologycal agents have great importance in Public Health for planning studies on genetical characterization, recognition of epidemiologycal markers, and also to enable the development and performance of drug resistance of xenoculture as technical procedure for isolation of T. cruzi from Triatoma infestans used in xenodiagnosis applied in 78 patients. All of these patients, who were from diverse States of Brazil, presented chronical phase of Chagas' disease, and 32 of them were coinfected with HIV. A total of 101 "in vivo" and/or "in vitro" xenodiagnosis were carried out with 30-40 T. infestans between third and fourth instar of development. At the end of xenodiagnosis examinations, a variable number of triatomines had their intestines individually seeded after iodine alcohol treatment, in biphasic medium: Ducrey and LIT or BHI (with gentamicine). The cultures were examined every fifteen days until three months, and isolate preservate in liquid nitrogen. From 101 xenodiagnosis, 73(72.3%) were positive to T. cruzi, corresponding to 57 out 78 (73.1%) patients. For 51 out 57 (89.5%) patients who had positive xenodiagnosis, the parasite isolation was feasible by mean of xenoculture. From 491 triatomines that were infected in xenodiagnosis examination, a total of 250 samples of T. cruzi was isolated. From 399 bugs, negatives on xenodiagnosis by means of xenoculture T. cruzi was isolated in 25(6.3%). Among 22 dead nymphs, for which we could not examine on xenodiagnosis, the xenoculture enabled isolation of 2(9.1%) samples of T. cruzi. From negative xenodiagnosis no parasite was isolated. It observed 5% of loss of xenocultures by fungal or bacterial contamination. Also, an apparent better adaptation of slender forms to the culture mediumwas observed. Besides to possible T. cruzi isolation from around 90% of patients with positive xenodiagnosis, and from more than a half of infected triatomines, the xenoculture led the recognition and parasite isolation from 6.5% of insects that were dead or those identified as negatives when examined on "in vivo" or "in vitro" xenodiagnosis.

XENODIAGNOSIS FOR DIAGNOSTIC AND PARASITEMIC EVALUATION IN THE TRYPANOSOMA CRUZI/HIV COINFECTION.

*Oliveira Jr., OC, *Nunes, EV, **Ramirez, LP, *Guilherme, CS, ***Shikanai-Yasuda, MA, ***Sartori, AM, *Westphalen, SR, *Tolezano, JE

* Seção de Parasitoses Sistêmicas do Instituto Adolfo Lutz - SP

** LGMPV, ORSTOM Montpellier, France

*** HC-FMUSP

In a total of 36 HIV seropositive patients, all of them in chronical phase of Chagas' disease, we tried to comparatively evaluate two procedures of xenodiagnosis: "in vivo" and "in vitro", as well as the parasitemic rates with T. cruzi in this situation of coinfection. We simultaneously performed xenodiagnosis "in vivo", and the collection blood for using "in vitro" technique. In either procedures, "in vivo" and "in vitro", we used Triatoma infestans between third and fourth instar of development. After the blood meal when xenodiagnosis were done, the insects stayed in fasting, and examined individually, at 30 and 60 days. Results indicated positivity in xenodiagnosis as being at order of 19.4 and 27.8% for "in vivo" and "in vitro" procedure respectivelly, statiscally no significative, at level of P<0.05. The evaluation of parasitemia, in terms of number of T. cruzi infected bugs utilized in the positive xenodiagnosis, we observed a higher positivity among insects from "in vivo" technique than "in vitro", 51.3 and 25.5% respectivelly. Statistical analyses were significant, at level of P<0.001, for the differences in parasitemic and mortality rates, always against "in vitro" procedure. By this study and performed analyses, the authors concluded that in terms of parasitological diagnosis no matter in using any procedure "in vivo" or "in vitro". On the other hand, by the parasitemic evaluation the remarkable parameter for the attempt to establish clinical prognosis for Chagas' disease in the T. cruzi/HIV coinfection, is the technique performed "in vivo" that will possibly render this answer, remaining now further investigations in order to atenuate or eliminate the inconvenient reactions to saliva from triatomines or to find best performance for "in vivo" procedure.

EFFECTS OF THE INFECTION BY TRYPANOSOMA RANGELI AND BEAUVERIA BASSIANA ON RHODINUS PALLESCENS

Agudelo ULA, Moreno MJ.

Chagas dlsease caused by Trypanosoma cruzí and transmitted by Hemlpterous from Reduvlidae fanuly affect nearly 18 million people in Latinameric. In Colombia nearly I.6 million people is affected. Trypanosoma rangeli shares vectors and hosts with T cruzi, and acts as natural control of Triatonúnes, being innocuous to the vertebrates. Ainong the main vectors of T rangeli, R. prolixus and R. pallescens stand out. This last one has a great epidemiologic importance, for its great capacity of domiciiiation. Tlus specles has been found infected with T cruzi and T rangelt in three chfferent department of Coioinbia: Bohvar, Sucre and Antioquia. Also, it is known that sonie fungi are pathogenic to the triatomines, standing out Beauvepia bassiana.

In the present work, the strain SO-28 of T rangeli isolated from R. pallescens, and the strain I~-297 of B. bassiana, ísolated from Hemipterous were used to carry out infections in R. pallescens. Mxed infections were carried out infccting insects with T rangeli, once parasitisrn with the fungus was proved.

T'he percentage of ínfection of R. pallescens with T rangeli was IOO%. Morphologic alterations were detected in salivary gland level as regards to size, damage in tabique and less coloration of salivary gland. Maiformation of thorax and proboscis were observed and difficulty to relase cuticle during molt was significandy different between infected (6.25'/o) and control (OO/o) insects.

During the follow up of parasitism, a 38.75% mortality was ~rved in R. pallescens infected and only S% was found in controls. This infwüon infiuenced also the percentage of molting, beings significantiy greater in controis (98.3OO/o) than in infected insects (83.97O/o), Infection by T rangeli modified the ahmentary habits of the R. paliescens, ~ng infected insects to takc more tisne in search of food, with values between 9.2 to 24.4 days, contrasting with O to 14.9 days for controls.

As regards to thc infwüon with B. bassiana, a mortahty of 95% was observed between the days 2 and 20 posunfection, with a percentage of sporulation of 68.42%. In mixed infection the same percentage of niortahty was observcd.

R. pallescens showed to be very susceptible to the ínfections by T rangeli and B, bassiana being the fungl more pathogenic than parasit. The simultaneous presence of T rangelí and B. bassíana does not scem to have a synergic effect on the R. pallescens.

COMPARISON OF THE EVOLUTIVE CYCLE OF RHODNIUS DOMESTICUS (HEMIPTERA, REDUVIIDAE) INFECTED AND NONINFECTED WITH TRYPANOSOMA RANGELI.

Guarneri, A. A.; Carvalho Pinto, C.J. & Steindel, M.

Departamento de Microbiologia e Parasitologia, Universidade Federal de Santa Catarina. Caixa Postal 476, 88040-900, Florianópolis, Santa Catarina.

Rhodnius domesticus is a sylvatic triatominae species endemic from the Atlantic forest. The natural populations of this species are small and strongly associated with rodents and opossums nests in bromeliads clumps. Pathogenic effects of Trypanosoma rangeli in some triatomines are well established. Further studies have shown that R. domesticus is susceptible to T. rangeli infection in experimental conditions. The aim of this study was to investigate the role of T. rangeli infection on the evolutive cycle of R. domesticus under controlled conditions. First instar nymphs were collected from a colony at the day of hatching. They were individualized in plastic recipients of 5 x 4 cm and maintained at 28 ± 2ºC and 70±5% of relative humidity. Two groups of 38 insects were used for comparision. One group was fed weekly during 4 hours on mice infected with SC-58 T. rangeli strain and another on noninfected mice. Daily the insects were observed for moulting time and mortality until the entire cycle was completed. Furthermore, 10 couples of infected and noninfected insects were accompanied for a period of 5 months and the number of bloodmeals and fecundity were recorded. All insects fed on infected mice presented flagellates in their faeces characterizing their infection with T. rangeli. The duration of the entire evolutive cycle of the insects was of 93.4±10.6 and 86.5±9.5 days for infected and noninfected insects respectively. No differences were found in the number of boodmeals required for each stage between the two groups. The mortality rate was 36.8% for the infected and 18.4% for the noninfected group. The higher mortality was found on the infected group where 18.4% of the insects died during moult. Wing deformities were observed in 50% and 12.9% of the infected and noninfected groups respectively. No differences in the total number of eggs laid per female during a 5 month period was observed between the two groups. The higher mortality and wing deformity rate observed in the insects infected by T. rangeli may explain the low population density of this triatomine in nature.

Supported by: CEC.

DIPETALOGASTER MAXIMUS CAPACITY OF INFECTION BY TRYPANOSOMA RANGELI. I: EVOLUTION IN THE HEMOLYMPH.

Machado, EMM1, Grisard, EC1,2 & Alvarenga, NJ1.

1-Centro de Pesquisas René Rachou - FIOCRUZ, Caixa Postal 1743, Belo Horizonte, 30.190-002, MG, Brasil. E-mail: forever@inet.com.br

2-Departamento de Microbiologia e Parasitologia/CCB/UFSC, Florianopolis,SC, Brasil.

Ninety, first stage and 30 of fourth stage nymphs of Dipetalogaster maximus were artificially fed with medium containing about 380.000 flagellates/ml of culture forms of Trypanosoma rangeli (H8GS strain). On the 5th, and on every 25 days after infection, the triatomines were allowed to feed on chickens. The presence of the parasite in the hemocoel of the insects was checked after observing fifty microscopic fields (200X) of 2 to 5ml of hemolymph obtained from a cut made in one of their median tarsus. Examinations of the group of first stage nymphs was performed on the 7, 30, and 60th day after infection with the use of phase-contrast microscopy. The observed hemolymph positivity rate was of 36.7, 26.7 and 23.3% (p=0.83) respectively, with a mortality rate of 0, 16.6 and 20% (p=0.04). Smears were also prepared for staining and morphological studies of the parasite evolution. On the 110th day after infection the remaining triatomines (56) were submitted to a final examination with positivity of 14 (25%). Six of them were previously considered negative for the presence of T. rangeli. The observed hemolymph positivity rate of the fourth stage nymphs of D. maximus examined on the 7, 14 and 30th day after infection was of 57.7, 46.2 and 11.5% (p=0.003) with a mortality rate of 0, 15.4 and 19.2% (p=0.04) respectively. Only one of the 5 remaining triatomines of this group was positive on the 110th day after infection. Analysis of stained hemolymph smears revealed that this strain of T. rangeli was able to invade the hemocoel of D. maximus seven days after their ingestion presenting all forms of the evolutive-cycle (spheromastigotes, large and short epimastigotes, large tripomastigotes as well as "metacyclics").It was also noted that the parasite could not develop inside the hemocytes, as described by different authors in relation to the evolution of T. rangeli in Rhodnius sp. Parasites were not observed in salivary glands of the examined triatomines. PCR analysis confirmed the microscopic observations on positivity of the triatomines infection. The results have demonstrated the natural susceptibility of D. maximus to T. rangeli infection. The presence of flagellates in hemolymph of triatomines, previously considered negative, also suggest a possible immune response to infection by the insects.

Supported by FIOCRUZ, CAPES-PICD and CNPq.

STUDIES OF TRYPANOSOMA RANGELI DEVELOPMENT IN RHODNIUS PROLIXUS: PROPO SYSTEM

(1) Gomes, SAO; (1) Feder, D; (2)Thomas, N; (1) Garcia, ES & (1) Azambuja, P

(1)Departamento de Bioquímica e Biologia Molecular & (2) Departamento de Protozoologia (IOC), FIOCRUZ, Rio de Janeiro, Brasil.

The insects present various barriers to infection. Vector species exhibit variation of cellular and humoral immune responses. The prophenoloxidase system (proPO) exists in insects as an inactive precursor of phenoloxidase and is activated by microorganism (bacteria, fungi or by their wall components (YOSHIDA and ASHIDA, 1986) through biochemical pathway involving the action of serine-protease (ASHIDA, 1974). Certainly, the inactive and non-toxic proenzyme proPO prevents excessive oxidation of phenols to toxic quinone wich is responsible for melanin formation (SÖDERHÄLL and SMITH, 1986).

A better understanding of host/parasite relationships and host-defense reactions will help elucidate immune-evasion mechanisms developed by parasites in their insect hosts.

In Rhodnius prolixus the activation of the proPO pathway was observed in insects inoculated with bacteria or trypanosomatids (AZAMBUJA et al, 1986,1989; GREGORIO and RATCLIFFE 1991; MELLO et al, 1995). In this work, the activation of the prophenoloxidase pathway in the haemolymph of the inoculated insects was studied with differents forms of Trypanosoma rangeli. Phenoloxidase in haemolymph of insect inoculated with sterile culture medium showed no significant PO activity using L-DOPA as substrate. The absorbance at 492 nm was measure in an ELISA plate reader. PO activity in haemolymph taken from insect when inoculated with short forms of parasite was significantly higher than long forms of T. rangeli. We also measure the proPO activity in haemolymph of insects orally infected with both forms of T. rangeli showed no of significant activity.

Biological study showed that only long form orally infected insect invade hemocele. These results indicate that long forms of parasite could be able to overcome proPO system.

Financial supported from CNPq, FAPERJ and PAPES (FIOCRUZ).

STUDY OF METALLO-PROTEASES IN DIFFERENT TISSUES OF RHODNIUS PROLIXUS INOCULATED WITH TRYPANOSOMA RANGELI AND ENTEROBACTER CLOACAE (b12).

Feder, D.; Gomes, SAO.; Salles, J. M.; Garcia, E. S. & Azambuja, P.

Departamento de Bioquímica e Biologia Molecular, Instituto Oswaldo Cruz, Rio de Janeiro, Brasil.

Insects live in an environment is occupied by a variety of microorganisms like bacteria, fungi, protozoa, as well as other parasitizing insects. Therefore, insects must be equipped with an effective defense system that will eliminate pathogens. The insect immune system involves both cellular and humoral reactions that act in a close interplay to defend the organism against attacking microbes and parasites. A number of factors have been shown to be important in non-self recognition in insect hosts, one of these include components of the prophenoloxidase system (proPO). Phenoloxidase (PO) is present in invertebrates as an inactive precursor, the prophenoloxidase (proPO). The melanization, originating a protein-polyphenol matrix, is considered an important immune reaction for cuticle sclerotization, wound repair (ANDERSEN, 1985) and encapsulation of pathogens (GOTZ and BOMAN, 1985). Trypanosoma rangeli has triatomine bugs as insect vectors, for example, Rhodnius prolixus (D'ALESSANDRO, 1976; ZELEDON, 1987). T. rangeli develops in the gut but clearly invades the haemolymph, survives free in the blood or inside the hemocytes, and causes some pathogenicity toward the insect's vector (TOBIE, 1968, 1970)

The induction of proteases after bacterian infection was detected by zymograms analysis in immune haemolymph of vector Simulium ornatum (HAM, 1992) and was shown that the protease may be responsable for Po activation. Different protease activities was studies by zymograms analysis after SDS-polyacrilamide gel electrophoresis (SDS-PAGE) performed on samples of haemolymph, fat body and crop taken from insects infected with bacteria (Enterobacter cloacae b12 strain) or T. rangeli. Infection with bacteria or the protozoan was carried on by direct haemocel inoculation. T. rangeli was also given orally, in the range of 106 parasites/ ml of blood. Tissue extracts were analysed with gelatin as substrate. Distinct patterns of protease activity were observed: i) two proteases were detected in the haemolymph one day after infection; ii) two proteases were also detected in the fat bodies from controls; iii) both haemolymph and fat body proteases had the same molecular weights: 46 of 56 kDa; iv) both enzymes were shown to see as metallo-proteases or metal-activated enzymes. We showed experiments leading to the proposal that in the haematophagous bug, Rhodnius prolixus, proteases appearing in the haemolymph may be related to PO activity. v) several other proteases in the crop of insects infected with bacteria or T.rangeli, on 9th day after the infection was detected. These proteases are presently under investigation.

Financial supported from: CNPq, FAPERJ, FINEP and PAPES (FIOCRUZ).

STUDIES OF TRYPANOSOMA RANGELI OF DEVELOPMENT IN RHODNIUS PROLIXUS: ORAL INFECTION WITH DIFFERENT FORMS OF PARASITES.

(1) Gomes, SAO; (1) Feder, D; (2)Thomas, N; (1) Garcia, ES & (1) Azambuja, P

(1)Departamento de Bioquímica e Biologia Molecular & (2) Departamento de Protozoologia (IOC), FIOCRUZ, Rio de Janeiro, Brasil.

The innate immune response of insects has attracted considerable interest in recent years. The natural development of Trypanosoma rangeli (Tejera, 1920), H14 strain in its invertebrate host begins with the ingestion of blood containing mature trypanosomes. For many years the cycle was thought to be confined to the digestive tube as in the case of Trypanosoma cruzi. However, in 1952, GROOT reported flagellates in the haemolymph of Rhodnius prolixus infected with T. rangeli. This discovery led to the hypothesis of distinct way of T. rangeli transmission, originating from protozoan present in the salivary glands (bite).

In the invertebrate host T. rangeli exhibits two different forms, known as short and long epimastigotes, but their role has not been fully elucidated. These forms can be synchronously reproduced in culture: until 7 days predominantly short forms are found while on old cultures (from 12 days old on) long forms are the most abundant. By this way alternative preparations of cultured T. rangeli differents forms can be obtained.

The aim of the present study is to elucidate the development of short and long T. rangeli forms inside R. prolixus.

Short or long T. rangeli forms were administred orally. Short but not long forms, growth rapidly inside the crop and midgut.

By the 8th day after long form infection with T. rangeli, these parasites were seem in the hindgut. By contrast, when short forms are used in the oral infection, only long forms are observed in the hindgut after 10 days after infection.

Investigation of haemolymph until 30 days after infection with long forms of T. rangeli, shows giant hemocites only from 17thday on, although with short forms these alteration seens delayed. Despite of hemocytes differences, no parasites were detected in the salivary glands, when the insect were dissected until the 30 days after infection.

Financial supported from CNPq, FAPERJ and PAPES (FIOCRUZ).

THE EFFECT OF GALACTOSIDDE-BINDING LECTIN FROM RHODNIUS PROLIXUS HEMOLYMPH ON TRYPANOSOMA RANGELI/HEMOCYTE INTERACTION IN VITRO.

Mello, C. B1.; Nigam, Y2.; Gonzalez, M. S1.; Azambuja, P3. & Ratcliffe, N. A2.

(1) Department of General Biology, Universidade Federal Fluminense, Niteroi, RJ, Brazil; (2) Biomedical and Physiological Research Group, School of Biological Sciences, University College of Swansea, Singleton Park, Swansea, SA 2 8 PP, UK; and (3) Department of Biochemistry and Molecular Biology, Fundação Oswaldo Cruz, Av. Brasil 4365, Rio de Janeiro, cep: 21045-900, RJ, Brazil.

We purified by one step affinity chromatography (RATCLIFFE et al.;1996) a hemolymph galactoside-binding lectin from Rhodnius prolixus which we belive could play an important role in the development of Trypanosoma rangeli in the hemocoel of the insect vector. this lectin enhanced the activation of clump formation by T. rangeli in Rhodnius prolixus hemocyte monolayers, with an increase in clump size and in hemocyte fusion. This hemolymph lectin also significantly affected the motility and survival of T. rangeli culture short forms, when they were incubated in vitro. The partial N-terminal amino acid sequence of this lectin demonstated homology with mammalian galactins, the abl Drosophila gene product and several kinase proteins. Galactins are human galactoside-binding proteins involved with multiple processes, acting as opsonins, as cell adhesion molecules and activating complement or inducing cell activity (BARONDES, 1984; DRICKAMER, 1988; VASTA et al.; 1994); CHAMAS, R. et al.,1996; COOPER, 1997; THIEL, 1997). The DNA sequence of the abl Drosophila oncogene product has a tyrosine domain (HENKEMEYER et al., 1988) and the kinase proteins have a role in signalling during cell transformation. This result support our supposition that this lectin has an important role in the T. rangeli Reduviid bug interaction.

This work was supported by grants from Conselho de Desenvolvimento Cientifico e Tecnologico, Fundacão Oswaldo Cruz (PAPES project), Commission of European Communities (grant n° TS3-CT93-0226 to E.S.G and N.A.R.), The British Council (N.A.R.) and the Welcome Trust (N.A.R. and E.S.G.)

AGGLUTINATION ACTIVITY OF RHODNIUS PROLIXUS CROP EXTRACT AGAINST TRYPANOSOMA CRUZI AND ERYTHOCYTES INVOLVES TWO DISTINCT AGGLUTININS.

Mello, C. B1.; Nigam, Y2.; Feder, D3.;Azambuja, P3.;Garcia, E. S.3 ; Ratcliffe, N. A.2 .

(1) Department of General Biology, Universidade Federal Fluminense, Niteroi, RJ, Brazil;(2)Biomedical and Physiological Research Group, School of Biological Sciences, University College of Swansea, Singleton Park, Swansea, SA 2 8 PP; and (3) Department of Biochemistry and Molecular Biology, Fundacão Oswaldo Cruz, Av. Brasil 4365, Rio de Janeiro, CEP 21045, RJ, Brazil.

Previously, we showed in Rhodnius prolixusdigestive tube extract, the presence of agglutination activity against rabbit erythrocytes and epimastigote forms of some Trypanosoma cruzi strains. Apparently, this lectin has an important role in the development of T. cruzi in the insect vector digestive tube. In recent experiments, undertaken by adsorption with rabbit erythrocytes and protozoans, it was demonstrated that there are, at least, two different agglutinins in the insect crop, one specific for erytrocytes and the other for trypanosomatids. By varying the R. prolixus diet, it was shown that the erythrocyte agglutinin is present in gut extracts of the insect fed either with whole blood or just with washed erythrocytes, whilst, the trypanosome agglutinin is derived entirely fro the plasma of the blood meal. We tested large numbers of carbohydrates in an attempt to block the agglutination activity against the erythrocytes and parasites but only succeeded inhibition these molecules with p-nitrophenol-D-galactopyranoside.

This work was supported by grants from Conselho de Desenvolvimento Cientifico e Tecnologico, Fundacão Oswaldo Cruz (PAPES project), Commission of European Communities (grant n° TS3-CT93-0226 to E.S.G and N.A.R.), The British Council (N.A.R.) and the Welcome Trust (N.A.R. and E.S.G.).

BOTH DECAPITATION AND AZADIRACHTIN TREATMENT BLOCK TRYPANOSOMA CRUZI ADHESION TO THE MIDGUT OF IT'S VECTOR, RHODNIUS PROLIXUS.

(2) M. S .gonzalez, (1) H. P. Araujo (4) N. F. S, Nogueira, (2) C. B. Mello, (5) W. De Souza, (3) D. Feder, (3) P. Azambuja, and (3) E. S. Garcia

(1) Laboratório de Biologia Celular e Molecular, Departamento de Imunologia, Instituto Nacional de Controle de Qualidade em Saúde (INCQS), Fundação Oswaldo Cruz, Rio de Janeiro, RJ, Brasil

(2) Departamento de Biologia Geral, Instituto de Biologia, Universidade Federal Fluminense, Niterói, Rio de Janeiro, Brasil.

(3) Departamento de Bioquímica e Biologia Molecular, Instituto Oswaldo Cruz, Fundação Oswaldo Cruz, RJ, Brasil

(4)Laboratório de Biologia Celular e Tecidual, Centro de Biociências e Biotecnologia, Universidade Estadual do Norte Fluminense, Campos de Goytacases, Rio de Janeiro, Brasil

(5) Laboratório de Ultraestrutura Celular Hertha Meyer, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Brasil

In Rhodnius prolixus treatment with azadirachtin (a triterpenoid) results in a strong effects on the insect neuroendocrine system, disrupting T. cruzi development (GONZALEZ et al., 1992). On the other hand, azadirachtin induces significant changes in the arrangement of R. prolixus epithelial cells of the stomach and intestine , as evaluated by Scanning and Transmission Electron Microscopy (NOGUEIRA et al., 1997). Parallel experiments showed that R. prolixus decapitation, besides inducing the same midgut structural alterations described for azadirachtin, also leads to a lowered parasite infection (GONZALEZ et al, submited). We suggeste that: the neuroendocrine changes induced by azadirachtin or decapitation promete the perimicrovilar membrane alterations derived from these treatments do not constitute an accetable environment for parasite survival and infection inside the host (GARCIA et al., 1990, 1991; NOGUEIRA et al., 1997; GARCIA et al., 1991; GONZALEZ et al., submited). Preliminary, in vitro, experiments using videomicroscopy, showed that T. cruzi parasites are not able to adhere to crop and intestine of decapitated or azadirachtin-treated insects. It is believed that the perimicrovilar membrane surrouding the microvilli of gut cells is the adhesive area for replication (BURGOS et al., 1990). Azadirachtin and decapitation cause a dramatic alteration on the outer membrane surface as well as in the microvilli structure of the crop and intestine cells (NOGUEIRA et al., 1997). These changes should be responsible for the blockage of the adhesion capacity of T. cruzi in the midgut of it¢s invertebrate host, R. prolixus. We are presently determining the factors envolved on this inhibition of T. cruzi adhesion in the midgut of R. prolixus.

This work was supported by grants from Conselho de Desenvolvimento Cientifico e Tecnológico, Fundação Oswaldo Cruz (PAPES project), Universidade Estadual do Norte Fluminense, Commission of European Communities (grant n° TS3-CT93-0226 to E.S.G and N.A.R.), The British Council (N.A.R.) and the Welcome Trust (N.A.R. and E.S.G.)

FURTHER STUDIES ON HYDROPHOBIC ATTACHMENT OF TRYPANOSOMA CRUZI EPIMASTIGOTES

Schmidt, J.; Kleffmann T.; Kollien, A.; Schaub, G.A.

Department of Special Zoology, Ruhr University, 44780 Bochum, Germany

Trypanosoma cruzi multiplies and develops in the intestine of the triatomine vectors mainly as epimastigotes attached to the rectum cuticle. Previous work in this laboratory revealed that the rectum cuticle of Triatoma infestans has the same basic architecture as the external cuticle of arthropods. Notably, the luminal surface is covered by a waxy superficial layer. Chitin, by contrast, is a constituent of the procuticle and is not available at the luminal surface for binding of the flagellates. T. cruzi epimastigotes only attach by contact with the flagellum to the waxy superficial layer of the rectum cuticle, whereas in the midgut the flagellates remain free swimming and neither attach to the extracellular membrane layers nor to the microvilli. In vitro investigations of parasite binding on hydrophobic compared with hydrophilic substrates demonstrate that epimastigotes attach via hydrophobic interactions of the flagellum with the surface. An about 3 µm long area on the flagellum tip is specialized for the binding to the substrate. Small droplets, about 3-5 µm in diameter, of emulsified hexadecane bound selectively to this area. The attachment with the terminus of the flagellum ensures the settlement in a suitable region of the intestine and, in addition, the undulating movements of the resident trypanosomes may stir the external fluid to facilitate uptake of nutrients. While epimastigotes attach to all tested hydrophobic surfaces, vital trypomastigotes were never found attached to any of the substrates. This different behavior enables a separation of trypomastigotes from epimastigotes by hydrophobic chromatography using columns with octacosane-coated glass beads. If mixed populations with about 10% trypomastigotes are applied to the column, the „flow-through„ „or" non-binding" peak fractions contain 90-95% trypomastigotes and intermediate forms, with recovery rates of more than 60%. In contrast to separation by ion exchange chromatography with DEAE cellulose, the new technique employs the natural binding mechanism and does not affect the surface charge of the trypomastigotes.

FATTY ACID INCORPORATION BY RHODNIUS PROLIXUS MIDGUT INFECTED WITH TRYPANOSOMA CRUZI

#Dutra, PML; #Lopes, AHCS; *Alves-Ferreira M; *Masuda, H and *Atella GC.

*Depto. Bioquímica Médica, ICB/CCS; #Depto.Microbiologia Geral, IM/CCS - UFRJ/Cidade Universitária, Rio de Janeiro, CEP 21949-900, RJ, Brasil.

In insects the importance of lipid metabolism has been widely recognized. Neutral lipids constitute the major lipids of insect hemolymph and free fatty acids are the second most abundant neutral lipid. These lipids are an important fuel source in different organisms. In insect hemolymph lipophorins are the molecules responsible for lipid transfer between the tissues involved in lipid absorption, storage and utilization. We have previously demostrated that the midgut is the main organ in oleic acid absorption. Now we are studing the capacity of midgut infected with Trypanosoma cruzi to incorporates 14C-oleic acid from hemolymph. When 14C-oleic acid was injected into infected Rhodnius prolixus females the radioactivity was recovered associated with lipophorin particles. Fifteen minutes after injection almost all radioactivity was transferred to digestive tract. The time-course of 14C-oleic acid incorporation by midgut was linear up to 30 min. The incorporation increased when the midgut were infected with the Trypanosoma cruzi. The infected midguts used the 14C-oleic acid to esterified phospholipids and neutral lipids.

Supported by CNPq, FINEP.

PHYSIOLOGIAL CONDITIONS IN THE INTESTINAL TRACT OF TRIATOMA INFESTANS: EFFECT OF FEEDING

Kollien, A.H.; Kleffmann, T; Schaub, G.A.

Department of Special Zoology and Parasitology, Ruhr University, D-44801 Bochum, Germany

Throughout Latin America haematophagous reduviid bugs are the vectors of Trypanosoma cruzi, the causative agent of Chagas' disease. The parasite develops in the intestinal tract, where in different physiological compartments and under different physiological states of the insect different population densities and population structures of T. cruzi exist. Physiological conditions and their changes by feeding the bugs were determined in the rectum of Triatoma infestans by measuring the pH, osmolality, iones, amino acids and proteins. The pH of the rectal content of unfed bugs was slightly acidic (pH 6.1). After feeding, the pH in the first dark drop of faeces was with 5.9, similar to that of the rectal content, but the following drops of urine up to 24h after feeding were alkaline (pH 8.0), while between 24 and 48 hours after feeding the pH became acidic again. The osmolality of unfed T. infestans in the rectum was about 350 mOsm/kgH2O, and in the first drops of faeces and urine it dropped to 300 mOsm/kgH2O. Anions and cations were measured by capillary-electrophoresis. Chloride and sodium (>100 mmol/l) were the predominant ions in the rectal content. Concentrations of phosphate and potassium were about 10 mmol/l while those of citrate, malate, carbonate, acetate, sulfate, succionate, magnesium, calcium and ammonium were less than 5 mmol/l. These concentrations of ions remained nearly constant during the excretion. Analysis of the concentrations of free and protein/peptide bound amino acids, using PITC-derivatisation and RP-HPLC analysis at different times before and after feeding, showed a dramatic reduction of the concentrations of the free (from 500µg/ml to 15mg/ml) and bound (from 2000 µg/ml to 20 mg/ml) amino acids in the course of excretion. In the 2nd drop of urine, proteins/peptides were deposited which were rich in glycine and glutamate and with the 3rd drop those rich in leucine and tyrosine. By SDS-PAGE many proteins were found in faeces. Urine also contained two additional proteins at about 80 kDa, which were absent or existing only in a very low concentration in faeces, one protein at about 110 kDa and two peptides or less than 30 kDa. These investigations showed the dramatic changes of conditions in the intestinal tract of the bugs with which T. cruzi has to deal.

THE INFLUENCE OF BURCHELLIN ON RHODNIUS PROLIXUS: IN VIVO AND IN VITRO DIURESIS

Cabral, M.M.O.; Kollien, A.H.*; Azambuja, P.; Gottlieb, O.R.; Garcia, E.S.; Schaub, G.A.*

Departamento de Bioquimica e Biologia Molecular e Departamento de Fisiologia e Farmacodinamica, Instituto Oswaldo Cruz, Av. Brasil 5365, Rio de Janeiro, Brasil

* Department of Special Zoology and Parasitology, Ruhr University, D-44801 Bochum, Germany

Supported by DAAD/CAPES

Lignoids are widely distributed natural plant compounds (Gottlieb et al., 1989), which play an important role on animals. In insects some activities of lignans, as feeding deterrents or larval growth inhibitors have been described by MacRae et al. (1984). Since scarcely anything is known about the influence of neolignan on insect physiology, the objective of this study was to investigate the oral effect of burchellin, a neolignan isolated from Aniba burchelli (an Amazon plant), on the excretory system of 4th instar larvae of the reduviid bug Rhodnius prolixus. In vivo burchellin (100µg/ml) added to a bloodmeal reduced the excretion of the insect, which could be measured by a slower weight loss of the treated bug compared with the untreated controls up to 24 hours after feeding. In vitro the effect of the compound was studied by measuring the excretion rate of isolated Malpighian tubules (Maddrell, 1980). Malpighian tubules of untreated bugs showed a normal excretion when the drug was added or when the bioassay was performed with homogenate of prothoraric ganglion masses as diuretic hormone source from treated or untreated bugs. When Malpighian tubules and/or hemolymph were obtained from burchellin treated insects, the excretion was slightly lower than the control groups. These in vitro experiments showed that there is no direct effect of the drug on the Malpighian tubules, but an indirect effect via the insect. The data indicated that in R. prolixus burchellin inhibits the release of diuretic hormone from the prothoraric ganglion masses causing a disturbance on diuresis of oral treated bugs.

MacRae et al. (1984) Phytochemistry 23 (6), 1207-1220.

Maddrell (1980) Neurohormonal Tecniques in Insects, ed. (Springer-Verlag, Berlin), 80-90.

Gottlieb et al. (1989) Natural Products of Woody Plants: Chemicals Extraneous to the Lignocellulosic Cell Wall, J.W.Rowe, ed.(Springer- Verlag, Berlin), 439-511.

LETHAL EFFECT IN RHODNIUS PROLIXUS OF CANATOXIN AND ITS PROTEOLYTIC PEPTIDES PRODUCED BY INSECT CATHEPSINS.

Ferreira, C.T.S , *Gombarovits, M.E.C., Oliveira, C.M. and Carlini, C.R.

Depto. Bioquímica Médica - ICB/ CCS, Universidade Federal do Rio de Janeiro,* Depto Medicina Tropical-IOC-Fundação Oswaldo Cruz, Rio de Janeiro.

Canatoxin (CNTX) is a toxic protein isolated from Canavalia ensiformis seeds. The toxin injected i.p. or i.v. into rats or mice induces convulsions and death but it is inactive if given orally to these animals. CNTX was shown to be lethal when fed to insects relaying on cathepsins as their main digestive enzyme while insects with trypsin-based digestion were insensitive to the toxin. (Carlini et al., 1997). The data also showed that preventing CNTX digestion by the sensitive insects protected them from its lethal effect. The hypothesis that CNTX is probably "activated" by insect cathepsins to an "active" peptide is now under investigation. CNTX was digested in vitro with enzymes from a sensitive insect, the bruchid C. maculatus, and peptides obtained were tested for lethality by oral or meta-thoracic administration in another susceptible insect, R.. prolixus. The mixtures of CNTX peptides thus obtained were then fed to R. prolixus through a feeding apparatus or injected into the metathorax of adults. Lethality was recorded daily during 5 days. Results indicated that CNTX peptides obtained are toxic to R. prolixus by oral route. Gel-filtration of this material revealed at least three groups of toxic peptides, in the 8-12 kDa M.W. range. More extensive digestion of CNTX, resulted in peptides that were not toxic when given orally but were lethal if injected into metathorax of adult R. prolixus. The present data thus confirm the proteolytic activation of CNTX by insect cathepsins and suggest that this mechanism is probably related to the observed susceptibility of insects with cathepsin-based digestion to this toxic protein.CNPq-FINEP-PADCT.

HAEMOZOIN FORMATION IN THE MIDGUT OF RHODNIUS PROLIXUS

P.L.Oliveira1, M.F. de Oliveira2, H.Masuda3, U.Lins4 and M.D.Petretski5

1,2,3Departamento de Bioquímica Médica, CCS, UFRJ

4,5Universidade Estadual do Norte Fluminense

Blood-sucking insects use hemoglobin as a major food source and its digestion leads to generation of large amounts of hemin. Free heme is able to stimulate lipid peroxidation, as a consequence of increasing production of oxygen radicals. These insects, therefore face an oxidative challenge due to hemin release in the lumen of the midgut.

A few years ago, it was demonstrated the presence of a hemin polymer in the digestive vacuolum of Plasmodium parasites. Plasmodium is an intracellular parasite which also use hemoglobin as a food source during its life-cycle. The main defense of this organism against heme toxicity is the formation of a heme polymer named Haemozoin. In this work we describe haemozoin formation in the midgut of Rhodnius prolixus, a blood-sucking insect. The solubility of hemin, haemozoin extracted from Rhodnius , and the in vitro synthetic hemin polymer b-hematin, was compared in an alkaline solution (pH 9.1). Both b-hematin and Rhodnius haemozoin were insoluble at pH 9.1, whereas hemin was highly soluble. The infrared absorption spectra of b-hematin and haemozoin were analyzed and they were identical for both molecules. The heme polymerization in vitro was stimulated by midgut membranes of Rhodnius. Furthermore, transmission electron microscopy together with x-ray microanalysis showed large iron-rich aggregates in the lumen of the Rhodnius midgut with the appearance very similar to malarial pigment found in the Plasmodium digestive vacuolum. Taken together, these results suggest the presence of a haemozoin-like polymer in the midgut of Rhodnius prolixus. This is the first report of occurrence of haemozoin in an organism different from Plasmodium.

Financial Support: CNPq, FINEP, PADCT.

EFFECTS OF ADIPOKINETIC HORMONE ON FAT BODY LIPIDS IN VECTORS OF TRYPANOSOMA CRUZI (HEMIPTERA: REDUVIIDAE)

Canavoso L.E., Stariolo R. * & Rubiolo E.R.

Departamento de Bioquímica Clínica, Fac. Ciencias Químicas, U.N.Córdoba, Agencia Postal 4, CC 61, (5000) Córdoba, Argentina and * Servicio Nacional de Chagas, M.S. y A..S., Córdoba, Argentina.

Flight activity is one of the most energy-demanding processes in nature. It has been suggested that the limiting factor controlling wingbeat frecuency in insects is the availability of energy-yielding substrates. In insects that use lipid as a fuel to power sustained flight, commencement of flight activity elicits secretion of peptidergic adipokinetic hormone (AKH) that results in mobilization of stored fat and causing the transformation of high density lipophorin (HDLp) into low density ones (LDLp). This was also demonstrated in triatomine bugs by in vitro assays. With the aim to study the lipid mobilization of the fat bodies reserves in vectors of T. cruzi by hyperlipaemic stimuli, we analyze the biochemical changes after injection of AKH into Panstrongylus megistus, Dipetalogaster maximus and Triatoma infestans. For the experiences, groups of male grown-up insects from the three species, sinchronically moulted and fasting for 15 days were injected with 100 pmol of AKH -I (Schistocerca gregaria) dissolved in 10 ul of Ringer´s insect solution. The equivalent volume of Ringer´s solution was injected into control animals. After 90 min of AKH injection, hemolymph was collected from the different groups to determine total lipids, carbohydrates and the levels of total lipophorin by ELISA. The hemolymph was also submitted to KBr density gradient ultracentrifugation in order to obtain lipophorin particles and to determine their lipidic and proteic composition. In the groups of insects stimulated with AKH were observed a significant increase of the hemolymphatic total lipids respect to controls although the levels of carbohydrates remain without changes in both groups (mean 0.4 mg/ml). After injection of AKH, the three species showed a LDLp (1.090 g/ml) with 80 % of acylglycerol in their composition and with higher amount of ApoLp-III respect to HDLp fraction (1.130 g/ml) present in controls. The levels of total lipophorin did not change with AKH stimulus. Similar to other insects, the results in these vectors would confirm the participation of AKH on mobilization of the lipid reserves to provide energy during the flight.

Supported by SECyT - U.N. Córdoba.

RANSFORMATION OF LIPOPHORIN INDUCED BY FLIGHT ACTIVITY IN VECTORS OF CHAGAS' DISEASE

Canavoso L.E.; Stariolo R.*, Cano R.C. & Rubiolo E.R.

Departamento de Bioquímica Clínica, Fac. Ciencias Químicas, U.N. Córdoba, Agencia Postal 4, CC 61, (5000) Córdoba, Argentina and * Servicio Nacional de Chagas, M.S.y A.S. Argentina

During sustained flight adipokinetic hormone (AKH) is released from the corpora cardiaca and triggers 1,2 di-O-acylglycerols mobilization from triacylglycerols stored in fat body. Diacylglycerols are bound to high density lipophorin (HDLp) and transported by hemolymph to the flight muscle where they are used for energy generation. Whith the purpose to analyze the ability of triatomine bugs to mobilize lipids during flight and generating a low density lipophorin (LDLp) were carried out experiments with Dipetalogaster maximus and Panstrongylus megistus (Hemiptera : Rediviidae). Groups of male grown-up insects from two species, sinchronically moulted and fed on hens were fasting for 15 days and posteriorly, submitted to sustained flight under stream of warm for 45 min. Groups of insects without flight stimulus were employed as controls. Immediately after the flight, hemolymph was taken from insects to analyze total lipids, carbohydrates and lipophorins by KBr density gradient ultracentrifugation. On the other hand, total lipid and glycogen content were determined in fat body. In both species stimulated with flight were demonstrated an increase of the hemolymphatic lipids (more than 100 % in P. megistus) and undetectable levels of carbohydrates with a decrese of lipids and glycogen stored in fat body. In the stimulated groups, two lipophorin fractions were isolated by ultracentrifugation corresponding to HDLp (1.125-1.130 g/ml) and LDLp (1.078-1.089 g/ml) whereas in the controls animals only HDLp fraction (1.130 g/ml) was obtained. LDLp particles showed by TLC a higher levels of diacylglycerols than their HDLp precursor. * It was possible to demonstrate that the flight activity induces an hyperlipaemic effect in these vectors. The generation of LDLp particles was in accordance with metabolic requirements related to sustained flight. ** The results also indicates that both species would employ carbohydrates during initiation flight period.

Supported by CONICOR and SECyT- U.N.C.

a-GLYCEROPHOSPHATE DEHYDROGENASE ACTIVITY CORRELATES WITH FLIGHT CAPACITY IN TRIATOMINE BUGS

Soares, RPP1,3, Romanha, AJ3, Santoro, MM2, Dujardin, JP4,Schofield, CJ5 & Diotaiuti, L3.

1Departamento de Parasitologia, Universidade Federal de Minas Gerais, Caixa Postal 2486; 31270-901, Belo Horizonte, MG, Brazil. 2Departamento de Bioquímica e Imunologia, Universidade Federal de Minas Gerais, Caixa Postal 2486, 31270-901, Belo Horizonte, MG, Brazil.3Centro de Pesquisas René Rachou-FIOCRUZ, Caixa Postal 1743, 30.190-002, Belo Horizonte, MG, Brazil.4UMR CNRS-ORSTOM 9926 "Génétique Moléculaire des Parasites et des Vecteurs", BP 5045, 34032, Montpellier cedex, France.5London School of Hygiene and Tropical Medicine, WC1 E7HT, London, U. K.

Many studies have demonstrated the importance of the enzyme a-glycerophosphate dehydrogenase ( = glycerol-3-phosphate dehydrogenase: NAD 2-oxireductase, a-GPDH) in the regulation of flight activity in insects such as Diptera and Hymenoptera. In this process the glycerol phosphate produced in the cytoplasm is reoxidized to dihydroxyacetone phosphate by a-GPDH located on the outer surface of the inner mitochondrial membrane, and the electrons are passed on to the respiratory chain. We studied the relationship between a-GPDH activity and flight capacity of Triatoma infestans, T.sordida, T.brasiliensis and Panstrongylus megistus, which are the most important vectors of Chagas' disease in Brazil. The insects were placed in actographs over a period of several weeks, according to Lehane & Schofield (1982) (Bull.Ent.Res. 72, 497-510) in order to separate flyers from non-flyers. Enzyme electrophoresis was then carried out on flight muscle extracts, assaying five enzyme systems known to be involved in muscular activity: a-glycerophosphate dehydrogenase (E.C. 1.1.1.8, a-GPDH), glucose phosphate isomerase (E.C. 5.3.1.9., GPI), isocitrate dehydrogenase (E.C. 1.1.1.42., IDH), lactate dehydrogenase (E.C. 1.1.1.28., LDH) and malic enzyme (E.C. 1.1.1.40, ME). Enzymatic activity of a-GPDH was also measured spectrophotometrically at 25°C by following the production of NADH at 340nm. T.sordida and P.megistus showed greater flight activity than either T.infestans or T.brasiliensis, but within each species there was no difference in the enzyme profiles shown by flyers and non-flyers. Nevertheless, the a-GPDH profiles were distinct for each species, with T.infestans and T.brasiliensis showing greatest polymorphism (3 and 6 bands, respectively). Studies with other Hemiptera (waterstriders) have indicated that high polymorphism for a-GPDH is associated with reduced flight activity, which is in accordance with our results showing high polymorphism in the two species with least flight activity. This may be related to the adaptation of these species to the stable habitats offered by human dwellings, where active dispersal by flight becomes necessary only in conditions of extreme competition leading to hunger or starvation. Although we observed no difference in the a-GPDH profiles of flyers and non-flyers, the enzymatic activity of a-GPDH was higher in flyers compared to non-flyers.

Suppoted by: CNPq, CPqRR/FIOCRUZ and ECLAT research network (European Comission contract number ERBIC 18CT960042).

KINETIC PROPERTIES OF HEXOKINASE FROM THORACIC MUSCLES OF DIPETALOGASTER MAXIMUS.

Scaraffia, P. Y. & Gerez de Burgos, N. M.

Cátedra de Química Biológica, Facultad de Ciencias Médicas, Universidad Nacional de Córdoba, C.C. 35, Suc. 16, 5016 Córdoba, Argentina.

A previous work from this laboratory reported changes of enzyme activities in thoracic muscles of triatomine insects during the last stage of metamorphosis (Comp. Biochem. Physiol. 116A:2, 173-179, 1997). Important variation was observed for hexokinase activity in Dipetalogaster maximus and Triatoma infestans, both vectors of Trypanosoma cruzi. We have now studied properties of the hexoquinase (EC 2.7.1.1) of thoracic muscles from Dipetalogaster maximus adults. The enzyme presented a single fraction after separation by gel electrophoresis. Muscle homogenates contained endogenous substrates (glucose and ATP) and previous passage of preparations through a Sephadex G-25 column was needed to eliminate them.

Hexokinase showed a Michaelian behavior with both substrates. Assaying at 30ºC, apparent Km and Vmax for glucose at constant concentration of ATP (3 mM) increased by increasing the assay solution pH (7.0, 7.6, 8.0, 8.5). Relative catalytic efficiency (Vmax/Km) did not change significantly within the range of pHs tested. There was no inhibition up to 10 mM concentration of glucose.

Apparent Km for ATP at 1 mM glucose decreased and the catalytic efficiency increased as the pH was incremented. Vmax was significantly lower (65%) at pH 7.0 than at pHs 7.6, 8.0 and 8.5. There was marked inhibition by ATP which varied with the pH. At 10 mM ATP, percentages of inhibition with respect to the activity at optimal concentration of ATP were 87, 44, 11, and 6% at pHs 7.0, 7.6, 8.0 and 8.5 respectively. Vmax, Km and catalytic efficiency were incremented as temperature was increased from 20º to 37ºC. Temperature also affected inhibition by high concentrations of ATP. Percentages of inhibition by 10 mM ATP were 93, 42 and 10% at 20º, 30º and 37ºC respectively. These results could indicate that Dipetalogaster maximus hexokinase is endowed with regulatory properties allowing adaptation to changing medium conditions.

SIGNAL TRANSDUCTION IN THE CONTROL OF URATE SYNTHESIS IN R. PROLIXUS: MODULATION BY OXIDATIVE STRESS

Aurélio V. Graça-Souza; Mário A. C. Silva-Neto and Pedro L. Oliveira

Departamento de Bioquímica Médica- ICB-CCS-UFRJ-Rio de Janeiro-Brasil CEP 21910-590, E-mail: avsouza@server.bioqmed.ufrj.br

Abstract

Heme in aqueous solutions is a powerful catalyst of the formation of reactive oxygen species. We have recently proposed that hematophagous insects are exposed to intense oxidative stress due to hemoglobin hydrolysis in their digestive tract [Petretsky, M.D. et al. (1995) J. Biol. Chem. 270, 10893-10896].

We have shown in a previous report [Graça-Souza, A. V. et al. (1997) Free Rad. Biol. and Medicine 22, 209-214] that the blood-sucking insect Rhodnius prolixus presents very high levels of urate (up to 5 mM) in its hemolymph, and this is an important antioxidant defense against blood-feeding derived oxidative stress .

When fat bodies are incubated in vitro with hemin, urate production increases within a few minutes. This response suggests the existence of signal transduction mechanisms that modulate urate formation and, by this way, linking the presence of hemin to the urate biosynthesis pathway. Incubation of Rhodnius fat bodies with okadaic acid, a potent inhibitor of protein phosphatases, also raises the level of urate synthesis, suggesting that urate production can be controlled by protein phosphorylation/dephosphorylation. Urate synthesis by the fat body is stimulated by dibutyryl cAMP and inhibited by N[2((p-Bromocinnamil) amino) ethyl]-5-isoquinolinesulfonamide (H-89), a selective inhibitor of protein kinase A (PK A), as well as by the protein kinase C (PK C) activator 4-(-phorbol 12-myristate 13-acetate (PMA).

In the presence of hemin, however, inhibition of urate synthesis by H-89 does not occur, suggesting that the hemin stimulatory effect is not dependent on PK A activity. Addition of calphostin C, a specific inhibitor of PK C leads to complete inhibition of the hemin-induced urate production, suggesting that the triggering of this antioxidant response stimulated by a pro-oxidant molecule is dependent on PK C activation.

THE ROLE OF EICOSANOIDS IN THE ENDOCYTOSIS OF A HEME BINDING PROTEIN IN RHODNIUS PROLIXUS OOCYTES.

E.A. Machado, M.A.C. Silva-Neto and H. Masuda

Departamento de Bioquímica, ICB, CCS, UFRJ - Brasil

During their growth a wide range of proteins are accumulated by insect oocytes. Several of these proteins are removed from the hemolymph through receptor mediated endocytosis although detailed data is only available to the major yolk proteins. A heme binding protein (RHBP) was recently isolated from the hemolymph and eggs of the blood sucking bug Rhodnius prolixus and characterized(Oliveira et al. 1995, JBC 270, pp:10897-10901). Purified RHBP labelled with 125I in the protein moiety was then used in this study in order to investigate its endocytosis by the ovaries. 125I-RHBP incubated in the presence of ovaries was specifically removed from the media by selective receptors. This result suggests that Rhodnius oocytes have specific binding sites for RHBP at their surface and it seems probable that RHBP incorporation occurs at these sites. In addition the participation of second messengers in the incorporation of this protein was also addressed. The rate of RHBP uptake increased 50% in the presence of the Indomethacin (8-40 mM), a cyclooxigenase inhibitor, while in the presence of PGE2 (1-10 mM) strong inhibition of RHBP uptake was observed. The inhibitor of protein kinase C, Calphostin C (5mM), in the culture medium also increased the RHBP uptake (50%), while the addition of TPA (protein kinase C activator) decreased the RHBP uptake. Together these data show that RHBP uptake may be under protein phosphorylation control and/or related with calcium and Eicosanoid acids pathways. Phosphoproteins involved in this process are now being identified using 32P-labelled ovaries.

Supported by CNPq, FINEP and FAPERJ.

FUTHER ASPECTS OF A HEME BINDING PROTEIN SYNTHESIS BY THE FAT BODY OF RHODNIUS PROLIXUS

G.O.Paiva-Silva , E.A. Machado , P.L. Oliveira and H. Masuda

Depto. Bioquímica Médica , ICB, CCS, UFRJ

The hemolymph of the hematophagous insect Rhodnius prolixus presents an antioxidant activity conferred by the presence of a heme binding protein known as Rhodnius heme binding protein (RHBP). The binding of heme to apoRHBP , protein in its form free of heme, prevents the generation of oxygen free species, protecting tissues against oxidative damage caused by those species. It is possible to detect both apo and holoRHBP circulating in the hemolymph.

As shown in a previous report, RHBP is synthesized by the fat body of adult females. In this study we demonstrate that the fat body is able to synthesize not only the antioxidant form of RHBP (apoRHBP) but also the form bound of heme. The amount of apo and holoRHBP synthesized and secreted by this tissue varies during the days after feeding.

We also report that RHBP is present in the hemolymph of the intermediate instars of this insect and the fat body is a site of synthesis in all of them.

Supported by CNPq, FINEP and FAPER.

CLONING AND SEQUENCING OF RHODNIUS PROLIXUS HEME-BINDING PROTEIN (RHBP)

M.H.F. Sorgine, G.O.Paiva-Silva , H. Masuda , F.D. Rumjanek and P.L. Oliveira

Dept. Bioquímica Médica , ICB, CCS, UFRJ

The hemolymph of the hematophagous insect Rhodnius prolixus contains a heme binding protein (RHBP). RHBP binds heme in an 1:1 ratio and once bound to this protein, heme in not able to generate oxygen free species. This capacity confers to RHBP an antioxidant function in the hemolymph.

A previous work reported that RHBP is synthesized by the fat body of this insect. Based on that we purified total messenger RNA from an extract of females fat bodies by means of oligodT cellulose affinity chromatography. The RHBP cDNA was amplified by RT-PCR using a degenerated oligonucleotide based on the N-terminal aminoacid sequence and a specific one obtained in a previous work. The cDNA was cloned in a pUC18 vector and sequenced.

The resulting sequence showed no high degree of similarities with sequences of other known heme binding proteins.

The translated sequence was submitted to secondary structure analysis, revealing a high a helix content as has been previously suggested by circular dichroism of RHBP.

Supported by CNPq, FINEP and FAPERJ

BEHAVIORAL GENES IN DROSOPHILA AND THEIR POTENTIAL USE IN INSECT VECTOR SPECIES

Peixoto, A. A.& Hall, J. C.*

Departamento de Bioquímica e Biologia Molecular, Fundação Oswaldo Cruz, Rio de Janeiro 21045-900, Brazil.*Department of Biology, Brandeis University, Waltham, MA 02254, U.S.A.

One of the most important aspects of the biology of an insect vector species is its behavior. Most of the work on insect behavioral genetics was done using the experimental model Drosophila melanogaster. In this species, a number of genes have been identified through the isolation of mutations that affect a variety of behaviors, from circadian rhythms to sexual preference. One of these mutations is cacophony. During courtship Drosophila males vibrate their wings producing a "lovesong". The song of cacophony males is characterized by longer interpulse-intervals (IPIs) and pulses that contain more cycles than normal. This mutant also shows frequent convulsions and pronounced locomotor defects when exposed to high temperature (37oC). This temperature-sensitive phenotype seems consistent with the idea that cacophony is a mutation in a calcium channel gene. Analysis of the courtship song of some other temperature-sensitive physiological mutations suggests that genes involved in ion channel function may be a source of genetic variation for song parameters. The potential use of these and other Drosophila behavioral genes in the study of insect vector species is discussed.

MAINTENANCE OF COLONIES OF ANOPHELES (NYSSORHINCHUS) ALBITARSIS AND AN. (NYS) AQUASALIS ( DIPTERA: CULICIDAE) IN THE LABORATORY USING FREE MATING.

Lima, J. B. P; Brandolini, M. B; Quintana, M; de Paula, A. M. & Horosko, S.

USA Medical research Unit, Walter Reed Institute of Research & Instituto de Biologia do Exercito, Rio de Janeiro, Brazil.

The breeding of Anopheles in the laboratory is primordial to the development of research in malaria, because large numbers of mosquitoes are needed to study the sporogonic cycle of Plasmodium. For the successful maintenance of laboratory colonies, ample knowledge of the species involved is necessary. In the present study we established a laboratory colony of An. albitarsis collected from Massaranduba Santa Catarina, Brazil in 1993. This species was confirmed to be An. albitarsis s.s. by RAPD- PCR, ( Wilkerson et al. 1995). The colony was maintained until May 1995 using the forced mating technique as described by Ow Yang et al (1963) , with some modifications. There after, forced copulation was discontinued and 31 free-mating generation were reared. Randomly selected females from the F5 , F6 and F11 generations were examined for percent insemination, mean number of eggs oviposited, percent hatched, larval developed and larval mortality. In addition, colony of An aquasalis collected in Rio de Janeiro in June of 1995 , was reared for 28 free-mating generations. Again, randomly selected females from the F3 , F4 and F17 generations were examined as described above.

CHARACTERIZING ANOPHELINE EMBRYOGENESIS: CLARIFICATION AND PERMEABILIZATION INITIAL ASSAYS

Monnerat, Adelaide Tardin (1), Pereira Lima, José Bento (4), Soares, Maurílio José (2), Pelajo-Machado, Marcelo (3), Vale, Bruno Silva (3), Lenzi, Henrique Leonel (3), Freitas-Sibajev, Maria Goreti R (1), Galler, Ricardo (1) & Valle, Denise (1)

(1) Departamento de Bioquímica e Biologia Molecular, (2) Departamento de Ultraestrutura e Biologia Celular (3) Departamento de Patologia, Instituto Oswaldo Cruz, FIOCRUZ, (4) U.S.Army Medical Research Unit, RJ, Brasil

The construction of transgenic mosquitoes refractory to Plasmodium infection is an alternative to the control of malaria that has been the subject of a great deal of effort. In this sense the knowledge of the vectors' embryonary development is extremely important, although it has been surprisingly neglected. Transgenic mosquitoes are planned to be obtained by exogenous DNA injection into embryos and the consequent integration of this information into the polar cells. Hence, detailed knowledge of early embryogenesis, including time and position of pole cells formation, is essential. Knowledge of wild mosquito embryogenesis as a whole will also be important to the characterization of mutants that are currently being isolated and of transgenic lines to be generated.

If, on one hand, the recent availability of neotropical anophelines autonomous colonies has made the study of it's embryogenesis possible, on the other hand, the melanized and sclerotized nature of these eggs still poses a problem. Thus, different methods have been used with the aim of clarifying and permeabilizing anopheline eggs.

The clarification method chosen is enabling the definition of the major morphogenetic movements of this long germ band embryo, as well as the establishment of a parallel with Drosophila melanogaster. These analyses have been carried on through confocal microscopy, since clarified anopheline eggs proved to be autofluorescent.

Different methods are under test for the permeabilization of anopheline eggs. The method classically used for the dechorionation and devitellinization of Drosophila eggs was not effective when applied to anophelines, as verified by Scanning Electron Microscopy. Preliminary assays with dopa-decarboxilase (the enzyme responsible for the chorion hardening and darkening) inhibitors indicate it is a promising alternative to the anopheline eggs permeabilization: embryos treated with inhibitors and clarified before exposure to ethidium bromide (in order to visualize the nucleus) exhibited a higher reflection rate when stimulated with He/Ne 543nm laser (confocal microscopy) than control clarified eggs.

Supported by: Instituto Oswaldo Cruz, CNPq, European Community.

NEOTROPICAL ANOPHELINES CONTAIN GUT-SPECIFIC AND BLOOD MEAL-INDUCED PROTEINS HOMOLOGOUS TO ANOPHELES GAMBIAE TRYPSINS

Hamedi, Afsaneh (1), Albuquerque, Maria Matilde M. (1), Lourenço de Oliveira, Ricardo (2), Pereira Lima, José Bento (3), Couto Alcântara, Gilberto (1), Galler, Ricardo (1) & Valle, Denise (1)

(1) Departamento de Bioquímica e Biologia Molecular and (2) Departamento de Entomologia, Instituto Oswaldo Cruz, FIOCRUZ, (3) U.S. Army Medical Research Unit, RJ, Brasil

Construction and release in the field of transgenic anopheline mosquitoes refractory to Plasmodium is an alternative strategy to the control of malaria and is currently under development. To attain this task several criteria have to be fulfilled. Among them, the characterization of promoters from gut-specific and blood meal induced genes is of major importance, as this is where and when parasite/vector interaction first takes place. Consequently, promoters with these characteristics are good candidates for driving expression of Plasmodium refractoriness through the mosquito vector. In the major malaria vector from Africa, Anopheles gambiae, genes coding for digestive proteases, such as trypsins or chymotrypsins have been characterized and their respective promoters are being functionally dissected.

We intend to study homologous genes in neotropical anophelines to define conserved promoter elements that will allow the establishment of a broadly applicable strategy. In order to study trypsin expression during development we have produced recombinant An. gambiae trypsins 1, 2 and 4 in a bacterial system, derived from clones in the expression vector pDS56/RBSII/6xHis (a gift from Dr. Crisanti, University of Rome).

The expressed proteins were purified in a nickel-coupled ProBond column and the purified proteins were used to immunize rabbits. Derived antisera against the late (1, 2) and early (4) trypsins were titrated and their cross reaction against the different recombinant proteases evaluated.

The ability of these antibodies to recognize homologous proteins in neotropical anopheline extracts is under analysis using crude antisera or affinity purified specific antibodies. Antisera against the low abundant early trypsin-4 and the late trypsin-2 did not recognize specific bands in neotropical mosquito extracts, however, mosquito extracts were recognized by antiserum raised against the major late trypsin-1, as assayed by dot blot. Extracts from dissected guts (but not from the blood used to feed the insects) were also recognized by anti-An. gambiae trypsin-1 serum.

Supported by European Community, CNPq and Instituto Oswaldo Cruz.

CHYMOTRYPSIN GENES OF NEOTROPICAL ANOPHELINES ARE CLOSELY RELATED TO THOSE FROM ANOPHELES GAMBIAE

Almeida, R.W. (1), Valle, D. (1), Ferreira, I. I. (1), Albuquerque, Maria Matilde M. (1), Lourenço-de-Oliveira, R. (2), Pereira Lima, José Bento (3) & Galler, R. (1)

Departamento de Bioquímica e Biologia Molecular (1), Departamento de Entomologia (2), Instituto Oswaldo Cruz, FIOCRUZ, U.S. Army Medical Research Unit (3), RJ, Brasil.

Malaria still constitutes a central health problem in tropical countries and one of the main reasons is the failure to control the anopheline vectors effectively. Molecular Biology has opened up the ways to the establishment of an alternative strategy, based on mosquito genetic manipulation, that would permit the effective blockage of the Anopheles midgut wall penetration by Plasmodium parasites. The development of these transgenic mosquitoes requires, among others, a detailed understanding of the physiology of the mosquito's digestion. Furthermore, characterization of genes expressed in the organ and at the moment the parasite/vector interaction first takes place and their respective promoters will also be necessary to define the site of Plasmodium refractoriness expression. In this sense, digestive proteases coding genes appear as good candidates.

Utilizing an Anopheles gambiae PCR amplified chymotrypsin fragment as probe, Chymotrypsin 1 and 2 from Anopheles aquasalis and Anopheles darlingi have been isolated from genomic libraries and fully sequenced. Comparison of An. gambiae (the major African malaria vector) with An. darlingi and An. aquasalis (the major Brazilian malaria vectors) Chymotrypsin sequences revealed a high degree of homology among these genes. Similarly to An. gambiae, neotropical anophelines contain 2 chymotrypsin genes, clustered in a single locus. Each anopheline chymotrypsin gene sizes approximately 1 kb and has 2 small introns, related in size and position. An. aquasalis chymotrypsin genes are transcribed in the same direction. Aminoacid sequence comparison between neotropical anophelines shows a high level of identity (66 to 88%) and similarity (73 to 90%). When these sequences are compared to the homologous genes from An. gambiae, the values are still high: 60 to 70% of identity and 68 to 78% of similarity. We intend to extend chymotrypsin sequence analysis to the 5' untranscribed region, in order to help in the elucidation of relevant promoter domains and to define elements necessary to a broadly applicable strategy.

Supported by: Instituto Oswaldo Cruz, CNPq, European Community

STUDY OF THE PERITROFIC MATRIX PROTEINS IN AEDES AEGYPTI LARVAE

Gusmão, D.S., Pimenta, P.F.P*, Lemos, F. J. A.

Laboratório de Biologia Celular e Tecidual, Centro de Biociências e Biotecnologia, Universidade Estadual do Norte Fluminense, Campos dos Goytacazes, R.J., CEP 28015-620, Brazil

*Centro de Pesquisa René Rachou - CPqRR, Fundação Oswaldo Cruz - FIOCRUZ,

P.O.Box 1743. Av. Augusto Lima, 1715, Belo Horizonte-MG, CEP 30000, Brazil.

Fax: (031)295-3115 e-mail: pimenta@netra.cpq.rr.fiocruz.br

The mosquito Aedes aegypti is the most important vector of dengue and yellow fever, endemic diseases present in large scale in Latin America and Afrika. Mosquitoes like other haematophagous insects synthesize a chitin and protein containing peritrofic matrix (PM). Depending of the mosquito life stages, the PM is formed from a secretion produced by midgut epithelial cells (PM I, in adults), or by specialized cells of the cardia, at the junction of the foregut and midgut (PM II, in larvae). Despite the large number of information available on the PM, it is surprising how little is known about its composition and function. In order to understand these aspects, we begun a protein characterization of the A. aegypti larvae PM. For our studies, we used mainly fecal pellets from A. aegypti larvae. This material was progressively extracted with a series of buffers with increasing strengths of solubilization that are: H2O, 100mM Tris-HCl, pH7.5/150mM NaCl/5mM EDTA/0.1mM phenylmethylsulfonyl fluoride (PMSF), 20mM Tris-HCl pH 7.4/140mM NaCl/0.1% Triton X-100/0.1m PMSF and 20mM Tris-HCl pH 7.4/140mM NaCl/6M urea/ 0.1mM PMSF. A subsequent extraction was made using SDS-PAGE sample buffer.The eletrophoresis profile of this extract showed the presence of two predominant proteins (MW. 54,000 and 48,500). Six other lower abundant proteins also were observed. All of these proteins were detectable by SDS-PAGE of the dissected larval PMs homogenates, suggesting they are integral components of the PM. Polyclonal antibodies were raised against the dissected PM using CF-1 mice by i.m. route with 800 PMs plus alumen. By westernbloting, the antiserum recognized all the larval major proteins. The same antiserum, also recognized two proteins in the PM of A. aegypti adults and about five proteins in the PM of A. fluviatilis adults. On the other hand, no Culex quinquefasciatus larval protein was immunostaining by the antiserum. Additional studies are being carrying out in order to purify, to characterize and to understand the topographical distribution of these proteins in the PM structure.

Supported by CNPq, FAPERJ, FENORTE and PRONEX.

This investigation received financial support from the UNDP/ World Bank/ WHO Special Programme for Research and Training in Tropical Diseases (TRD).

* To whom the correspondence shoud be sent.

STUDY OF THE MOSQUITO CHITINOLYTIC SYSTEM AND ITS ROLE ON THE FORMATION AND DEGRADATION OF PERITROPHIC MATRIX

Távora, M.P.F. , Dias Filho, B.P. , Lemos,F.J.A. , Pimenta, P.F.P.*

Laboratório de Biologia Celular e Tecidual, Centro de Biociências e Biotecnologia , Universidade Estadual do Norte Fluminense , Campos dos Goytacazes, RJ, CEP 28015-620, Brazil

* Centro de Pesquisas René Rachou - CPqRR; Fundação Oswaldo Cruz - FIOCRUZ, P.O.Box 1743. Av. Augusto Lima, 1715, Belo Horizonte - MG, CEP 30000, Brazil. Fax: (031) 295-3115 E-mail: pimenta@netra.cpqrr.fiocruz.br

The peritrofic matrix (PM) has been an object of study during decades. This extracelular chitin-protein structure is present in the midgut of the mosquitoes involving the food bolus. It is recognized as a potential physical barrier to parasites which develop and multiply within the midgut. The knowlodge about which set of enzymes are involved on the PM synthesis and degradation is still unknown. The aim of this study is to identify and characterize the chitinolytic system of the midgut of A. aegypti. We also intend to correlate this enzymatic system with the formation and degradation of the PM. With the understanding of how this system works, it will be possible to think about the development of mechanisms that could be used to modify the natural process of PM formation. In this way, it is also possible to interrup the invasion process of the parasites. This work would form the basis for the genetic alteration of insect vectors susceptible to malaria and other important infection diseases. Measurement of chitinolytic activity in lysate of Aedes aegypti midguts, dissected at 0h and 4h after artificial feeding, with the substrates 4-mehtylumbelliferyl-b-D-N-acetylglucosamine (4MU[GlcNAc]1), and 4-mehtylumbelliferyl-b-D-N,N',N''- triacetylchitotriose (4MU[GlcNAc]3), showed that both chitinase and N-acetylglucosaminidase were involved in the liberation of the fluorophore methylumbelliferone. The chitinase activity was predominantly of the "endo"-type. The highest enzyme activity with respect to the two substrates appeared in the lysates of Aedes aegypti midguts dissected at 4h after the artificial feeding. For both 4MU[GlcNAc]1 and 4MU[GlcNAc]3 the activities ratios between hour 4 and hour 0 were aproximately 3. Under the conditions employed here, the lysates of the mosquitoes midguts dissected at 0h was virtually inactive toward 4MU[GlcNac}2. In contrast to the lysates of midguts dissected at 0h, the enzyme activities of the lysates at 4h against the 4MU[GlcNAc]1 substrate was higher against the 4MU[GlcNac]3 substrate. Optimal activity occurred at pH 6-8 for N-acetylglucosaminidase and pH 5-7 for chitinase. The hydrolysis of the substrate 4MU[GlcNAc]3 by the enzyme activities presented in the lysate of Aedes aegypti midguts was inhibited by allosamidin (Ki=1.08 , 88,9%). The chitinolytic enzyme activities were also examined by native polyacrylamide gel electrophoresis (12,5% and run at 80V for 2h). To visualize the enzyme activities, the gel was first equilibrated in 0.15M sodium acetate at pH5.0 and then incubated for 30 min at 37°C with the substrates above, at a final concentration of 1mM. A single protein band of both enzymes was obtained. Studies are in progress aiming to determine the substrate specificity, kinectic data and the enzymes purification using ultrafiltration, gel filtration and by ion exchange chromatography.

Supported by FENORTE, PRONEX, CNPq and This investigation received financial supported from the UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (TDR)* To whom correspondence should be sent.the native polyacrylamide gel electrophoresis. Studies are in progress aiming to determine the substrate specificity, kinectic data and the enzymes purification using ultrafiltration, gel filtration and by ion exchange chromatography.

Supported by FENORTE, PRONEX, CNPq and This investigation received financial supported from the UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (TDR)* To whom correspondence should be sent.

ASPECTS OF LECTIN-BINDINGS TO THE PERITROPHIC MATRIX COMPONENTES DURING ITS FORMATION IN AEDES AEGYPTI.

Lemos,V. P.; Lemos, F. J. A.; Duque-de-Mello,M. and Pimenta, P. F. P.*

Laboratório de Biologia Celular e Tecidual, Centro de Biociências e Biotecnologia, Universidade Estadual do Norte Fluminense, Campos dos Goytacazes,R.J., CEP 28015-620, Brazil and

* Centro de Pesquisas René Rachou - CPqRR; Fundação Oswaldo Cruz -FIOCRUZ,P.O.Box 1743. Av. Augusto Lima, 1715, Belo Horizonte-MG, CEP 30000, Brazil. Fax: (031)295-3115 E-mail: pimenta@netra.cpqrr.fiocruz.br

Endemic and epidemic transmission cycles of yellow fever and dengue diseases remains a serious problem that affect potentially the South America and Africa. These diseases are transmitted to humans by mosquito bites, specifically of Aedes aegypti. The Aedes aegypti-Plasmodium gallinaceum interaction studies is in regular use today. Therefore, A. aegypti is also considered a good model for malaria studies. As hematophagous insects, these mosquitoes need a blood meal to produce eggs. An important event is observed in the adult females mosquitoes in response to the blood meal: the formation of an extracellular matrix containing chitin, separating ingested food from the gut epithelial cells. This layer is called peritrophic matrix (PM). Our knowledge about this structure is incomplete; however, there has been a recent surge of interest in the PM because of its possible significance as a barrier to various pathogens . Our goal is to investigate the PM formation and its chemical composition. The initial approach at morphological level we did, it was to show the morphogenesis of the PM at the ultrastructural level using routine preparation and cytochemical techniques. In order to locate the primary component of the PM, the chitin, we used the lectin wheat germ agglutinin (WGA) conjugated with colloidal gold particles as a cytochemical marker that has affinity to oligomers and polymers of N-acetyl-glucosamine. Guts were dissected out from A. aegypti in 20 minutes, 1, 3, 12, 24 and 48h post blood meal (pbm). These guts were fixed and processed for transmission electron microscopy. For the cytochemical experiments, ultrathin sections of each time were put on grids covered with Formvar. Then they were incubated with gold-labeled WGA, diluted 1:10 in PBS-PEG pH 8.0 for 2 h. After several washes with PBS-PEG pH 7.2 and distilled water, the sections were stained with uranyl acetate and lead citrate and observed in the electron microscope. The ultrastructural aspects of the blood-fed guts at different times after the meal, revealed that around 20 minutes after the ingestion of the blood just few colloidal gold particles appears between the microvilli and beyond their tips. By 12 hr the PM is a discrete and uniform layer surrounding the blood bolus. After 24 hr, the PM is completely formed with a characteristic aspect of a very dense structure. Our cytochemical experiments confirmed the presence of chitin . The gold-labeled WGA on the PM is seen at 24hr. In our experiments we could observe the whole process of the chitin secretion by the mosquito gut epithelial cells until the complete PM formation and its degeneration at 48h pbm. Other gold-labeled lectins such ConA (Concanavalin A) , a tetrameric protein with a specificity for a-Mannose, alpha-glucose, and a-GlcNac, HPA (Helix pomatia) a glycoprotein that shows a strong preference for a-N-acetylgalactosamine residues and LFA (Limax flavus) that has affinity for sialic acid were used just in the PM at 24hr and all of them showed a positive results. Further studies will be done using these lectins in the other times of the formation of the PM in order to have a better idea about the topographical distribution of the glycoconjugates present in the PM composition.

Supported by CNPq, FAPERJ, FENORTE and PRONEX.

This investigation received financial support from the UNDP/ World Bank/ WHO Special Programme for Research

and Training in Tropical Diseases(TDR) * To whom the correspondence should be sent.

THE MIDGUT OF AEDES AEGYPTI: HISTOCHEMICAL AND CYTOCHEMICAL STUDY.

Sheila T. Pereira, Mohammed Shahabuddin and Paulo P.F.Pimenta.*

Laboratório de Biologia Celular e Tecidual, Centro de Biociências e Biotecnologia, Universidade Estadual do Norte Fluminense, Campos dos Goytacazes, R.J., CEP 28015-620, Brazil and * Centro de Pesquisas René Rachou- CPqRR; Fundação Oswaldo Cruz - FIOCRUZ, P. O. Box 1743. Av.Augusto Lima, 1715, Belo Horizonte - MG, CEP 30000, Brazil. Fax (031) 295-3115

E-mail : pimenta@netra.cpqrr.fiocruz.br

The mosquito Aedes aegypti is an important vector of tropical diseases, and it is also used as a common model for studying malaria infection. The midgut of the female mosquito is the place where it is initiate the whole process of malaria infection. Just after the ingestion of the blood, parasites develop asynchronously within the bloodmeal, and spread over the entire midgut. Our recent obsevation suggests a selected invasion of specific midgut cells. This present study intends to characterize the surface of the midgut epithelial cells and better understand the difference between them. Mosquito midguts were processed for several cytochemistry techniques and observed by light and transmission electron microscopies. We used the following methods: Periodic Acid Schiff's (PAS), lectin binding, ruthenuim red, Thiery and filipin treatment. The reaction of PAS and Thiery showed neutral mucosubstances and glucosaminoglycans on the epithelium surface. The lectin binding sites were visualized by the the lectin-colloidal gold complexes. The following lectins were used: WGA (Wheat germ agglutinin), HPA (Helix pomatia agglutinin), PNA (Peanut agglutinin) , WFA (Wisteria floribunda agglutinin), Con A (Concavalin agglutinin), LFA (Limax flavus), BS I and BS II (Bandeiraea simplicifolia), and UEA (Ulex europaeus agglutinin). Only the WGA, HPA and PNA showed a strongly binding to the midgut surface cells. These results indicated that the following sugar components are conceivable exposed over the midgut cells surface : N-acetyl-a-D-galactosaminyl residues, N-acetil-b-D-glucosaminyl residues, N-acetylneuraminic (sialic acid), glucoronic acid and phosphorycholine analogs. We also investigated the distribuition of cholesterol present in the epithelium surface using the filipin treatment technique. A distribuition of filipin-sterol complexes were observed in the microvilii membrane of Aedes aegypti midgut cells. In conclusion, our experiments suggest that the midgut epithelial cells have different carbohydrates in its surface. Further controlled studies will indicate which glycoconjugates are related with these sugar residues.

Support by CNPq, FAPERJ, FENORTE and PRONEX.

This investigation received financial support from the UNDP/ World Bank/ WHO Special Programme for Research and Training in Tropical Diseases (TRD). * To whom the correspondence shoud be sent.

MORPHOLOGICAL AND BIOCHEMICAL ASPECTS OF ADULTS ANOPHELES DARLINGI SALIVARY GLANDS.

Moreira, C. K.; Marinotti, O. & Bijovsky, A. T.

Departamento de Parasitologia - ICB - USP, 05508-900, São Paulo, SP, Brasil.

The salivary glands of female anopheline mosquitoes are directly involved in the transmission of malaria parasites to the vertebrate hosts. The infective sporozoites remain in the glands until they are injected in the host during mosquito blood meal. We investigated some morphological and biochemical aspects of the adult female salivary glands of Anopheles darlingi, the main malaria vector in Brazil.

Salivary glands of female mosquitoes are paired organs that lie in the thorax on either side of the oesophagus. They have two lateral lobes, comprising proximal and distal portions, and a medium lobe. Lobes are acinar structures, organised as an unicellular epithelium that surrounds a salivary duct which is covered by a cuticle in the proximal portions of the gland. The cellular architecture is very similar among all portions of the gland with secretory material appearing as large masses. The cells in the proximal portion of the lateral lobes show asynchronic cycles of secretory activity; they have a cisterneiform endoplasmic reticulum and finely filamentous secretory masses. On the other hand, the cells in the distal portion have a synchronic cycle of activity; they own a reticulate endoplasmic reticulum and the secretory masses are denser, presenting a mottled pattern. The medium lobe cytoplasm is similar to the last one but the secretory masses are very uniform and extremely electrondense.

Surprisingly, preliminary studies on male mosquito salivary glands show that they are unilobar organs. Electron microscopy reveals an appearance similar to that observed in the proximal portion of the lateral lobes of female gland: secretory masses finely filamentous involved by thin cytoplasmic strips and cells with asynchronic cycles of secretory activity.

Biochemical analysis revealed apyrase, alpha-glucosidase and lysozyme activities in the salivary glands extracts. The alpha-glucosidase and lysozyme activities are mainly accumulated in the proximal portion of the gland while the apyrase is mainly accumulated in the distal portion. This differential distribution of the analysed enzymes reflects a specialisation of different regions of the gland for sugar and blood feeding. We are now trying to correlate the morphological differences with the functional properties.

Financial support: FAPESP, CNPq, UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases.

OBSERVATIONS ON THE SALIVARY GLANDS OF LUTZOMYIA LONGIPALPIS OF DIFFERENT AGES

Brazil,B.G.* ; Alves, J.M.C.* ; Pedras,M.J.* ; Lino Neto, J.**; Brazil,R.P.*

*Laboratório de Leishmanioses,Centro de Pesquisas René Rachou-FIOCRUZ, Caixa Postal 1743 Belo Horizonte,30190-002,Minas Gerais,Brasil. **Departamento de Biologia Geral, Universidade Federal de Viçosa, Minas Gerais,Brasil.

Following our studies of the salivary glands (SG) of Lutzomyia longipalpis we compared insects fixed at different times after emergence from pupae. Fixatives used were Bouin's and Carnoy's or Bouin's and Kleinenberg's.The embbeding medium was historesin (hidroxi ethyl methacrylate) of which 2um thich sections were obtained, stained with hematoxylin/eosin and observed under the light microscope. In insects up to 24 h of age, the SG walls showed only large cells,bearing large nuclei and nucleoli and presenting numerous vacuoli in the citoplasm, features of secreting cells. Insects fixed from 24h up to 96h (5th day ) after emergence, showed a very thin wall were only small cells strongly and homogeneously stained by hematoxylin were seen.In these cells sometimes distinction between citoplasm and nucleus was difficult. The gland contents in younger insects presented granules of large and small sizes well stained by the hematoxylin. Droplets of a substance that do not mix with the secretion was present and the stain appeared to be only deposited on the surface of the droplets, probably due to the presence of acidic groups on it. In the insects over 24h of age the gland content was more homogeneous showing always very fine basophilic granules in more abundance within eosinophilic medium of the gland reservoir. These findings suggests that in this species the SG of the female from the emergence up to the 5th day of age, go on a phase of active secretion when different substances are produced wich is followed by a non secreting phase during which maturation of the saliva occurs.The confirmation of this hipothesis will be searched by histochemical and biological methods.

Supported by: CAPES, CNPq , FIOCRUZ e UFV.

PARTIAL PURIFICATION AND CHARACTERIZATION OF A TRYPSIN-LIKE ACTIVITY FROM TRIATOMA INFESTANS SALIVARY GLANDS.

David, A .P.ª, Amino, R.b , Schenkman, S.b, Sampaio, C.A .M.ª & Tanaka, A .S.ª

ªDepartamento de Bioquímica, bDepartamento de Microbiologia, Imunologia e Parasitologia, Escola Paulista de Medicina, Universidade Federal de São Paulo, Rua Botucatu, 862, São Paulo, Brazil, Tanaka.bioq@epm.br

Trypsins are endopeptidases, members of serine protease family, that cleave polypeptide chains on the carboxyl side of basic amino acids (arginine and lysine). They have pH optimum between 8.0-9.0 and molecular mass around 20-35 kDa. Digestive trypsin-like activity has been reported in several species of different insect orders, save some Coleopteran species and the Hemipteran, in which the proteolytic digestion seems to rely on the action of cysteine and aspartic proteases (Terra,et al. 1996, In: Biology of the Insect Midgut, Lehane, and Billingsley, eds. Chapman & Hall, p.153-194). Here we described the preliminary isolation and characterization of a trypsin-like activity in salivary glands of the hemipteran Triatoma infestans, which is important vector of Chagas's disease in Brazil. The proteolytic enzyme (triapsin) was purified by ion-exchange chromatography, gel filtration or affinity chromatography on soybean trypsin inhibitor-Sepharose from homogenates of 50 glands pairs. The triapsin displayed a molecular weight of approximately 25 kDa by gel filtration on a Zorbax (G-250) column in a HPLC system. The partially purified triapsin exhibited a pH optimum between 7.5-8.5, and Km values for the synthetic substrates S2222 (Bz-Ile-Glu-Gly-Arg-pNA) and Ac-Phe-Arg-pNA of 0.24 and 0.40 mM, respectively. Two protein serine protease inhibitors from plants, soybean trypsin inhibitor and Bauhinia ungulata Factor Xa inhibitor, inhibited triapsin activity with Ki values of 57 and 99 nM, respectively. Other synthetic serine protease inhibitors presented only weak inhibition, e.g. benzamidine with Ki = 0.28 mM, and phenylmethylsulfonyl fluoride, a typical serine protease inhibitor, just showed traces of inhibition. Is unlikely that this enzyme has a digestive role since its activity was detected only in the salivary glands, not in midgut. Moreover, the midgut pH is acidic and contains thrombin inhibitor that also inhibits trypsin. Therefore, the triapsin could be have a role in the vector-host interaction, most likely during the bite on feeding.

Financial support: FAPESP, CNPq

EXPERIMENTAL MODIFICATIONS OF THE NATURAL TRANSMISSION OF TRYPANOSOMA CRUZI BY THE VECTOR

Heide, B.S.; Schaub, G.A.

Department of Special Zoology and Parasitology, Ruhr University, D-44801 Bochum, Germany

Investigating the modifications of the natural way of transmission of Trypanosoma cruzi to mammals, intradermal or subcutaneous injection of isolated T. cruzi and faeces of the vector into C57/Bl6 mice caused an initial retardation of the development of the parasite in the vertebrate host in comparison to injections without faeces. Simulating natural transmission led to very different results: Triatoma infestans with or without salivary glands were allowed to feed on the backs of C57/Bl6 mice. T. cruzi "Chile 5" were applied surfically to the area of the bite, using parasites in faeces of the bug, infested or free of bacterial symbionts, or PBS only. Whereas transmission of Leishmania is supported by the sandfly saliva (1), T. cruzi development does not seem to be affected by saliva of triatomines or different components of the faeces. In other experiments we injected different doses of T. cruzi (10 to 104) into nude mice establishing a scale of disease development. Comparing the "natural transmission experiments" with these results we found that 50-500 T. cruzi invade the vertebrate host through the puncture of the mouthparts. The high rate of morbidity in our experiments (70 to 100%) shows that this way of infection is - contrary to other results (2) - not at all unlikely. Using additional T. cruzi strains we can find whether or not these differences are caused by the parasite.

(1) Theodos CM, Ribero JMC, Titus RJ (1991) Infect Imm 59, 1592-1598.

(2) Soares VA, Marsden PD (1986) Rev Soc Bras Med Trop 19: 165-166.

COMPARATIVE MORPHOLOGIC STUDY OF THE SALIVARY COMPLEX OF TRIATOMINAE (HEMIPTERA: REDUVIIDAE)

Santos, C.M.; Jurberg, J.; Galvão, C. & Lent, H.

Instituto Oswaldo Cruz, Departamento de Entomologia, Laboratório Nacional e Internacional de Referência em Taxonomia de Triatomíneos. Avda. Brasil 4365, 21045-900 Rio de Janeiro, RJ, Brasil.

Authors have studied the salivary complexes of five genera of Triatominae, looking for new parameters and tools for taxonomic and phylogenetic approaches. Three of them belong to the tribe Triatomini (Triatoma Laporte, 1832; Panstrongylus Berg, 1879, and Mepraia Mazza, Gajardo & Jörg, 1940), and two belong to the tribe Rhodniini (Rhodnius Stal, 1859, and Psammolestes Bergroth, 1911); to these genera belong most of the species vectors related to Chagas' disease.The salivary complex is composed (Baptist, 1941) by a Principal Gland ( Glândula Principal: GP) formed by two regions called Anterior Lobe (Lobo anterior: Lob a) and Posterior Lobe (Lobo posterior: Lob p), one Accesory Gland (Glândula Acessória: GA), a Principal Duct (Canal Principal: Can P), an Accessory Duct (Canal Acessório: Can A), a Protuberance (Prot) and a Hilum (Hi) (Barth, 1954).For this study authors used 10 fifth instar nymphs of Triatoma infestans (Klug, 1834), Panstrongylus megistus (Burmeister, 1835), Mepraia spinolai (Porter, 1934) and Rhodnius prolixus Stal, 1859, from the LNIRTT-IOC Insectary, and a single specimen of Psammolestes tertius Lent & Jurberg, 1965 sent from Goiania University and collected in Posse, GO. Nymphs were placed into cylindrical crystallizing vessels separated by species and kept in a BOD stove at 28+/-1C and % of RH, fed twice a week to accelerate the ecdysis, until they attained the adult stage. The sixth day after the last moulting, and being starved, especimens were dissected while immersed in Petri dishes with saline solution; salivary glands after extracted , were designed with camera lucida.The comparative analysis of salivary complexes in Triatominae showed a homogeneous structure but shapes are enough different between the five genera to take them into account for generic diagnosis.

Supported by CNPq, agreement Fiocruz/FNS and European Comission contract IC18-CT96-0042

SALIVARY PROTEINS DISTINGUISH RHODNIUS PROLIXUS POPULATIONS.

Soares, RPP1,2, Gontijo, NF1, Pires, HHR2, Romanha, AJ2, Diotaiuti, L2 & Pereira, MH1.

1Departamento de Parasitologia, Universidade Federal de Minas Gerais, Caixa Postal 2486; 31270-901, Belo Horizonte, MG, Brazil. 2Centro de Pesquisas René Rachou-FIOCRUZ, Caixa Postal 1743, 30.190-002, Belo Horizonte, MG, Brazil.

Rhodnius prolixus is the main vector of Chagas' disease in Colombia, Venezuela and Central America. In Colombia and Venezuela, it is found in the sylvatic and domestic habitats, while in Central America it is found only in the domestic habitats. Many studies comparing Triatominae populations are being carried out using isoenzymes, morphometry and morphological features. In this work, we describe another method based on electrophoresis of some saliva components (haemoproteins), which have importance in the interaction triatomine-host during blood-sucking. The main actions of these proteins are involved in the vasodilatation, anticoagulant and antihistaminic activities. It has been described four haemoproteins (nitrophorins) in R.prolixus. Adult females had their salivary glands dissected. Haemoproteins electrophoresis was made in starch gel and stained by tetramethylbenzidine, after fixation in ethanol, acetic acid and water (1:1:1). Populations from Honduras, Venezuela and Brazil were used. Thirteen different profiles were found ranging from 3 to 8 bands. A band sharing analysis was made and a taxon/character matrix was constructed on the basis of the presence/absence of bands. The phenogram based on a band pairwise comparisos was constructed using the Dice similarity coefficient. The data derived from these comparisons was collected into a matrix of similarity that was then used for unweighted pair group method analysis (UPGMA). The phenogram showed a clear separation between the individuals of Brazil from the others. Venezuela and Honduras could not be distinguished, being Honduras the most monomorphic population. The brazilian population was different, probably reflecting the geographical isolation. The high similarity between Honduras and Venezuela is in agreement with the hypothesis of the introduction of R.prolixus in Central America from Venezuela individuals. But the dispersion mechanism between these countries remain unknown. The low level of polymorphism presented by Honduras individuals thus support the hypothesis of a founder effect, in which a small number of venezuelan individuals were originaly introduced in Honduras.

Supported by: CPqRR/FIOCRUZ.

CHARACTERIZATION OF DIFFERENT POPULATIONS OF PANSTRONGYLUS MEGISTUS, BURMEISTER, 1835. III. SALIVA PROTEINS.

Barbosa, SE1,2, Pereira, MH1, Soares, RPP1,2 & Diotaiuti, L2.

1Departamento de Parasitologia, Universidade Federal de Minas Gerais, Caixa Postal 2486; 31270-901, Belo Horizonte, MG, Brazil.2Centro de Pesquisas René Rachou-FIOCRUZ, Caixa Postal 1743, 30.190-002, Belo Horizonte, MG, Brazil.

Electrophoresis of triatomines saliva shows complex migration profiles in many species. It has also demonstrated that saliva has an important role in the interaction triatomine-host. In this work we compared saliva of three P.megistus populations: Bahia, where it is usually domestic; Minas Gerais, where the species is found in both habitats (wild and domestic) and Santa Catarina, which has low potential of colonizing the artificial environment. Saliva was collected by electric stimulation. Electrophoresis (SDS-PAGE) of triatomine saliva was carried out on 12,5% polyacrylamide slab gel containing Tris-sodium dodecylsulfate buffer and the protein bands were detected by Coomassie blue G-250. Protein content in the saliva was determined by the method of Bradford (1976), being approximately 5 mg of protein were loaded in each lane. It was performed densitometer scans on all the lanes of the gels using IS-1000 Digital Imaging System. Only the bands that exhibit 5% of total protein applied were considered in our analysis. Seventeen profiles were found ranging from 4 to 8 bands. A band sharing analysis was made and a taxon/character matrix was constructed on the basis of the presence/absence of bands. The phenogram based on a band pairwise comparisons was constructed using the Dice similarity coefficient. The data derived from these comparisons was collected into a matrix of similarity that was then used for unweighted pair group method analysis (UPGMA). The phenogram showed a separation into two distinct groups, being possible to distinguish Bahia from Santa Catarina. Nevertheless, Minas Gerais individuals were in an intermediate similarity level being more similar to Santa Catarina, only 25% of the insects were similar to Bahia. It was observed a decreasing in the average number of protein bands analyzed from Santa Catarina to Bahia (p<0,01). Minas Gerais was different from Bahia and Santa Catarina with an intermediate number of bands (p<0,01). Our results showed a simplification of the electrophoretic profiles from Santa Catarina towards Bahia. It is interesting to notice that the populations of Santa Catarina (sylvatic) and Minas Gerais (sylvatic and domestic) were more polimorphic than Bahia (only domestic). The phenomenon of simplification has been demonstrated for other Triatomine species as Triatoma infestans. Although our results suggest that it could have occurred for P.megistus for these characteristics, many other parameters are being studied to better understand this trend.

Supported by: Capes, CPqRR/FIOCRUZ

POLYMORPHISM IN THE SECOND INTERNAL TRANSCRIBED SPACER (ITS2) OF ANOPHELES (KERTESZIA) CRUZI (DIPTERA: CULICIDAE) FROM THE STATE OF SÃO PAULO, BRAZIL.

Malafronte, R.S.1; Marrelli, M.T.1,2; Carreri-Bruno, G.C.3; Urbinatti, P.R.4 & Marinotti, O2. 1-Inst.Med.Trop.de São Paulo.Av.Dr.Enéas de Carvalho Aguiar 470,SP-CEP:05403-000, 2-Inst.Ciências Biomédicas-USP, 3-SUCEN, 4-Fac.de Saúde Pública - USP.

The importance of the correct identification of siblings species of anophelines for the control of malaria has been discussed by several researchers. The DNA sequences of the second intergenic transcribed spacer (ITS2) has been used as a diagnostic tool for the identification of several medically important mosquitoes. Anophelines of the subgenus Kerteszia are the vectors of malaria in the State of São Paulo. Among them, the most important vector species, An.cruzi, live associated with bromeliad plants in the Atlantic Forest. We captured anophelines in the Litoral region (Peruíbe and Cananéia) and Vale do Ribeira (Juquiazinho, Shangrilá and Sete Barras) and their genomic DNA was extracted. PCR for specific amplification of ITS2 was conducted with CP16 (GCGGGTACCATGCTTAAATTTAGGGGGTA) and CP17 (GCGCCGCGGTGTGAACTGCAGGACACATG) primers. The amplified fragments containing about 429 bp including the complete ITS2 and the flanking 5.8S and 28S rDNA sequences, were cloned in pBluescript. Several clones from each region were sequenced and the data were aligned by CLUSTAL W (1.6) program. The final alignment was manually shifted. The clone program determined the occurrence of a polymorphic Nru I site (position 135-136) among the sequenced clones. Restriction polymorphism analysis with NruI was then conducted for insects from all the above mentioned populations. The results showed that the NruI site polymorphism occurs only in mosquitoes from Peruibe region.

Financed by FAPESP.

PRELIMINARY IDENTIFICATION RESULTS OF THE SPECIES IN THE ALBITARSIS COMPLEX BY THE RANDOM AMPLIFIELD POLYMORPHIC DNA POLYMERASE CHAIN REACTION (RAPD-PCR) TECHNIQUE FROM MACAPÁ, BRAZIL.

Segura, M.N.O 2, Wilkwerson, R.1, Santa Rosa, E.P.2, Lopes, E.J.2, Lacerda, R.L. 2, Lessa, R.T.2, Galiza, D.2 & Póvoa, M.M.2.

1- Water Reed Army Institute/USA; 2- Instituto Evandro Chagas/FNS/Belém/Pará/Brasil.

Due to the high intraspecific variation of the mosquito Anopheles (Nyssorhynchus) albitarsis Lynch-Arribálzaga species complex, molecular biology techniques as random amplifield polymorphic DNA-polymerase chain reaction (RAPD-PCR), have been applied to distinguish four species within of this complex: A. albitarsis senso stricto (s.s), A. albitarsis specie B, A. marajoara and A. deaneorum (Wilkerson et al., 1995). The objective of this study is to verify if there are any specie of albitarsis complex into of the malaria transmission area in Macapá city, Brazil and also to know the importance of each specimens population as vector.

Adult mosquitos were captured with human bite in three (3) localities of Macapá city (Lagoa dos Índios, Granja Alves and Zerão). Ten samples of each localities were tested using RAPD-PCR with 4 random decamer oligonucleotide primers which the analyzed results showed that all were identified as A. marajoara. It is being done a valuation to relate this species with transmission of the disease.

Supported by Instituto Evandro Chagas/FNS/MS; University of Vermont/Water Reed Army Institute/USA.

PREVENTION AND CONTROL OF THE MALARIA DISEASE IN THE AREA OF SERRA DA MESA HYDRELECTRIC PLANT IN GOIÁS

Santos, A.H., Abraão, N., Camargo, M.F., Oliveira, A.W.S., Alves, R.B.N. & Isac, E.

Instituto de Patologia Tropical e Saúde Pública, UFG e Fundação Nacional de Saúde Goiânia-GO

Goiás is considered a state of low risk in the transmission of Malaria. More than 80% of the positive samples are imported cases from Mato Grosso and Pará. The Serra da Mesa plant is being built by FURNAS-Centrais Elétricas S.A., in the river Tocantins, about 50 km from Minaçú (GO) and it will a lade of 1.780 km2, reaching several, municipal districts of the area. The area of influence of the Hydrelectric is of great susceptibility and vulnerability for occurrence of malaria, with registration of high indexes of the disease in the 80's. Now a days sit happens some sporadic cases, provoked by people who come from other malarian areas of the country. With the objective of evaluating the entomologics aspects of the species of Anopheles with relevance in the campaign of control of the malaria in the city of Minaçú and the dam area of the plant. Monthly collections from July to December of 1996, in the intra, peri and extrahome of the capture, it was used human and animal baits and shannon. The capture stations were installed in places selected through a previous larva survey. Among Anopheles species captured the one that presented larger incidence during the research period was A. albitarsis with index of 62,83% being significantly large than A. darling with incidence of 5,18%. The best bait was the animal one ,followed by the human bait, it was demonstrated that the absence of animals as animal alimentary source, the female can prick the man. The two species of Anopheles are considered vectorial in potential, A. albitarsis is considered as a wide geographical distribution and one of the main vectors of the malaria in the centre of Brazil, being just overcame by A. darling. It was noticed that the anofelinos number captured in the urban perimeter was significant, which makes us to consider the hypothesis of the transmission of the malaria in those areas. Those parameters are an indication of the high risk of transmission of the malaria in the studied area.

PHYLOGENETIC RELATIONSHIPS AMONG SPECIES OF THE GENUS TRIATOMA INFERRED FROM MITOCHONDRIAL DNA SEQUENCE DATA

García, B. A.1,2 & Powell, J. R.2.

1Cátedra de Química Biológica, Facultad de Ciencias Médicas, Universidad Nacional de Córdoba, C.C. 35, Suc. 16, 5016 Córdoba, Argentina. 2Department of Biology, Yale University, New Haven, Connecticut 06520-8104, USA.

With the purpose of understanding the relationships and evolutionary history of different species of the genus Triatoma, we studied seven available species of the infestans complex (T. infestans, T. guasayana, T. sordida, T. platensis, T. brasiliensis, T. rubrovaria, and T. vitticeps ) and one member of the same genus but different complex based on morphological characters, T. circummaculata. As outgroup, we chose one member of another genus, Panstrongylus megistus. For two individuals each of eight of the species studied and two different strains of T. sordida, we have sequenced mtDNA fragments of 12S and 16S ribosomal RNA genes (343 and 514 bp, respectively), and cytochrome oxidase I (COI) protein coding gene (1447 bp) to infer the phylogenetic relationship of these species that have been found naturally infected with Trypanosoma cruzi. Interspecific distances (maximum likelihood, Felsenstein 1981) varied from 0.00 to 14.80%, 0.20 to 12.50%, and 0.30 to 20.60% for 12S, 16S, and COI respectively. The smallest interspecific divergences are between T. infestans and T. platensis. The remarkable mtDNA similarity between these two species is probably due to current or past introgression of mtDNA. Phylogenetic analysis was performed by neighbor-joining (Saitou & Nei 1987) and maximum parsimony (Swofford 1993). The 12S, 16S, and COI gene sequences were studied separately and combined as follows : 12S+16S, and 12S+16S+COI. Evolutionary trees were constructed using P. megistus as outgroup. As expected, all the phylogenetic trees inferred by the analyses of the molecular sequence data paired T. infestans with T. platensis with good bootstrap value. Other well supported nodes in the trees obtained from the combined data set are : (i) the node clustering T. guasayana, T. circummaculata, and T. rubrovaria, and (ii) the node connecting the infestans-platensis clade and the other species of Triatoma analyzed (except T. vitticeps). The outgroup gave evidence that the root of the group would be between T. vitticeps and the rest of the species. The mtDNA sequence data suggest that T. vitticeps is the most ancestrally separated species of the Triatoma taxa examined. On the other hand, the placement of T. circummaculata into the middle of the infestans complex is not consistent with the morphological classification, suggesting that present systematics of this group does not reflect phylogenetic affinities.

CHARACTERIZATION OF DIFFERENT POPULATIONS OF PANSTRONGYLUS MEGISTUS, BURMEISTER, 1835. I. ISOENZYME.

Barbosa, SE1,2, Soares, RPP1,2, Romanha, AJ2 & Diotaiuti, L2.

1Departamento de Parasitologia, Universidade Federal de Minas Gerais, Caixa Postal 2486; 31270-901, Belo Horizonte, MG, Brazil.2Centro de Pesquisas René Rachou-FIOCRUZ, Caixa Postal 1743, 30.190-002, Belo Horizonte, MG, Brazil.

Panstrongylus megistus is a species with great importance in the epidemiology of Chagas' disease, that frequently colonizes houses and peridomestic ecotopes in Brazil, having high Trypanosoma cruzi susceptibility. Nevertheless, the species exhibits behavioral variations concerning to its capacity of colonization and domiciliation, reflecting in different epidemiological importance depending on the region it occurs (di Primo, 1955). With the aim of studying a probable genetic polymorphism that could justify these behavioral differences, three populations of P. megistus were selected: one from Minas Gerais (first generation), where the species is found in both habitats (wild and domestic); one from Bahia (first generation), where it is usually domestic, and one from Santa Catarina (third generation), which has low potential of colonizing the artificial environment. Dórea et al. (1982) did not distinguish individuals of this species from Pernambuco, Rio de Janeiro and Bahia with isoenzymes. In the present work we introduced other enzymes and the populations studied seem to better represent the different P. megistus behavior patterns. Enzyme electrophoresis in starch gel was then carried out on flight muscle extracts, assaying 13 enzymes with 20 loci: MPI, ME, MDH, LDH, GPI, G6PD, 6PGD, IDH, a-GPDH, PEP-2, PGM, ALAT and ASAT. Ten out 13 enzymes were monomorphic for all populations. Two enzymes (ALAT and ASAT) showed no bands under our experimental conditions. PGM has shown polymorphism, with two patterns. The pattern A was observed in all populations, in 100%, 58% and 92% of the individuals from Santa Catarina, Minas Gerais and Bahia, respectively. The pattern B was present only in the individuals from Minas Gerais and Bahia (42% and 8%, respectively). PGM was the only enzyme that revealed the existence of polymorphism. PGM has demonstrated polymorphism in Triatoma infestans populations and thus may represent an important genetic marker for Triatominae. Although it was observed PGM variability among the populations, we could not establish any epidemiological correlation. Other molecular and biological parameters are being studied in order to better characterize these populations.

Supported by: Capes, CPqRR/FIOCRUZ and ECLAT research network (European Comission contract number ERBIC 18CT960042).

CLADISTIC ANALYSIS OF ALLOZYME DATA AND THE PHYLOGENY OF RHODNIUS SPP. (REDUVIIDAE: TRIATOMINAE: RHODNIINI)

Monteiro, F.A.1,2 & Solé-Cava, A.M.2

1-Laboratório Nacional e Internacional de Referência em Taxonomia de Triatomíneos; Departamento de Entomologia; FIOCRUZ e 2-Laboratório de Biodiversidade Molecular; Departamento de Genética, UFRJ.

The genus Rhodnius is composed of 12 Neotropical species, many of which have been found naturally infected by Trypanosoma cruzi. Despite the epidemiological importance of this genus, no hypothesis has been produced, to date, for the phylogenetic relationships between its species. In this work we used allozyme data for the study of nine species of Rhodnius. Protein homogenates of 5 to 8 specimens of each species from laboratory colonies were analysed by 1% agarose gel electrophoresis (Tris-EDTA-Maleate buffer, pH 7.4). Ten allozyme loci were scored for all samples studied. Cladistic analysis was performed, with the locus as the character and the alleles as character states, using Psamolestes tertius (representing the other genus of the Rhodniini tribe) as an outgroup. This analysis produced a single most parsimonious tree: (((robustus,prolixus)(nasutus,neglectus)) ((ecuadoriensis,brethesi)(domesticus,pallescens))) pictipes), and the following conclusions: 1) the samples of robustus and prolixus were genetically indistinguishable. This may reflect their high morphological similarity, or the possible (apparently common) contamination of robustus colonies by R. prolixus; 2) R. neglectus and R. nasutus formed a monophyletic clade, which agrees well with their overall high morphological similarity, but neglectus presented two diagnostic autoapomorphies that clearly distinguish the two species; 3) R. robustus, R. prolixus, R. nasutus and R. neglectus form a monophyletic clade supported by four synapomorphies, in agreement with morphological data; 4) R. pictipes is the most basal species in the genus. The genitalia of this species is more similar to that of Triatoma spp., which sets it apart from the other species of Rhodnius. It would be interesting (but very difficult, given its rarity) to compare this species with R. paraensis, considered by Lent & Wygodzinky (1979) the most plesiomorphic species of Rhodnius; 5) two synapomorphies support the monophyletic group: ecuadoriensis, brethesi, domesticus and pallescens. The positioning of R. domesticus within this clade is at odds with its known geographical distribution (domesticus occurs along the south-eastern coast of South America; the other three species of the clade are from the northern part of Latin America).

Financial support: CNPq

HIGH GENETIC DIVERGENCE BETWEEN TWO CLOSELY RELATED TRIATOMINE SPECIES (HEMIPTERA, REDUVIIDAE)

Monteiro, FA *Costa, J & *Marchon-Silva, V

Laboratório Nacional e Internacional de Referência em Taxonomia de Triatomíneos, *Coleção Entomológica, Departamento de Entomologia. Instituto Oswaldo Cruz. Av. Brasil, 4365, Cep 21045/900, Rio de Janeiro, Brasil.

Triatoma brasiliensis is chromatically variable regarding its cuticle colour, which led the description of three subspecies by distinct authors (Galvão, 1956), that were later synonimyzed (Lent & Wygodzinsky, 1979). Lucena (1970), aware of this high intraspecific variability, proposed a T. brasiliensis complex and also questioned the specific status of T. petrochiae, which is superficially similar to T. brasiliensis, suggesting that it should be regarded as another morph of this complex. However, Espinola (1971), was able to collect wild specimens of these two "varieties" (T.brasiliensis and T. petrochiae) occurring sympatrically in Paulo Afonso, Bahia State, Brazil. He carried out cross-mating experiments and could not obtain viable hybrids. These results confirmed the specific status of this species. Since the validity of cross-mating experiments in defining the specific status of triatomines has been questioned, other more objective methods should be used (Lane, 1997). Further studies, showed that T. brasiliensis is composed of several allopatric populations that are very distinct in terms of allozymes and morphology (Costa et al., 1997a and b). In this study we analyzed, by means of allozyme electrophoresis, nine adult individuals of two sympatric field populations of these putative species collected at Caicó, Rio Grande do Norte State. Sixteen loci were scorable and 11 out of these were diagnostic (Acon-1 and 2, Fum, G6pdh, Hk, Idh, Mdh, Mpi, Pgd, Pgi, and Pgm). The other five loci were monomorphic (alfa Gpd-1 and 2, Got, Me and Xod). The estimated genetic identity (Nei, 1987) was very low (0.35). We can thus conclude that under the Biological Species Concept T. petrochiae and T. brasiliensis can be considered as good species and that they are not so closely related as it was previously suggested.

Supported by CNPq and FNS.

THE USE OF METEOROLOGICAL SATELLITES TO STUDY THE DISTRIBUTION OF TRIATOMINAE AT A CONTINENTAL SCALE

David E. Gorla. Laboratorio de Ecología de Insectos. Fac. Cs Agropecuarias.

Universidad Nacional de Córdoba. Argentina. Email: dgorla@famaf.fis.uncor.edu

The geographic distribution of human disease vectors is a key aspect in epidemiological evaluations within vector control programmes. The influence of environmental factors over the distribution and abundance of insect species is well documented in general and in particular for certain Triatominae species. In this presentation, the spatio-temporal change of vegetation pattern at a continental scale is studied as an indicator of Triatominae species potential distribution in South America. Except for a few species showing a strong association with particular plant species, current knowledge would indicate that vegetation should not show a relation with this group of haematophagous insects, especially in the cases of highly anthropophyllic species (ie. Triatoma infestans). The specific objective of this work was to study the association between the spatio-temporal pattern of vegetation change and the distribution of two well known Triatominae species: T. infestans and T. brasiliensis. The vegetation data used in this study comes from a temporal series of the global vegetation index (GVI). The GVI is an index obtained from images taken by the NOAA meteorological satellites and measures the photosynthetic activity over an approximately 16x16 kms area (the so called image pixel) of the ground (its maximum occurs where the ground is completely covered by green vegetation, and its minimum where the ground has no vegetation cover). In this study, 48 monthly GVI images (September 1990-August 1994) were used. Each image is composed of approximately 120000 pixels, representing the vegetation status over the continent for each month. Within each image, GVI differences between pixels represents spatial changes of the vegetation, whereas GVI differences of the same pixel on different images represent the temporal change of the vegetation for that particular location. This 120000 x 48 vegetation dataset was studied through principal component analysis, that besides allowing a complete characterisation of the variability within the dataset, extracts in the first three components the spatial, summer-winter and autumn-spring vegetation changes, respectively. From the fourth component, it extracts other temporal changes and local anomalies. In this work, the first 7 components were used to estimate the species distribution through supervised classification of the 48 GVI images and based on a sample of small areas (40x40 kms) considered as typical localities for the species. The distribution maps so derived match remarkably well with the known potential distribution of T. infestans and T. brasiliensis. This approach opens new possibilities in the quantitative analysis of the vectors distribution, and seems particularly appropriate for the analysis of the vectors distribution changes produced by environmental changes induced by human activities.

MORPHOMETRIC STUDIES OF THE ANTENNAL SEGMENTS OF NYMPHS AND ADULTS OF TWO COLONIES OF TRIATOMA RUBROVARIA (BLANCHARD, 1843) (HEMIPTERA, REDUVIIDAE).

Tres, D.F.A.; Cruz, C.A. dos*; Rosa, J.A. da

Faculdade de Ciências Farmacêuticas, Universidade Estadual Paulista - Caixa Postal 502, Araraquara, 14 801 - 902, SP, Brasil. * Faculdade de Odontologia Universidade Estadual Paulista - Caixa Postal 331, Araraquara, 14 801 - 903, SP, Brasil.

Samples of two colonies of T. rubrovaria mantained in laboratory were utilized for the mensuration of the four antennal segments, right and left, of first to fourth instar nymphs and, male and female fifth instar nymphs and adults, through profile projector. The mensurations obtained from 15 samples of each one colonies and the mentioned instars were evaluated statistically by the INSTAT program. Significant difference was not observed between right and left segments, between male and female, in the case of fifth intar nymphs and adults, and too, between both colonies. However, about the difference of dimension between the four antennal segment, we observed that the first and second instar nymphs of both colonies, showed the following difference of dimension between the segments: 4th > 3rd > 2nd > 1st. For the third instar nymphs, of both colonies, the difference of dimension between the segments was different from that obtained to the first and second instar nymphs: 3rd > 4th > 2nd > 1st . At once, the fourth instar nymphs and, male and female fifth instar nymphs and adults, of both colonies, showed the following difference of dimension between the segments: 2nd > 3rd > 4th > 1st. Based on the obtained results, we concluded that the mensurations of the four antennal segments of the five nymphal instars and adults didn't allow the establishment of morphometric characters to the distinction of the samples of both colonies. However, the means of the effeatuated mensurations showed three constants in relation to the difference of dimension between the four antennal segments, which once are showed extremely significant according to the statistic analysis.

Supported by CNPq.

THE FUNCTIONAL MORPHOLOGY OF TRIATOMINAE LEGS: II. THE PRETARSUS

Campanucci, V.; Insausti, T.C. and Lazzari, C.R.

Laboratorio de Fisiología de Insectos, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, (1428) Buenos Aires, Argentina. e-mail: veronica@bg.fcen.uba.ar

In the pretarsus of the insect leg, between the claws and the first tarsomere, occurs a structure, the unguitractor, which remains partly retracted into the end of the tarsus. All parts of the pretarsus are subject to much variation and, in Triatominae bugs as Triatoma infestans and Rhodnius prolixus, this structure is oval in form and its surface is structured in symmetrical crests aligned transversally to the major axis of the leg. This oval structure is surrounded by a smooth rough membrane. We studied the morphology of this structure by means of light microscopy and scanning electron microscopy (SEM). Our studies have been focused on T. infestans ( larval stages 4th and 5th, and adults) and, in order to compare with another triatomine species , we have analysed this structure in R. prolixus by means of light microscopy. The analysis revealed that the cuticular characteristics of this portion are similar in both species. In addition, the histological study evinced that the unguitractor is associated to large glandular cells, located bellow a smooth rough membrane. Glands have conducts opening to the outside, supporting an exocrine function. Taking together the morphological and the behavioural evidence available up to date on T. infestans, the modifications in the unguitractor structure and its association with glands suggests that it could play a role related to the release of the chemical footprints recently discovered in this species. This chemical signal plays a role in intraspecific communication, inducing assembling in this species.

Supported by CONICET, Univ. Buenos Aires/Argentina and UNDP/World Bank/WHO (TDR).

THE FUNCTIONAL MORPHOLOGY OF TRIATOMINAE LEGS: I. THE DISTAL TIBIA

Campanucci, V.; Insausti, T.C. and Lazzari, C.R.

Laboratorio de Fisiología de Insectos, Facultad Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, (1428) Buenos Aires, Argentina. E-mail: veronica@bg.fcen.uba.ar

The first two pairs of legs in Triatoma infestans bear a "fleshy pad" at the distal end of the tibia, being those of the forelegs bigger than that of the middlelegs ones (490 x 335 µm vs. 403 x 249 µm). We studied the morphology of this organ by means of light microscopy and environmental scanning electron microscopy (ESEM) The whole surface of the pad was covered by densely packed hairs, that can be ascribed to two categories. Most of the hairs are 20 µm length and distribute all over the pillow. The tip of the hair apparently has the surface cut obliquely and are associated to epidermal cells, probably having a glandular function. The other kind of hairs are present in a reduced number as compared with the former, and are easily recognised by their socket, which gives place to a wide ring around the hair. These hairs are associated to an inner long filament links to a group of cells of probable nervous origin. A thick nerve runs through the pad cavity, just bellow the hypodermal cells, and leaves the tibial pad joining the nerve of the leg. The classical study by Wigglesworth and Gillett (1932) in Rhodnius prolixus ascribes to this organ an adhesive function, provided that this species exhibit a remarkable ability to climb vertical flat surfaces, an ability that is not shared by T. infestans. Our studies reveal, in addition, a strong sexual dimorphism for T. infestans, females lacking from tibial pads. In R. prolixus only a light difference in size could be established between sexes. Larvae, in their turn, lack from pads in their legs. From the analysis of the mating behaviour of the bugs, and the role of the male legs in grasping the female during the copula, we suggest that these organs could serve to: (1) hold the female body in position to allows a successful copula male to copulate, (2) release some kind of secretion related to sexual interactions and/or (3) to provide sensory information associated to sexual behaviour. All these testable hypothesis do not exclude a general adhesive function that could serve the locomotion of bugs..

Supported by CONICET, Univ. Bu enos Aires/Argentina and UNDP/World Bank/WHO (TDR).

MORPHOLOGICAL DIFFERENCES BETWEEN 5TH INSTAR NYMPHS OF TRIATOMA MACULATA (ERICHSON, 1848) AND TRIATOMA PSEUDOMACULATA CORRÊA & ESPÍNOLA, 1964 (HEMIPTERA, REDUVIDAE)

Rosa, J.A. da, Barata, J.M.S.*, Jurberg, J.** & Cilense, M.***

Faculdade de Ciências Farmacêuticas, Universidade Estadual Paulista, Caixa Postal 502, Araraquara, 14801-902, São Paulo, Brasil. * Faculdade de Saúde Pública, Universidade de São Paulo, São Paulo,01246-900, SP, Brasil. ** Laboratório Nacional e Internacional de Referência em Taxonomia de Triatomíneos, Departamento de Entomologia, Instituto Oswaldo Cruz, Rio de Janeiro, 21045-900, RJ, Brasil. *** Instituto de Química, Universidade Estadual Paulista, Caixa Postal 355, Araraquara, 14801-970, SP, Brasil.

Lucena's (1973) publication considered T.pseudomaculata identical to T.maculata. Gonçalves et alii (1985) did the comparative morphological study of eggs and nymphs from these two species. Differences had been showed in this research between 5th instar nymphs of the two species by scanning electron microscope. The examined samples were obtained from Laboratório Nacional e Internacional de Referência em Taxonomia de Triatomíneos - IOC. The 5th instar male nymph of T.maculata shows a central longitudinal depression in the 9th ventral segment, a re-entrance in the anterior portion and another one in the posterior portion. The 9th ventral segment of 5th instar male nymph of T.pseudomaculata doesn't show neither the longitudinal depression or both re-entrances, showing a straight furrow in the limit with the 10th segment and a curved furrow in the limit with the 8th segment. The 9th ventral segment of 5th instar female nymph of T.maculata shows two ( 1+1 ) elevations in the central portion separeted by a fissure and in the 8th two more ( 1+1 ) elevations separated by the vertex of the quitinous plate. Both lateral portions of the 9th segment of the female nymph in the T.pseudomaculata show oblique furrows and two more thin ones, transverse to those wich limit the central portion of this segment. There is a depression in a "V" shape in the posterior central limit of the 9th segment. The prevalent bristles of the 8th central segment in the 5th instar nymphs of the two species are frizzled and serrated , but they are clearly different, because the friezes in T.pseudomaculata are more accentuated and the milleds are in a superior number. The 5th instar nymphs of T.maculata and of T.pseudomaculata show morphological differences wich haven't been described in the consulted literature.

DESCRIPTION OF THE EIGHT AND NINETH UROSTERNITE OF MALE AND FEMALE FIFTH INSTAR NYNPHS OF PANSTRONGYLUS GENICULATUS (LATREILLE, 1811) AND PASTRONGYLUS HERRERI WYGODZINSKY, 1948 (HEMIPTERA, REDUVIDAE).

Rosa, J.A. da; Barata, J.M.S.* & Silva, S.A. da**

Faculdade de Ciências Fannacêuticas, Universidade Estadual Paulista, Caixa Postal 502, Araraquara, 14 801-902, SP, Brasil. *Faculdade de Saúde Pública, Universidade de São Paulo, São Paulo, 01246-900, SP, Brasil. **Fundação Nacional de Saúde, Ananindeua, 67030-070, PA, Brasil.

Rosa et alii (l992) described the sexual distinction of fifth instar nymphs of six species of Triatominae, by scanning electron microscope (SEM). The distinction of fifth instar nymphs of P. megistus have already been described among these six species. The characteristics of the eigth and nineth urostemite of male and female fifffi instar nymph of two other species of the Panstrongylus genus are descrer in this experiment. The male fifffi instar nymph of P. geniculatus shows a swift depression in the posterior central portion of the nineth ventral abdominal segment. This depression is a little more stressed and it is bifurcated in the linút of the tenth segtnent in P. herreri. The nineth ventral abdominal segment of the female fifth instar nymph of P. geniculatus shows a depression on the shape of a shell, with a grooved bottom and an opening on the shape of a "V" in the linút of the tenth segment. In the eigth ventral abdominal segment, in the adjoining portion with the nineth segrnent were observed two (I + I) grooved elevations, which are separated by a depression. ln the female nymph of P. herreri, the depression on the shape of a shell of the nineth ventral abdominal segrnent is level and with smooth bottom. The two elevations of the eigth segment are smooth and separated by a depression.

DESCRIPTION OF THE EIGHTH AND NINETH UROSTERNITE OF MALE AND FEMALE NYMPHS OF FIFTH INSTAR OF TRIATOMA ARTHURNEIVAI LENT & MARTINS, 1940 AND TRIATOMA PROTRACTA (UHLER, 1894) ( HEMIPTERA, REDUVIIDAE )

Rosa, J.A. da, Barata, J.M.S.* & Cilense, M.**

Faculdade de Ciências Farmacêuticas, Universidade Estadual Paulista, Caixa Postal 502, Araraquara, 14801-902, São Paulo, Brasil. * Faculdade de Saúde Pública, Universidade de São Paulo, São Paulo, 01246-900, SP, Brasil. ** Instituto de Química, Universidade Estadual Paulista, Caixa Postal 355, Araraquara, 14801-970, SP, Brasil.

The morphological characteristics of the nineth ventral abdominal segment of male and female nymphs of two species were described in this summary by scanning electron microscope ( SEM ), on the sequence to the taxionomic studies of fifth instar nymphs of Triatoma. The male nymph of fifth instar of T.arthuneivai has a depression in a ²V² shape in the posterior central portion. The nineth ventral abdominal segment in the male nymph of T.protracta is lengthier than other fourteen observed species of Triatoma. The female nymph of fifth instar of T.arthurneivai has two ( 1+1 ) oblique furrows, a slot in a ²V² shape in a posterior central portion, and a central region slightly demarcated in the nineth ventral abdominal segment. The nineth abdominal segment in T.protacta shows six ( 3+3 ) elevations and two ( 1+1 ) ones in the posterior portion of the eighth abdominal segment. This symmetrical conjunct of eight elevations confer a peculiar aspect to the female nymph of fifth instar of T.protracta. Morphological characteristics of the nineth ventral abdominal of fifth instar nymphs of 13 species of Triatoma have already been described and all of them had this structure different.

CHARACTERIZATION OF DIFFERENT POPULATIONS OF PANSTRONGYLUS MEGISTUS, BURMEISTER, 1835. III. MALE GENITALIA MORPHOLOGY.

Barbosa, SE1,2, Margonari, CS2, Pires, HHR2 & Diotaiuti, L2.

1Departamento de Parasitologia, Universidade Federal de Minas Gerais, Caixa Postal 2486; 31270-901, Belo Horizonte, MG, Brazil.2Centro de Pesquisas René Rachou-FIOCRUZ, Caixa Postal 1743, 30.190-002, Belo Horizonte, MG, Brazil.

Morphological variability of the genitalia structures have been showing to be the great importance in the Triatominae taxonomy, not only for species differentiation but also for population characterization. Panstrongylus megistus genitalia was described for the first time by Lent & Jurberg (1968), but no comparative study involving populations have not been not carried out, yet. Our work had the objective of characterizing morphologically the male genitalia of different P.megistus populations (Minas Gerais, Bahia and Santa Catarina), with variable importance concerning to Chagas disease transmission. In the present work were used 30 insects of each population. General procedure followed the description of Jurberg (1977). The following structures were studied: parameres, endosoma process, median pygophore process, phalosoma, phalosoma support and vesica. Among these structures, it was observed no differences in the parameres, phalosoma, phalosoma support and vesica that could separate the populations. These differences were thus observed in the endosoma process and in the median pygophore process. The number of denticles presented in the endosoma process was different according to the population. Santa Catarina and Bahia had the same number of denticles (p=0,86), while Santa Catarina and Minas Gerais (p<0,01), and Minas Gerais and Bahia (p<0,01) did not. The minimum number of denticles present in this structure was 110, and the maximum was 340, these limits are concerned to Minas Gerais population. When comparing the median pygophore process length, no difference was observed between Santa Catarina and Minas Gerais and, Minas Gerais and Bahia (p=0,70 and p=0,25), respectively. Nevertheless, statistical difference was observed between Santa Catarina and Bahia (p<0,01). It seems not to have any correlation between the differences of these two structures studied with the three populations. Other parameters are being studied in order to better establish the biosystematic of the species.

Supported by: CAPES, CPqRR/FIOCRUZ.

CHARACTERIZATION OF DIFFERENT POPULATIONS OF PANSTRONGYLUS MEGISTUS, BURMEISTER, 1835. II. MALE GENITALIA MORPHOLOGY.

Barbosa, SE1,2, Margonari, CS2, Pires, HHR2 & Diotaiuti, L2.

1Departamento de Parasitologia, Universidade Federal de Minas Gerais, Caixa Postal 2486; 31270-901, Belo Horizonte, MG, Brazil.2Centro de Pesquisas René Rachou-FIOCRUZ, Caixa Postal 1743, 30.190-002, Belo Horizonte, MG, Brazil.

Morphological variability of the genitalia structures have been showing to have great importance in the Triatominae taxonomy, not only for species differentiation but also for population characterization. Panstrongylus megistus genitalia was described for the first time by Lent & Jurberg (1968), but no comparative study involving populations have been carried out. Our work had the objective of characterizing morphologically the male genitalia of different P.megistus populations (Minas Gerais, Bahia and Santa Catarina), with variable importance concerning to Chagas disease transmission. In the present work were used 30 insects of each population. General procedure followed the description of Jurberg (1977). The following structures were studied: parameres, endosoma process, median pygophore process, phalosoma, phalosoma support and vesica. Among these structures, it was observed no differences in the parameres, phalosoma, phalosoma support and vesica that could separate the populations. These differences were thus observed in the endosoma process and in the median pygophore process. The number of denticles presented in the endosoma process was different according to the population. Santa Catarina and Bahia had the same number of denticles (p=0,86), while Santa Catarina and Minas Gerais (p<0,01), and Minas Gerais and Bahia (p<0,01) did not. The minimum number of denticles present in this structure was 110, and the maximum was 340, these limits are concerned to Minas Gerais population. When comparing the median pygophore process length, no difference was observed between Santa Catarina and Minas Gerais and, Minas Gerais and Bahia (p=0,70 and p=0,25), respectively. Nevertheless, statistical difference was observed between Santa Catarina and Bahia (p<0,01). It seems not to have any correlation between the differences of these two structures studied with the three populations. Other parameters are being studied in order to better establish the biosystematic of the species.

Supported by: CAPES, CPqRR/FIOCRUZ.

CONEXIVE STUDY OF TRIATOMA RUBROVARIA (BLANCHARD, 1843) (HEMIPTERA, REDUVIIDAE) BY SPECTROMETRY, NUCLEAR MAGNETIC RESSONANCE AND SCANNING ELECTRON MICROSCOPE

Matsumoto, E.N., Mauro A.E.*, Monti R., Sahão, F.C.S.*, Bonalle, N. *, Lopes, M.N.*, Rosa, J.A. da.

Faculdade de Ciências Farmacêuticas, Universidade Estadual Paulista, Caixa Postal 502, Araraquara, 14801-902 SP, Brasil; * Instituto de Química, Universidade Estadual Paulista, Caixa Postal 355, Araraquara, 14801-970 SP, Brasil.

Matsumoto et alii (1996) observed by spectrometric method, in the infrared region, that the conexive have the following funtional groups:

Group Region of band Primary amine (-NH2) 3295 and 3433 cm-1 Alifatic ligations (C-H) 2933 cm-1 Double ligations 1544 cm-1 Conjugate carbonile (C= C - C = O) 1657 cm-1 Ligation -C-N 1070 cm-1

The analysis using UV visible showed absorption about 230nm wavelengh, then there weren't proteic compounds. The spectrometric analysis by method DNS (acid 3,5 dinitrosalisilic) showed absence of reducers sugars. In this abstract the last results were compared with the ones gotten by nuclear magnetic ressonance (NMR). To carry out the analysis by NMR, it was necessary to solv red portions of conexive in D2O and after in NaOD. The results suggest presence of olefinics protons and fat acids, confirming the presence of alifatic ligations (C-H), aromatic protons, and probably sugars non-reducers, once that the results of method DNS were negative. The analysis by NMR suggest that the proportion of the detected substances is the following: fat acids > sugars > aromatic compounds. The observations did by scanning showed that the development of the conexive starts on the second instar nymphs, so it is not formed on the first instar nymphs.

Supported by CNPq.

ANATOMIC STRUCTURES OF 98 TRIATOMINAE SPECIES STUDIED WITH SCANNING ELECTRON MICROSCOPY (SEM)

Carcavallo, R.*, Galíndez Girón, I,1 Jurberg, J.* & Catalá, S.2

*Instituto Oswaldo Cruz, Departamento de Entomologia, Laboratório Nacional e Internacional de Referência em Taxonomia de Triatomíneos, Caixa Postal 926, Rio de Janeiro 21045-900, RJ, Brasil. 1 Univ. de Los Andes, Núcleo "R.Rangel", Trujillo, Venezuela. 2 Laboratorio de Insectos Hematófagos, Fac.C.E.F.Nat., Vélez Sarsfield 299, (5.000) Córdoba, Argentina.

Authors have studied most of the known species of Triatominae with Scanning Electron Microscopy (SEM) . They were able to photograph structures in these bugs belonging to the 5 known tribes, 13 of the 15 genera existing on the American Continent and Caribbean Islands, and 98 of the 111 recognized species of the subfamily on the same geographical region. Every species of genera Alberprosenia, Cavernicola, Psammolestes, Rhodnius, Dipetalogaster, Eratyrus, Mepraia, Paratriatoma, Hermanlentia and Panstrongylus were studied. Two species of Belminus, one of Microtriatoma and most of the Triatoma species were also photographed with SEM. It was possible to photograph some rare specimens, including type material, but in these cases the specimens were not metallized. Still, the results were highly satisfactory. In addition, the critical material was protected from breakage by using very low acceleration (5-10 Kv.). More than 1500 photos were taken. Investigation of 89% of the known Triatominae species of the Americas has allowed for observation of several characteristics, some of which previously studied by Barth (1953), Lent & Jurberg (1968), Justo & Tramezzani (1977), Ortiz & Boszko (1979), Lent & Wygodzinsky (1979), Carcavallo et al. (1994a, b, c; 1995), Galíndez & Carcavallo (1994), Catalá & Schofield (1994), Carcavallo & Galíndez (1995) and Catalá (1996) : clypeus, gena, and labrum, rostrum, antennal tubercle, antenna, synthlipsis, ocellocular region, antero-lateral angle of collar, stridulatory sulcus, scutellum and other interesting structures from the point of view of both anatomy and taxonomy: the meso- and metasterna, abdomen, connexivum, corium, interlobar pronotal sulcus, humeral angle, and other foramina. Shape, cuticular surface, pilosity and relationships are parameters that have demonstrated value to separate genera and species, being currently studied as tools for phylogenetic arrangements.

*Supported by CNPq

ATTEMPT TO USE THE GENITAL ATRIUM AS A CHARACTER FOR DISTINGUISHING PAROUS AND NULLIPAROUS NEOTROPICAL PHLEBOTOMINE SANDFLIES.

Brazil, R.P.; Pedras,M.J. ; Brazil,B.G.; Andrade Filho, J.D.

Laboratório de Leishmanioses, Centro de Pesquisas René Rachou-FIOCRUZ, Caixa Postal 1743, Belo Horizonte, 30190-002, Minas Gerais, Brasil.

Recently, Tang & Añez (Ann. Trop. Med. Parasit., 90, 203-206, 1996) studying the appearence of the membrane delimiting the genital atrium (GA) in parous and nulliparous Lutzomyia migonei proposed the use of the changes found in parous insects as a new criteria for the determination of the parity of neotropical sandflies. In this study females of laboratory bred Lutzomyia longipalpis (Lapinha Cave,Lagoa Santa, MG) and first generation (F1) of wild-caught L. longipalpis, L. renei, L. whitmani and L. intermedia (Lapinha Cave and Lassance, MG) were dissected at different physiological stages ( non-fed, gravid and after egg-laying) for observation of the cited membrane. Females were confined after feeding in individual cups for oviposition. Forty-five parous, eight gravid and fifty non fed nulliparous flies were dissected in a drop of Berlese's fluid on a glass slide. The GA was mounted and then observed and photographed under a Zeiss-Axiolab microscope. Among all dissected flies none showed any recognizable changes in the GA thus we could not confirm the aplicability of this method to discriminate between nulliparous and parous females of neotropical sandflies

Supported by : FIOCRUZ, CNPq , CAPES.

MORPHOMETRIC AND PHENETIC STUDY OF DIFFERENT POPULATIONS OF LUTZOMYIA WHITMANI (DIPTERA, PSYCHODIDAE, PHLEBOTOMINAE)

Barata, R.A.; Fortes-Dias, C.L.*, Miranda, J.C.**, Brandao-Filho, S.P.*** & Dias, E.S.

Centro de Pesquisas Renê Rachou-FIOCRUZ, Caixa Postal 1743, 30190-002 Belo Horizonte, MG, Brasil /* Fundação

Ezequiel Dias- 30510-010, Belo Horizonte, MG, Brasil /** Centro de Pesquisas Gonçalo Muniz- 40295-001, Salvador, BA,

Brasil / ***Cenúo de Pesquisas Aggeu Magalhães- Caixa Postal 7472, 50670-420 Recife, PE, Brasil

ln Brazil, Lutzomyia whitmani is a phlebotomine species that is prevalent in determinei areas where the transmission of leishmaniases is evident. Prevalence of L. whitmani associated to finds of especimens from the subgenus Viannia naturaly infected by Leishmania, incriminates this species as a vector of leishmaniases. However, different behaviour and phisiology of geographically distinct populations suggests the existence of a complex of species. So we decided to study reference populations of of L. whitmani from five different regions of Brazil (Ilhéus-BA, Martinho Campos-MG, Corte de Pedra-BA, Baturité-CE e Amaraji-PE) where the transmission of leishmaniasis is active. A number of quantitative morphological characters have been selected for this study. The measurements of these characters have beem compared using statistical and phenetical analysis. Sixty four % and 54% of the characters under study showed differences which were statistically significant when compared by analysis of variance (ANOVA) and all pairwise multiple comparison test (Bonferroni's t-test), for males and females respectively. Some of those characters were able to distinguish a population or groups of populations from the others, especially in the case of males. The population from Ilhéus-BA showed a higher degree of differentiation from the others, followed by the Corte de Pedra-BA and Martinho Campos-MG populations. The phenetical study indicate the existence of two distinct groups: one composed by the populations of Ilhéus-BA and Baturité-CE and the other grouping the populations from Amaraji-PE, Martinho Campos-MG and Corte de Pedra-BA. We intend to continue these studies using a cladistic analysis to obtain a definite characterization of those populations.

DISTINCTION OF MALES OF LUTZOMYIA INTERMEDIA (LUTZ & NEIVA, 1912) COMPLEX BY ARTIFICIAL NEURAL NETWORK (DIPTERA, PSYCHODIDAE, PHLEBOTOMINAE)

Carlos Brisola Marcondes; Paulo Sérgio S. Borges1 & Ana Leuch Lozovei2

Depto Microb. Paras., CCB, UFSC-Campus Trindade, 88040-900 Florianópolis, SC; 1- Depto Inform. Estat., CTC, UFSC; 2- Depto Patol. Básica, SCB, UFPR-Centro Politécnico, Curitiba, PR

While it is easy to classify female insects from between L. intermedia s. s. and L. neivai (Pinto, 1926) (Marcondes, 1996- Mem. Inst. Oswaldo Cruz), male individuals can only be distinguished by means of statistical differences, with a great range of variation that overlap for both species. It has been observed that L. intermedia s. s. has significantly smaller extra-genital structures, whereas L. neivai has smaller genital organs. The statistical analysis of several ratios, by combining the lengths of palpomere 3, palp. 5, mesonotum, wing, a, a/b, d, R5 and e with those of coxite, style, paramere, lateral lobe, genital pump and genital filaments, indicated very high values for the F statistic. However, the ranges obtained were still too great to get a secure differentiation.

Employing a sample of 356 male insects from Brazil, Paraguay, Argentina and Bolivia, 39 variables were measured in each individual, and the insects were classified according to the respective association with well characterized females. Then, the afore mentioned ratios were computed.

In order to provide an alternate approach to the classification problem, this paper investigates the use of an artificial neural network (ANN) as a tool to accomplish the categorization of the insects. ANN's are a technique of computational inteligence that yields good results in tackling such questions. The designed ANN was trained using most of the avaliable data, with the measured ratios treated as the inputs and the respective species taken as the outputs. After the training process was over, the ANN was presented with other examples it had not seen before, and asked to make a prediction of the category of each individual. The results demonstrate the feasibility of the method, which ensues its application in other similar problems.

EXPRESSED SEQUENCE TAGS SEQUENCING OF LUTZOMYIA LONGIPALPIS.

Ortigão M., Vilela, M.*, Rangel, E.* and Traub-Csekö, Y.M.

Depto. de Bioquímica e Biologia Molecular, * Depto. de Entomologia, IOC-Fiocruz, Av. Brasil 4365, Rio de Janeiro, RJ, Brazil.

Nowadays there is a growing interest in ways other than pesticides as a means for disease vectors' control. Many researchers throughout the world are currently trying to devise mechanisms for interfering with the vectorial capacity of vectors for malaria, chagas' disease and arboviroses. Our group is interested in studying the molecular aspects of the interaction between leishmania and sand flies. Based on these studies we hope to be able to identify genes responsible for the maintenance of the vectorial capacity of these insects. We have established a cDNA library from Lutzomyia longipalpis from RNA extracted from abdomen or head and thorax, and have sequenced several of the obtained clones. Comparison of the deduced aminoacid sequences with Genebank sequence databank has shown, among other homologies, mitochondrial DNA sequences that migth be useful in taxonomic studies. Other clones demonstrated an aminoacid sequence homology with such genes as the homeoprotein-regulated gene of Drosophila melanogaster, protein biding gene/engrailed nuclear homeoprotein-regulated gene of D. melanogaster and a serine protease gene from Anopheles gambiae. We are presently in the process of sequencing more clones.

PRELIMINARY STUDIES ON PHLEBOTOMINAE FAUNA FROM PARQUE ESTADUAL DO TURVO, RS, A ENDEMIC TEGUMENTARY LEISHMANIASIS AREA.

Onilda Santos da Silva

Jörg Grunewald

Institut für Tropenmedizin Wilhelmstrasse 27 - 72076 Tübingen, Germany

After confirmation of cutaneous and mucocutaneous leishmaniasis cases in a village quite near the Parque Estadual do Turvo, we undertook a study on Phlebotominae fauna (sandflies) in order to verify the profile of disease transmission in this area. This forest is one of the few forest reserves of the State and it harbours many Phlebotominae species and silvatic animals which serve as food resource for these insects. It is probably the area where the cycle of the disease is predominant in these region. For that reason an entomological survey was carried out weekly from November 1996 to January 1997. Catches were made in three different biotopes: domestic, peridomestic area and forest, with light traps, entomological aspirators, and animal and human baits. We collected 2,215 sandflies which belong to 11 species. In domestic areas we caught Lutzomyia migonei, L. pessoai, L. intermedia, L. lanei, L. fischeri, L. missionensis, L. alphabetica, Lutzomyia sp. and L. shannoni. In peridomestic areas L. migonei, L. pessoai, , L. intermedia, L. lanei, L misionensis, L. shannoni and L. monticola. In the forest L. misionensis, L. migonei, L. pessoai, L. lanei, L. intermedia, L. fischeri, L. schreiberi, L. shannoni, L. monticola, L. gaminarai, Lutzomyia sp., Brumptomyia nitzulescui, B. correalimae and B. pintoi. Among them L. migonei (50,65 %) and L. pessoai (17,24%) were the most abundant species in domestic and peridomestic areas. Altthough both species were higher there, they were found in low number in the forest. The Phlebotominae fauna in the forest showed predominance of L. misionensis (32,24 %). The number of males collected in forest was considerably lower than in either the other biotopes. The Lutzomyia schreiberi, Brumptomyia correalimae, B. nitzulescui and B. pintoi species were identified for the first time in RGS. Because of leishmaniasis cases in this region, the presence of L. pessoai and L. migonei (both man-biting), as predominant species is important. Epidemiological data from other authors suggest they are vectors of Leishmania (Viania) braziliensis. The polymerase chain reaction (PCR) applied directly on the sandflies, was done with primers (MP1L and MP3H) specific for the L. braziliensis complex. Until now it did not indicate female infection.The study is continuing and the results will be announced later.

GEOGRAPHICAL DISTRIBUTION OF MEMBERS OF LUTZOMYIA INTERMEDIA (LUTZ & NEIVA, 1912) COMPLEX (DIPTERA, PSYCHODIDAE, PHLEBOTOMINAE)

Carlos Brisola Marcondes; Ana Leuch Lozovei1 & José Henrique Vilela2

Depto Microb. Paras., CCB, UFSC- Campus Trindade, 88040-900 Florianópolis, SC; 1-Depto Patologia Básica, SCB, UFPR-Centro Politécnico, Curitiba, PR; 2- Lab. Geoprocessamento, DG, CFH, UFSC

After the redefinition of L. intermedia s. s. and L. neivai (Pinto, 1926) by Marcondes (1996- Mem. Inst. Oswaldo Cruz), the distribution of both species and of L. intermedia s. l. was studied. The distribution was based in insects morphometrically studied, in bibliography and in personal communications from several workers.

L. intermedia s. s. was found just in Brazil, in the States of Piauí, Pernambuco, Bahia, Espírito Santo, Rio de Janeiro, Minas Gerais and São Paulo. L. neivai was found, in Brazil, in the States of Goiás, Minas Gerais, São Paulo, Paraná, Santa Catarina and Rio Grande do Sul, and in Paraguay, Argentina and Bolívia. Besides the above refered regions, specimens collected or refered in Sergipe, Ceará, Tocantins and Pará States could only be considered as L. intermedia s. l. Both species occur in Pariqüera Açu, in the Ribeira River Valley, in the South of São Paulo State. We prepared maps and a list of municipalities.

The regions where L. intermedia s. s. occurs vary, by Thorntwaite classification, from Fifth Megathermic (Teresina, PI) to Fourth Mesothermic (Eastern São Paulo and Paraíba River Valley), and L. neivai was found in regions from First Megathermic (Northwestern São Paulo) to Second Mesothermic (near Serra do Mar).

The study of the distribution of both species, related to altitude and climate, revealed that L. intermedia s. s. occurs in warmer and wetter regions than L. neivai. The first was found in higher altitudes [Lagoa Santa (MG)-760 m a. s. l.;Venda Nova do Imigrante (ES)- 750 m a. s. l.] if situated in smaller latitudes. At São Paulo State, the first species was found only in the east of Serra do Mar.

The distribution of both species must be better studied, specially emphasizing Paraíba River Valley and the coastal region to the south of Ribeira River Valley, between Pariqüera Açu and Florianópolis (Santa Catarina State), to get a better understanding of their biologies and limitations.

EPIDEMIOLOGY OF AMERICAN CUTANEOUS LEISHMANIASIS (ACL) IN THE STATE OF SÃO PAULO. SANDFLY FAUNA IN ENDEMIC REGIONS

Taniguchi, HH, Tolezano, JE, Elias, CR & Larosa, R.

Seção de Parasitoses Sistêmicas - Instituto Adolfo Lutz - São Paulo-SP

For more than 18 years, we have been conducting studies with the purpose to clarify epidemiological aspects of ACL in the State of São Paulo, as well as to get subsidy for its control. In this communication we present the composition of phlebotominic fauna in three differents endemic regions. The regions of this study were in Southeast-São Roque City, in Southweast - Teodoro Sampaio City, and in South - Eldorado Paulista City. Sandflies were collected during 12 consecutive months, a week per month, by employing a modified Shannon trap, modified Falcão trap and captors of Castro. A total of 35,779 phlebotomines were collected, being 38.6% males and 61.4% females. The caught at Southeast region shows 41.5% of the total of insects, belonging them to 20 different species, 27.0% the Southwest, with 10 species of sandflies, being Lutzomyia intermedia, Lu. whitmani, Lu. fischeri, Lu. pessoai, Lu. migonei, and Lu. ayrozai with 99.3% the insects. Lu. intermedia, Lu. fischeri and Lu. migonei were present in all regions, with evident dominance for the first one (47.0%). Lu. whitmani appeared in high densities in plateau regions (Southeast and Southwest), being absent in the region of Sea Sierra System (South). Considering aspects related to the ecology of sandflies (alimentary preferences, habitats, and densities) the authors believe that Lu. intermedia, species associated with modified environment and anthropic action should be playing as vector of Leishmania (V.) braziliensis in all of three regions. Lu. whitmani could either act as vector or in plateau region only. The involvement of Lu. migonei, Lu. fischeri and Lu. pessoai as secondary vectors should be investigated. About Lu. ayrozai, new studies should be necessary since it has been incriminated with Leishmania circulation in Amazon region.

Partially supported by PCDEN/FNS

EPIDEMIOLOGY OF AMERICAN CUTANEOUS LEISHMANIASIS IN THE STATE OF SÃO PAULO. SANDFLIES COLONIZATION IN THE FORESTED ENDEMIC ENVIRONMENT

Taniguchi, HH, Elias, CR, Larosa, R., Nunes, EV & Tolezano, JE

Seção de Parasitoses Sistêmicas do Instituto Adolfo Lutz - São Paulo-SP

In an area with 500 to 600 m2, at 40-50 meters inside the forest, in Eldorado City in the Ribeira River Valley, were built 5 enclosures for sentinel animals with the purpose of exposing them to phlebotominie population that naturally colonize the forested environment. The enclosures were destined for dogs, hamsters, marsupials (D. marsupialis), wild rodents (Oryzomys sp., Akodon sp. and Oxymycterus quaestor), and hen. The sandflies were collected before and after animals introduction and in the canopy of trees, at 10 meters of soil. In parallel, we collected phlebotomines in an open environment, near 150 meters from the enclosures, where exist a vegetable garden and a pigsty with pigs. In primitive forested environment, before introduction of sentinel animals, Lutzomyia fischeri, Lu. ayrozai and Lu. migonei were dominants, with 78.2, 13.1 and 5.1% respectivelly, while Lu. intermedia was present in only 2.8% of collected insects. After introduction of sentinels, Lu. ayrozai has been revealing remarkable zoophilic preference, presenting a density around 70.0% from the sandflies collected from inside forested, in the enclosures for different animals, and the same was observed in altitude, in canopy of trees, being follewed by Lu. fischeri, Lu. migonei and Lu. monticola with 21.0, 4.7 and 2.1 respectivelly. Lu. intermedia in this forested environment appeared with 0.6% only. In the deforested open environment, even close to the forest (150 m), it was revealed an incredible change of phlebotomines with dominancy of Lu. intermedia, with 74.0%, following Lu. migonei and Lu. fischeri. It is worth to point out the absence of Lu. ayrozai in this environment considering the densities, the aspects of environment and the nutritional preferences of the phlebotomines, and the authors have considered for this endemic region of São Paulo States that in the hypothesis odf existence of enzootic cycle of Leishmania (Viannia) braziliensis in the forest, it is great the possibility of Lu. ayrozai acts as transmission agent, as verified for this species in amazon region in relation to Leishmania naiffi. In open and modified environment this role can be ouved to Lu. intermedia almost absolute by in areas where anthropic action is present.

ECOLOGY OF SANDFLIES (DIPTERA, PSYCHODIDAE), POTENTIAL VECTORS OF HUMAN DISEASES AT IGUAÇU NATIONAL PARK, PARANÁ STATE, BRAZIL

Aguiar, G.M., Medeiros, W.M., Santos, S.C. & Gambardella, S.

Instituto Oswaldo Cruz, Departamento de Entomologia, Laboratório de Diptera, Av. Brasil 4365, 21045-900, Rio de Janeiro, RJ, Brasil

From 1992 to 1996 an ecological study on sandflies was performed in three areas of Iguaçu National Park: inside the forest, at the forest side and in the villa of the Park's employee. Human baits and light traps (Shannon and Falcão) were used. The periods of capture were as follows: human baits and Shannon trap _ from 6 p.m. to mid-night; Falcão trap _ from 6 p.m. to 8 a.m. There were 10,604 sandflies captured, from 23 species (2 Brumptomyia and 21 Lutzomyia). Out of the total, human baits represented 40.8%; light traps represented 30% (Shannon) and 15.2% (Falcão); 14% were captured from the trees and walls of the houses. Eight species bit men: L.whitmani (43%), L.shannoni (25%) and L.misionensis (18%), followed by L.monticola, L.pessoai, L.migonei, L.intermedia and L.fischeri (4%). L. whitmani females prevailed at Shannon trap, while males prevailed at Falcão trap. L. pessoai and L.shannoni showed no prevalence between sexes; L.misionensis and L. monticola were represented only by females in both traps. In Falcão traps, L.whitmani and L.pessoai showed more activity at the top of the trees (10 m) while L.misionensis and L. monticola were more active near the soil (1 m). From the studied species, four are believed to be Leishmania braziliensis vectors in other parts of the country: L.whitmani, L.pessoai, L.intermedia and L.migonei, representing 77.5% of the total. The potentiality and prevalence of these species, specially L.whitmani may indicate the transmission of cutaneous leishmaniasis in its natural enzootic cycle. The prevalence of L.whitmani inside the forest and at its side, with high acrodendrophilic activity, suggests eclectic preferences concerning biting sites. L.whitmani showed high prevalence on captures performed on the trees: at twilight on the trunk basis and at night near the top of the trees. The fact that the coati is commonly found at this region, with sinantropic characteristics, allied to the observation of four specimens which presented suspect lesions on the snouts and tails, led us to study the feeding specificity of the sandflies in relation to men and other mammals, aiming to associate possible reservoirs and Leishmania vectors.

COMBINATION OF PINPOINTED PHLEBOTOMINE CAPTURE AND PCR FOR LEISHMANIA IMPROVES DETECTION OF NATURALLY INFECTED LUTZOMYIA.

Miranda, JC1, Reis, E1, Gonçalves, M1, Reis, M1, Fernandes, O2, Barral-Netto, M1,3 & Barral, A.1,3

1Centro de Pesquisas Gonçalo Moniz - FIOCRUZ-BA; 2 Instituto Oswaldo Cruz - FIOCRUZ-RJ; 3 Serviço de Imunologia-UFBA, Salvador - Bahia. R. Waldemar Falcão, 121; 40.295-001 SSA- Bahia, Brazil (barral@ufba.br)

Natural infection of Lutzomyia spp with Leishmania in endemic areas is very low (ranging from 0 to 0.1%). When the capture was performed near the house of a very recent cases of the human infection there was 1 positive phlebotomine (dissection) out of 193 examined. We decided to evaluate the polimerase chain reaction (PCR) in the detection of Leishmania in phlebotomines captured in the neighborhood of a house from a very recent case of leishmaniasis to evaluate the natural infection of Lutzomyia spp in the endemic area of Corte de Pedra. We have captured 4027 female sandflies from 200 captures, and grouped in 335 samples (10 to 20 sandflies/samples). Samples were stored in liquid nitrogen before total DNA extraction. PCRs were done with a oligonucleotide primers that amplify the conserved region of the Leishmania minicircle molecule: 5' GGG GAG GGG CGT TCT GCG AA 3' and 5' GGC CCA CTA TAT ACC AAC CCC 3' and 5' CCG CCC CTA TTT TAC ACC AAC CCC 3'. The sensitivity of the PCR technique for the detection of Leishmania was evaluated by testing cultures spiked with 10, 100 and 1000 Leishmania mixed with 10 or 20 sandflies at same tube. Amplified products were submitted to gel agarose electrophoresis, ethidium bromide-stained, and visualized under UV light, and hybridized with a L. braziliensis probe. We were able to detect leishmanial DNA in samples containing an estimated 10 parasites with 10 or 20 sandflies. Inspection of the agarose gels showed 11 positive samples. After hybridization positivity was observed in a total of 30 samples (including the 11 positive by UV inspection). Even if we assume that each positive pool contains a single infected specimen the proportion of infected sandflies was 0.74%. These results show that the use of PCR in samples captures near the houses of recently diagnosis leishmaniasis patients improves the detection of leishmania-infected phlebotomine in endemic areas and may be a helpful tool for evaluating patterns of Leishmania infection.

Supported by NIH Grant 30639, PRONEX-FINEP and CNPq.

DETECTION OF LEISHMANIA FROM PHLEBOTOMINE IN A CUTANEUS LEISHMANIASIS ENDEMIC AREA,OF MATO GROSSO, BRAZIL.

Lima, J. B. P; Pereira, T. R; Grogl, M; Quintana, M & Hohosko,S.

USA Medical Research Unit, Walter Reed Institute of Research & instituto de Biologia do Exercito, Rio de Janeiro, Brasil.

Cutaneous leishmaniasis is commonly reported in the state of Mato Grosso, Brazil. However, the sand fly vectors responsible for transmitting the infections are unknown. In this study 848 sand flies were collected in northern Mato Grosso in June 1997. Collections were made with CDC light traps, Shannon traps, human landing collections and aspirated directly from tree trunks. Eleven species were identified with L. umbratilis (648) and L. davisi (178) being the most common sand flies captured. These two species made up 97.4 percent (826/848) of the collection. Dissections produced three potential positives sand flies to include two L. umbratilis and one L. davisi. To confirm the presence of Leishmania parasites the carcasses of two of the infected flies were grown in 200 ul of PBS 3% ATB(S/P), with 100 ul of the solution used to inoculate biphasic medium. The remaining 100 ul was used to inoculated the nose of two hamsters, 50 ul each. Seven day cultures were checked for parasites, all cultures were negative. Results of the inoculated hamsters are pending.

ISOLATION AND IDENTIFICATION OF BACTERIA FROM SANDFLIES OF LUTZOMYIA LONGIPALPIS (DIPTERA: PSYCHODIDAE) MANTEINED IN LABORATORY.

Giordano-Dias, C. M.1; Figueiredo, A. R.1; Oliveira, S. M. P.2; D'Almeida, J. M.2; Hofer, E.1 & Brazil,R. P.3

1- Depto de Bacteriologia e 2- Depto de Biologia, Instituto Oswaldo Cruz, FIOCRUZ-RJ.

3- Laboratório de Leishmanioses, Instituto René Rachou, FIOCRUZ-BH.

Depto de Bacteriologia, IOC, FIOCRUZ. Av. Brasil, 4.635. Manguinhos, Rio de Janeiro, 21045-900, RJ, Brasil.

Many species of Lutzomyia are considered leishmaniasis' vectors, mainly Lutzomyia (Lutzomyia) longipalpis (Lutz & Neiva, 1912), that is Calazar's vector in American continent. Considering the few number of studies on the importance of microorganisms in the nutrition of insects, we decided to carry out this research to improve the knowledg of the L. longipalpis biology. A study was carried out to identify the bacterial flora from the gut and Malpighi tubules of males and females of Lutzomyia longipalpis from a laboratory colony. Two hundreds individuals, fed exclusively by sacarose solution, were dissected and divided in groups of 20 flies. Macerated material from each pool was sowed in blood agar and thioglycolate broth. Primary characterization of the microorganisms was obtained on basis of colonial and cellular morphology after Gram staining. Bacterial identification was based on biochemical and physiological tests mainly by its capacity of sugar or other substrates fermentation. Gram negative bastonets were isolated more frequently and most of them were nonfermentative. The following genera were identified: Alcaligenes, Burkholderia, Pseudomonas, and Stenotrophomonas. The family Enterobacteriaceae was represented by the genera: Enterobacter, Moellerella and Serratia. Gram positive bastonets were represented only by Bacillus sp in males sandflies. It was observed a big bacterial diversity in gut samples from females sandflies. However the genera Burkholderia, Pseudomonas and Stenotrophomonas were obtained more frequently from the guts of males.

  • 412
  • 413
  • 414
  • 415
  • 416
  • 417
  • 418
  • 419
  • 420
  • 421
  • 422
  • 423
  • 424
  • 425
  • 426
  • 427
  • 428
  • 429
  • 430
  • 431
  • 432
  • 433
  • 434
  • 435
  • 436
  • 437
  • 438
  • 439
  • 440
  • 441
  • 442
  • 443
  • 444
  • 445
  • 446
  • 447
  • 448
  • 449
  • 450
  • 451
  • 452
  • 453
  • 454
  • 455
  • 456
  • 457
  • 458
  • 459
  • 460
  • 461
  • 462
  • 463
  • 464
  • 465
  • 466
  • 467
  • 468
  • 469
  • 470
  • 471
  • 472
  • 473
  • 474
  • 475
  • 476
  • 477
  • 478
  • 479
  • 480
  • 481
  • 482
  • 483
  • 484
  • 485
  • 486
  • 487
  • 488
  • 489
  • 490
  • 491
  • 492
  • 493
  • 494
  • 495
  • 496
  • 497
  • 498
  • 499
  • 500
  • 501
  • 502
  • 503
  • 504
  • 505
  • 506
  • Publication Dates

    • Publication in this collection
      30 Nov 2000
    • Date of issue
      Nov 1997
    location_on
    Instituto Oswaldo Cruz, Ministério da Saúde Av. Brasil, 4365 - Pavilhão Mourisco, Manguinhos, 21040-900 Rio de Janeiro RJ Brazil, Tel.: (55 21) 2562-1222, Fax: (55 21) 2562 1220 - Rio de Janeiro - RJ - Brazil
    E-mail: memorias@fiocruz.br
    rss_feed Stay informed of issues for this journal through your RSS reader
    Go to top Report error