ABSTRACT
Objective Glucagon-like peptide-1 (GLP1) and leptin (Lep) are afferent signals that regulate energy metabolism. Lactational hypernutrition results in hyperphagia and adiposity in adult life, and these events can be prevented by exercise. We evaluated the effects of swimming training on hypothalamic (GLP1-R) and Lep receptor (Lep-R) gene expressions in lactational hypernutrition-induced obesity.
Methods On the 3rd postnatal day, the litter sizes of lactating dams were adjusted to small litters (SL; 3 pups/dams) or normal litters (NL; 9 pups/dams). After weaning (21 days), NL and SL male rats were randomly distributed to sedentary (Sed) and exercised (Exe) groups. Exercised mice swam (30 min/3 times/week) for 68 days. Food intake and body weight gain were registered. At 92 days, intraperitoneal glucose and insulin tolerance tests were performed and rats were euthanized at 93 days; adipose tissue depots were weighed, and blood counts and plasma biochemical analyses performed. Hypothalamus were isolated to evaluate Lep-R and GLP1-R gene expressions.
Results Small litters sedentary rats presented increased body weight gain, adiposity, insulin sensibility and higher fasting values of glucose and triglycerides, besides higher hypothalamic gene expressions of Lep-R and GLP1-R, compared to NLSed animals. SLExe rats did not develop obesity or metabolic abnormalities and Lep-R and GLP1-R hypothalamic gene expressions were normalized.
Conclusion Lactational hypernutrition induces obesity and metabolic dysfunction in adult life, in association with higher hypothalamic expressions of the Lep-R and GLP1-R genes. Exercise prevented obesity and improved metabolic state in SL overnourished rats, and normalized their hypothalamic Lep-R and GLP1-R gene expressions.
Hypothalamus; Exercise; Metabolic reprogramming; Swimming; Obesity
Highlights
Small-litter promotes greater body weight gain, adiposity, and metabolic abnormalities in adulthood.
Small-litter -adult obese rats showed augmented hypothalamic expression of GLP1-R and Lep-R.
Swimming training throughout life avoids obesity and metabolic disorders in small-litter-adult rats.
Regular exercise can normalize GLP1-R and Lep-R hypothalamic expressions in small-litter-adult rats.
Article extracted from author Stefani Valeria Fischer master’s thesis presented to the Postgraduate Program in Evolutionary Biology at the Universidade Estadual de Ponta Grossa, Ponta Grossa, PR, Brazil, in partnership with the Universidade Estadual Oeste do Paraná, Cascavel, PR, Brazil.
In Brief
Lactation is an important period of metabolic programming. Litter reduction, a model of lactational hypernutrition, promotes obesity and metabolic dysfunctions in adulthood. Here, we demonstrate that swim training introduced early in life prevents obesity and metabolic abnormalities in small-litter rats, in part by adjusting the hypothalamic expression of GLP1-R and Lep-R.
INTRODUCTION
Nutritional experiences during early developmental periods of pregnancy and lactation may contribute to the onset of metabolic diseases later in life, including obesity.(1) Excessive nutrients at early stages of life can modify gene expression via epigenetic mechanisms, in turn modulating the construction of adaptive responses in tissues involved in energy metabolism and weight control. In this regard, white adipose tissue (WAT), endocrine pancreas, hypothalamus and the intestines are especially plastic during childhood(2,3) and highly influenced by nutritional elements.(4)
Several studies in rodents and humans have shown that excessive energy supply during pregnancy and/or the lactation period favors high WAT accumulation throughout life.(5) Moreover, the adult-obesity induced by gestational or lactational high-calorie diets also favors insulin resistance (IR), dyslipidemia and cardiovascular disease at a younger age.(6,7)
The hypothalamus is an important neuronal area that controls energy homeostasis(8) and disruptions in neurotransmission in several hypothalamic nuclei can cause altered regulation of body weight and metabolism.(9) The hypothalamic neuronal circuits for controlling body weight and satiety begin to establish early in life(10,11) and are very vulnerable to nutritional insults that can program metabolic changes along life.(12)
The control of hypothalamic energy homeostasis is finely regulated by peripheral hormonal signals, which are primarily originated from the WAT and the intestine.(8)Accordingly, circulating levels of leptin (Lep) reflect the energy storage in WAT.(10) A high adipocyte triglyceride content results in high Lep release, which coordinates inhibition of food intake and increases energy expenditure via hypothalamic Lep receptor (Lep-R) activation.(10,13) Thus, over the long term, the activation of Lep-R regulates body weight and adiposity.(13) In addition, signs of short-term satiation are produced by intestinal cells, particularly the glucagon-like peptide-1 (GLP1) hormone produced by L-intestinal cells. GLP1 is secreted mainly by gut L-cells in response to fat and carbohydrate loading, but is also secreted by neurons in the central nervous system (CNS), especially in the brainstem. In response to peripheral and central actions, GLP1 acts on GLP1 receptors (GLP1-R), located in several hypothalamic areas, as a phasic regulator of satiety.(13) Alterations in expressions and signaling of the Lep-R and GLP1-R in specific regions of the hypothalamus have been associated with obesity abnormalities.(14)
Aerobic exercises, particularly those maintained over the long term, can reduce WAT accumulation and preserve metabolic health, avoiding the development of diabetes and cardiovascular diseases in adulthood.(15,16) Interestingly, regular exercise also modulates hypothalamic pathways, changing GLP1 and Lep responses, and potentiating the efficacy of GLP1-R agonist treatments in patients with Type 2 diabetes mellitus.(17) Moreover, diabetic rats that are exercised demonstrate increased GLP1-R.(17) Lep-R expression is also sensitive to central exercise effects. For example, 12 weeks of wheel exercise is reported to reduce the expression of Lep-R in the arcuate hypothalamic nuclei.(18)
Manipulating the litter size during lactation can modulate milk production and its components, provoking changes in the metabolism of offspring.(19,20) Adult offspring born to small litters (SLs; 3 - 4 pups per dam) present obesity, dyslipidemia, and glucose intolerance,(19,21,22) caused by lactation hypernutrition.(5,23) Rodent dams feeding SL during lactation produce a milk that is richer in total calories, particularly lipids, compared to milk from dams with normal litters (NLs; 6–9 pups per dam). Accordingly, adults raised in SLs present alterations in hypothalamic pathways.(24) SL-obese adult rats have been reported to have increased Lep-R expression in the hypothalamus(25) and male SL-obese rats have exhibited reductions in hypothalamic GLP1-R.(26) We and others have demonstrated that submitting SL rats to exercise can improve their metabolism and prevent the development of obesity.(22,27) However, whether these anti-adiposity effects that are induced by exercise involve hypothalamic reorganization is unknown. Our hypothesis it is that regular exercise could restore hypothalamic pathways, contributing to positive health effects in overnourished SL adult male rats.
OBJECTIVE
We evaluated the effects of swimming training on the expressions of hypothalamic genes GLP1-R and Lep-R in lactational hypernutrition-induced obesity.
METHODS
Ethical aspects and experimental design
Wistar rats were obtained from the Universidade Estadual de Ponta Grossa (UEPG). The Ethics Committee for Experimental Animals (CEUA number 03482/2012) approved all animal protocols. Animals were kept under controlled temperature (21±3°C), humidity (50-65%) and luminosity (12:12h light-dark cycle), with ad libitum access to food and water. Male and females were matched, and pregnant female were separated until the birth of pups for litter size manipulation during the lactation phase. After weaning (21 days), rats were subdivided in sedentary and exercise groups. Exercised rats swam throughout their life. To avoid female hormonal influences, only males were used in the present work. The glucose and insulin tolerance test were performed in vivo (post-natal day 92), and the ex vivo analyses was performed after euthanasia (post-natal day 93). Details of each protocol are mentioned below and experimental design is shown in figure 1.
Illustrative experimental design created by author in Biorender.
Induction of obesity by lactation hypernutrition
Wistar rats (age 90 ± 10 days) were mated at a ratio of three females to one male. After mating, pregnant females were placed in individual cages until the birth of offspring. Milk volume and composition of the dam can be adjusted to prole size.(28,29) Therefore, at birth, the number of pups in each litter was kept to 10 per dams, to avoid maternal milk adjustment. On the 3rd postnatal day, the lactating dams were randomly selected to have small litters (SLs; three pups/dams) or normal litters (NLs; nine pups/dams); only male rats were evaluated. Lactating dams suckling SL offspring produced milk with a high caloric content that was rich in lipids and carbohydrates, resulting in lactational overfeeding.(21,30) SL (n= 40) and NL (n=44) offspring were weaned at 21 days of age and randomly distributed into 3 - 4 rats per cage, receiving water and rodent chow (Nuvital, Curitiba, Brazil) ad libitum. Dams and offspring were housed under a controlled luminosity cycle and temperature monitoring, as mentioned above.
Swimming training
From 22 to 90 days of life, half of the NL (n=22) and half of the SL (n=20) male rats were submitted to swimming training, as described by Fischer et al.(22) Briefly, rats swam 3 times/week for 30 minutes in a pool adapted to rodents (area 1m2), with constant temperature (32±2oC) and received a load corresponding to 5% of body weight attached to the tail, to avoid accommodation. This protocol can be considered to induce moderate intensity exercise, according to Voltarelli et al.(31) After each swimming training session, the rats were dried and returned to their cages. Sedentary (Sed) groups did not perform any exercise. Importantly, all experimental protocols described below were performed at 48 hours after the last swimming session. Thus, considering litter size manipulation and swimming training, four subgroups were obtained (n=10-11 rats): NLSed - normal litter sedentary rats; NLExe - normal litter exercised rats; SLSed - small litter sedentary rats; SLExe - small litter exercised rats. All groups contained rats from at least five different litters.
Feed efficiency coefficient
From 22 to 90 days of age, the animals were weighed and food consumption per rat determined (n=11 animals/group). The quantification of the feed efficiency coefficient (FEC) is the relationship between the body weight (BW) mass gain (g) per amount of feed consumed (g). The following calculation was used FEC = (final BW - initial BW) / Total of Food, as suggested by Nery et al.(32)
Intraperitoneal glucose and insulin tolerance test
At 92 days of life, and at 48 hours after the last exercise session, the intraperitoneal (ip) glucose or insulin tolerance tests (ipGTT and ipITT, respectively) were performed; 8-10 male rats per group were randomly selected for each test. For this, the rats were allocated to individual cages and submitted to 12 hours (ipGTT) or 8 hours (ipITT) of fasting. Immediately before starting the test, a basal blood (time 0) sample was collected from the tail of each rat, and glucose levels were measured using a glucometer (Accuchek, Roche). Subsequently, the glucose load (2g/Kg of BW dose) was administered and glucose measured at 15, 30, 60, and 120 minutes after glucose administration. For the ipITT, after basal sample collection, the rats received insulin at a dose of 1U/Kg of BW and glucose was measured at 5, 10, 20 and 25 minutes after insulin administration. For both the ipGTT and ipITT, the areas under curve (AUCs) were calculated. Additionally, insulin sensitivity was analyzed by plasma glucose disappearance rate (KITT), as reported by Lundbaek.(33)
Euthanasia and blood and tissue collection
At 93 days of life, the male rats were fasted for 12 hours and euthanized by decapitation after brief desensitization with CO2. The rats were immediately weighed (g), and their naso-anal lengths (cm) were registered to obtain the Lee Index (LI).(34) Subsequently, blood was collected in heparinized tubes and plasma was obtained was used to measure glucose, cholesterol and triglycerides using enzymatic commercial kits (Gold Analisa®, Belo Horizonte, MG, Brazil), and an automatic analyzer (Selectra II, Bayer), insulin was analyzed by radioimmunoassay. For hematocrit (Hct) evaluation, 1mL of blood was collected in tubes containing 1% EDTA-potassium, and hemoglobin (Hb; %), red blood cells (RBC), white blood cells (WBC) and platelet count, as well as the volume of concentrated cells, were determined. Additionally, the mean corpuscular volume (MCV), mean corpuscular hemoglobin (HCM), mean corpuscular hemoglobin concentration (MChC), monocytes (%) and lymphocytes (%) were evaluated in the blood. All hematocrit measurements were made in an automated cell counter (SERONO BAKER System 9120 CP + UK). After blood collection, the abdominal cavity of the rats was opened, and the WAT from visceral mesenteric and retroperitoneal depots and the brown adipose tissue (BAT) interscapular depot were excised and weighed; data are expressed in 100g BW.
Quantitative real-time PCR (qRT-PCR) assay
Immediately after euthanasia, the brains of 7-8 animals/group were excised and weighed, and the hypothalamus was separated and transferred to TRIzol® (Invitrogen, Life Technologies, Carlsbad, CA, USA) solution for RNA isolation, according to the manufacture’s protocol. For RNA expression, one microgram (µg) of total RNA was reverse transcribed using the First-Strand cDNA Synthesis Kit (GE Healthcare Bio-Sciences, Piscataway, NJ, USA), as recommended by the manufacturer′s instructions. For Lep-R and GLP1-R gene amplification, the following primer pairs were used, respectively: Lep-R_forward (5´CCATTCCCAGCTCACTGTCT 3´) and Lep-R_reverse (5´GAACAGGATTGAAACTGGGG 3´) and GLP1-R_forward (5´ CTGCATCGTGATAGCCAAGCT 3´) and GLP1-R_reverse (5´ GGACTTCGCGAGTCTGCATT 3´).(35) The amplification of 18S rDNA (18S_forward: 5′ ATGCGTGCATTTATCAGA 3′; 18S_reverse: 5′ AACTATCCCGTCTGCAAG 3′) was used as an internal control.(36) The qRT-PCR consisted of 20ng of template cDNA, 8μM of each primer (forward and reverse), and 1x SYBR Green PCR Master Mix Kit (Stratagene, La Jolla, CA, USA), in a total volume of 25μL. Gene expression was quantified by qRT-PCR in a thermocycler (Stratagene MxPro3005P, La Jolla, CA, USA) programmed as follows: 5 minutes at 94 °C; 40 cycles of 15 seconds at 94 °C, 30 seconds at 60 °C, 30 seconds at 72 °C; and ending with a dissociation curve. The threshold cycle (Ct) values obtained by amplification were measured and a relative change in the expression level of one specific gene was presented as 2 - ΔΔCt.(37)
Statistical analysis
Data are presented as means ± standard deviation (SD). After normality and homoscedasticity tests, the data were submitted to two-way Anova and F values were calculated for Litter (L), Exercise (E) and Interaction (I), followed by the Tukey post-hoc test. P<0.05 was adopted as significant. Statistical analyses and figures were elaborated with GraphPad Prism, version 6.0 for Windows (GraphPad Software, San Diego, CA, USA).
RESULTS
After weaning (21 days of life), the male SL rats presented higher BW (38%) in relation to the NL group rats (Table 1; p<0.0001); similar results were found in a SL adult male rat. Thus, at 93 days of life SL was found to influence BW (F (1,40) = 32.07; p<0.0001), LI (F (1,40) = 1.,76; p=0.0003) and fasting glycemia (F (1,39) = 10.00; p=0.0030). SLSed rats presented higher BW (18%; p<0.0001); LI (4%; p=0.0040) and glycemia (46%; p=0.0060) in comparison to NLSed animals. Neither plasma triglyceride (F (1,40) = 0.7940; p=0.3782) nor insulin (F (1,38) = 1.58; p=0.2159) levels were significantly affected by litter manipulation (Table 1). With the exception of the insulin value, exercise influenced the BW (F (1,40) = 10.42; p=0.0025), NAL (F (1,40) = 8.375; p=0.0061), LI (F (1,40) = 33.64; p<0.0001), and plasma glucose (F (1,39) = 4.105; p=0.0496) and triglyceride (F (1,40) = 4.165; p=0.0479) levels. Interaction effects (L versus E) were also observed for BW (F (1,40) = 8.038; p=0.0071), where NLExe (16%; p<0.0001) and SLExe (11%; p=0.006) groups had lower BW in relation to SLSed rats. Moreover, LI was significantly reduced in NLExe (8%; p<0.0001) and SLExe (6%; p<0.0001) groups, in comparison to SLSed animals. Similarly, the fasting glycemia values were lower in NLExe (34%; p<0.0044) and SLExe (25%; p<0.0484) groups, in relation to the SLSed animals. Exercise and litter interaction effects modulated plasma triglyceride levels (F (1,40) = 11.41; p=0.0016). Thus, SLSed animals demonstrated elevated triglyceride values, in relation to the NLSed (34%; p=0.0220) and SLExe (42%; 0.0024) groups.
The impacts of litter size reduction and swimming training on food intake, FEC and adiposity in adult SL offspring rats are shown in figure 2A-F. Litter size manipulation influenced BW gain (F (1,40) = 7.842; p=0.0078; Figure 2A); FEC (F(1,40) = 9.065; p=0.0045; Figure 2B); total food intake (F (1,40) = 4.290; p=0.0448; Figure 2C); WAT-M (F(1,40) = 22.35; p<0.0001; Figure 2D); WAT-R (F(1,40) = 33.09; p<0.0001; Figure 2E) and BAT (F (1, 40) = 7.536; p=0.0090; Figure 2F) content. Thus, SLSed rats showed higher BW gain (14%); FEC (22%) and visceral adiposity [WAT-R (47%) and WA-M (50%)] in relation to NLSed animals. Exercise also modified BW gain (F (1, 40) = 20.63; p<0.0001); FEC (F (1,40) = 7.596; p=0.0088); WAT-M (F (1, 40) = 22.35; p<0.0001); WAT-R (F (1, 40) = 50.91; p<0.0001) and BAT (F (1, 38) = 140.7; p<0.0001). Moreover, interaction effects (L versus E) were noted in the FEC (F (1,40) = 21.09; p<0.0001) and WAT-M depot (F (1,40) = 10.62; p=0.0023). Thus, it may be noted that SLExe rats presented a lower BW gain (19%), and lower FEC (14%), WAT- R (41%) and WAT-M (31%), compared to the SLSed group, and showed similar values to those of the NLSed animals. Moreover, the SLExe and NLExe groups showed higher BAT weight (67%) in relation to the respective sedentary groups.
Body weight gain (A), FEC (B), total food intake (C) and adiposity (D to F) of NL and SL male adult offspring rats submitted to swimming training throughout life
Blood cell parameters in the SL and NL exercised animals are presented in the figure 3A-I. The platelets were influenced by litter (F (1,38) = 12.58; p=0.0011) as well as by the interaction (L versus E) (F (1,38) = 4.495; p=0.0406). Thus, SLSed and SLExe groups presented significant reductions of 37% (p=0.0015) and 30% (p=0.0119), respectively, in platelet values, in comparison to NLSed animals (Figure 3A). Interaction effects (L versus E) were also observed for the RBC (Figure 3B), MCHC (Figure 3C) and Hct (Figure 3D) parameters, however without significant difference using the Tukey post-hoc test. On the other hand, exercise affected granulocytes (F(1,38) = 5.263; p=0.0274; Figure 3E) and Hb (F (1,38) = 4.773; p=0.0351; Figure 3F) values, where SLExe rats had a reduction of 36% (p=0.0492) in granulocytes in relation to SLSed animals. Moreover, NLExe animals had lower (5%; p=0.0428) Hb values in comparison to NLSed rats. The other hematological parameters evaluated were not significantly affected by either litter size manipulation or swimming training (Figure 3G-I).
Red blood cells and white blood cells counts in adult normal litters and small litter male offspring rats submitted to swimming training throughout life
Glucose tolerance and insulin sensitivity are shown in figure 4A-E. After glucose load (2g/Kg/BW ip) the SLSed rats presented higher glucose values than those of the other experimental groups (Figure 4A), influencing AUC. The AUC of glucose during the ipGTT was affected by the E versus L interaction (F (1, 27) = 8.734; p=0.0064), where SLExe rats presented a significant reduction (59%; p=0.0282) in the AUC of glucose, in comparison to the SLSed group (Figure 4C). The glycemic response after insulin load (1U/Kg/BW ip) was higher in the SLSed rats versus other experimental groups (Figure 4B), which influenced the AUC. The AUC was affected by the L interaction (F (1, 31) = 6.149; p=0.0188) and SLSed rats had significantly higher glucose levels for the glucose AUC, in comparison to the NLSed (17%; p=0.0293) and NLExe (19%; p=0.0124) groups (Figure 4D).
Glucose (A and C) and insulin (B and D) tolerance tests in normal litters and adult small litter male offspring rats submitted to swimming training throughout life
After insulin administration (1U/Kg/BW ip), plasma glucose levels decreased in all of the groups (Figure 4B). The AUC for glucose during the ipITT was significantly higher (17%) in SLSed animals, in relation to the NLSed and NLExe groups (Figure 4D). However, the magnitude of the decrease in blood glucose was greater for the SL groups, as shown by the KITT data (F (1,31) = 25.47; p<0.0001; Figure 4E). Thus, SLSed rats showed an elevated KITT value in relation to NLSed (28%; p=0.0144) and NLExe rats (38%; p=0.0004).
Total brain weight was influenced by litter size reduction (F (1,40) = 6.381; p=0.0156) and exercise (F (1,40) = 11.70; p=0.0015); total brain weight was significant lower (16%; p=0.0008) in the SLSed rats, compared to NLExe animals (Figure 5A). Similarly, hypothalamic GLP1-R gene expression was influenced by litter size reduction (F(1,20) = 7.204; p=0.0143) and exercise (F (1,20) = 6.607; p=0.0183; Figure 5B); hypothalamic GLP1-R gene expression was approximately five times higher in SLSed rats, compared to the NLExe (p=0.0096) and SLExe (p=0.0485) groups. Litter size reduction (F (1,24) = 8.329; p=0.0081), exercise (F (1,24) = 6.473; p=0.0178) and their interaction (L versus E) (F (1,24) = 6.369; p=0.0186) influenced Lep-R hypothalamic gene expression; hypothalamic Lep-R gene expression was approximately five times higher in the hypothalami of SLSed rats, in relation to the NLSed (p=0.0064), NLExe (p=0.0062) and SLExe groups (p=0.0138) (Figure 5C).
Total brain weight (A) and hypothalamic gene expressions of GLP1-R (B) and Lep-R (C) in adult normal litters and small litter male offspring rats submitted to swimming training throughout life
DISCUSSION
In the present study, we confirmed that pups reared in SLs present elevated BW at weaning and higher BW gain throughout life, as demonstrated by several studies.(1,22,38) Moreover, our data show that adult SL offspring rats develop greater adiposity, as characterized by high visceral WAT depots, associated with augmented fasting values of glucose and triglycerides. These data corroborate results showing that lactational hypernutrition is associated with a high risk for obesity and metabolic diseases in adulthood, as established by the Developmental Origins of Health and Disease (DOHaD)concept.(4,39) Lactational hypernutrition is a recognized model of obesity induction in adult life.(5,21,40) We(20) and others(19,24,41) have demonstrated that SL reduction during lactation modifies milk composition, increasing lipid content and elevating the intake of calories by pups.(4,19) High energy surplus during the lactation phase can alter important hypothalamic pathways involved in food intake and body weight control.(4,5) In this regard, we found that adult SL offspring rats presented higher FEC, indicating a greater ability to convert calories consumed to BW gain, particularly visceral fat. These data confirm earlier findings that overnutrition in SL animals causes hypertrophy specifically in the visceral WAT depot.(42) Some studies have indicated that adult SL offspring present elevated plasma insulin(5,24) and leptin(24,43) levels. In our study, we did not observe fasting hyperinsulinemia in adult SL offspring rats. However, we noted that these rats presented elevated Kitt values, indicating higher insulin sensibility. Insulin is a primary lipogenic and adipogenic hormone and probably contributed to elevated adiposity in the SL obesity model, as previously demonstrated by Lundbaek.(33)
As mentioned, adult SL offspring rats develop obesity and metabolic dysfunctions, such as glucose intolerance.(22,40) We found that adult SL offspring rats had elevated AUC of glucose during ipGTT. However, this response was not linked to IR in adult life. We previously demonstrated that pancreatic islets from adult SL obese rats have reduced glucose-induced insulin secretion.(22) Thus, the fasting hyperglycemia and glucose intolerance found in adult SL obese rats appears more related to the lower insulin secretion from the endocrine pancreas than IR, as also suggested by Waterland et al.(40)
Exercise elevates energy expenditure, reduces fat deposition, and prevents the development of chronic metabolic diseases.(15,16) Accordingly, our data showed that swimming training, started after weaning and maintained throughout life, prevents obesity and metabolic abnormalities in adult SL offspring life. Herein, SL exercised rats demonstrated restored insulin sensitivity and glucose tolerance when compared to SL sedentary animals, events that may be related to normalization of fasting glycemia and the reduction in WAT visceral depots. Using the SL obese model, we previously demonstrated that swimming training is able to restore glucose-induced insulin secretion from isolated pancreatic islets.(22) The anti-adiposity effects of exercise in SL rats were also demonstrated by Rinaldi et al.(27) According to these authors, beneficial exercising of SL obese rats involves restoring the autonomic imbalance. Consistent with this finding, we also noted higher BAT weight in SL exercised rats, suggesting that swimming training was able to reactivate the BAT hypofunction frequently found in SL obese rats.(43) In agreement, male rodents submitted to swimming training performed between 35-36oC showed augmented thermogenesis with high norepinephrine release and protein content, resulting in increased BAT weight.(44)
Obesity is associated with alterations in RBC and WBC numbers and functions.(45) Herein, we showed that SL overfed rats presented normal profiles of RBC and Hct, in contrast to obese subjects.(46) However, we observed a significant reduction in platelet count in SL obese rats, as is frequently observed in the obesity state.(47) Activated platelets have thrombo-inflammatory functions linking hemostatic and immune responses in several physiological and pathological conditions.(48) Early overnutrition elevates the risk for cardiovascular diseases during life.(4,49) Thus, altered platelet counts in adult SL obese rats may contribute to abnormal vascular functions. Further studies are necessary to confirm this hypothesis. Moreover, we found interaction effects (E versus L) on Hct, RBC, MCHC and platelets, suggesting that the SL obese model could induce altered responsiveness of hematological parameters to exercise training.
In the present study, we also noted that gene expressions of GLP1-R and Lep-R are augmented in the hypothalamus of adult SL offspring rats, confirming several studies showing that lactation overfeeding modifies hypothalamic pathways and energy homeostasis control.(2,50-52) Augmented Lep-R gene expression in hypothalamus was also found in adult SL obese rats by Aréchiga-Ceballos et al.(53)In contrast, Rocio Schumacher et al. showed that hyperexpression of the Lep-R gene observed in the hypothalamus of SL rats occurred only at 21 days, and disappeared in adult life.(54) In contrast to Schumacher et al.(54) who evaluated specific gene expression in the ARC, we studied gene expression in the total hypothalamus. Dawidowa et al. demonstrated that altered leptin anorexigenic responsiveness found in hypothalamic neurons of SL rats explained the disruption in energy homeostasis in this model.(55) GLP1 is an important incretin that regulates food intake and insulin sensitivity;(50,56) however, the effects of GLP1 have been poorly explored in the SL obese model. Our study found augmented GLP1-R hypothalamic gene expression in adult SL offspring rats. In contrast, a recent published study showed that adult SL rats present reduced GLP1-R gene expression in the ARC, without changes in intestinal GLP1-R protein expression.(26) Similarly as Lep-R, GLP1-R gene expression was evaluated in the total hypothalamus and not just in the ARC, this may be the point of antithesis.
It is well recognized that epigenetic mechanisms, such as, histone and DNA methylation or acetylation besides miRNA are involved in lactation metabolic programming.(57-59)In SL rats, the hypothalamic gene promoter of the main anorexigenic neurohormone, proopiomelanocortin (POMC), showed hypermethylation of CpG dinucleotides, blocking leptin regulatory effects. Obesity is associated with leptin resistance and, despite hyperleptinaemia, POMC expression lacked upregulation in SL obese rats.(57) A recent study demonstrated that decreased methylation of the Lep-R promoter, H3K27, increased Lep-R mRNA levels in the hypothalamus.(58)
GLP1-R is highly expressed in hypothalamic neurons, leading to an overall reduction of appetite and energy intake. Reduced expression of GLP1-R in Type 2 diabetes mellitus patients might also be mediated by increased methylation of its promoter.(59) In endocrine pancreas, GLP1-R gene expression is regulated by DNA methylation, a process unknown at hypothalamic levels. Lep-R is present in the hypothalamic neurons expressing GLP1 and the anorexic action of leptin involves GLP1 regulation.(60) Thus, we suggest that the hyperexpression of Lep-R and GLP1-R, found herein, could be related.
To our knowledge, we have shown, for the first time, that chronic swimming training effectively normalizes GLP1-R and Lep-R gene expression in the hypothalamus of SL overnourished rats, indicating a potential role of exercise in preventing the reprogramming induced by lactational hypernutrition. Plasma insulin and leptin can cross the blood-brain barrier (BBB), repressing neuropeptide Y (NPY)/AgRP (orexigenic neuropeptides) and increasing POMC (anorexigenic neuropeptide) gene expression in the hypothalamic ARC.(61,62) Regular exercise can decrease high caloric food intake, leading to an improvement in body weight, due to activation of POMC neurons.(52) In contrast to our findings, nine weeks of endurance exercise reduced plasma leptin levels and increased Lep-R mRNA expression in the ARC of non-obese mice.(60) As demonstrated herein, SL-overnourished rats are obese and present high Lep-R hypothalamic gene expression. Thus, it is probable that exercise training restores altered Lep-R gene hypothalamic expression in SL-obese male rats. Interestingly, we have already demonstrated that exercise in SL rats restores the effects of GLP1 on isolated pancreatic islets.(22) Moreover, as mentioned, the anorexic action of leptin involves modulations in GLP1-R in the hypothalamic nucleus.(63)
Swimming training can modulate hypothalamic gene expression via epigenetic mechanisms.(64) In this study, swimming training was introduced immediately after weaning and maintained throughout life, favoring epigenetic exercise-induced modifications. In accordance with this hypothesis, long-term exercise elevated the levels of methylation in the hippocampus and hypothalamus, promoting down-regulation of gene related with adiposity.(65) Thus, we believe that exercise-induced normalization of GLP1-R and Lep-R hypothalamic gene expression (shown herein) may be associated with the reestablishment of FEC, more adequate BW and adiposity control in adult SL offspring rats.
We should point out some of the limitations of our data. First, we did not measure the serum concentrations of leptin or GLP1. Secondly, we evaluated total hypothalamic GLP1-R and Lep-R gene expression, and these receptors can be modulated in specific nuclei, as demonstrated by Sanz et al.(63)
CONCLUSION
In conclusion, swimming training throughout life can prevent the obesity and metabolic abnormalities induced by lactational overfeeding, an effect that could involve normalization of GLP1-R and Lep-R gene expression in the hypothalamus region.
REFERENCES
- 1 Ziko I, Sominsky L, Nguyen TX, Yam KY, De Luca S, Korosi A, et al. Hyperleptinemia in Neonatally Overfed Female Rats Does Not Dysregulate Feeding Circuitry. Front Endocrinol (Lausanne). 2017;8:287.
- 2 Chen H, Simar D, Morris MJ. Hypothalamic neuroendocrine circuitry is programmed by maternal obesity: interaction with postnatal nutritional environment. PLoS One. 2009;4(7):e6259.
- 3 Peleg-Raibstein D. Understanding the Link Between Maternal Overnutrition, Cardio-Metabolic Dysfunction and Cognitive Aging. Front Neurosci. 2021;15:645569.
- 4 Picó C, Reis F, Egas C, Mathias P, Matafome P. Lactation as a programming window for metabolic syndrome. Eur J Clin Invest. 2021;51(5):e13482.
- 5 Habbout A, Li N, Rochette L, Vergely C. Postnatal overfeeding in rodents by litter size reduction induces major short- and long-term pathophysiological consequences. J Nutr. 2013;143(5):553-62.
- 6 Dyer JS, Rosenfeld CR. Metabolic imprinting by prenatal, perinatal, and postnatal overnutrition: a review. Semin Reprod Med. 2011;29(3):266-76. Review.
- 7 González-Hedström D, Guerra-Menéndez L, Tejera-Muñoz A, Amor S, de la Fuente-Fernández M, Martín-Carro B, et al. Overfeeding During Lactation in Rats is Associated with Cardiovascular Insulin Resistance in the Short-Term. Nutrients. 2020;12(2):549.
- 8 Timper K, Brüning JC. Hypothalamic circuits regulating appetite and energy homeostasis: pathways to obesity. Dis Model Mech. 2017;10(6):679-89.
- 9 Yoo ES, Yu J, Sohn JW. Neuroendocrine control of appetite and metabolism. Exp Mol Med. 2021;53(4):505-16.
- 10 Obradovic M, Sudar-Milovanovic E, Soskic S, Essack M, Arya S, Stewart AJ, et al. Leptin and Obesity: Role and Clinical Implication. Front Endocrinol (Lausanne). 2021;12:585887.
- 11 Fruhwürth S, Vogel H, Schürmann A, Williams KJ. Novel Insights into How Overnutrition Disrupts the Hypothalamic Actions of Leptin. Front Endocrinol (Lausanne). 2018;9:89.
- 12 Cardenas-Perez RE, Fuentes-Mera L, de la Garza AL, Torre-Villalvazo I, Reyes-Castro LA, Rodriguez-Rocha H, et al. Maternal overnutrition by hypercaloric diets programs hypothalamic mitochondrial fusion and metabolic dysfunction in rat male offspring. Nutr Metab (Lond). 2018;15(1):38.
- 13 Friedman JM. Leptin and the endocrine control of energy balance. Nat Metab. 2019;1(8):754-64.
- 14 Ten Kulve JS, van Bloemendaal L, Balesar R, IJzerman RG, Swaab DF, Diamant M, et al. Decreased Hypothalamic Glucagon-Like Peptide-1 Receptor Expression in Type 2 Diabetes Patients. J Clin Endocrinol Metab. 2016;101(5):2122-9.
- 15 Horowitz JF. Exercise-induced alterations in muscle lipid metabolism improve insulin sensitivity. Exerc Sport Sci Rev. 2007;35(4):192-6.
- 16 Pinckard K, Baskin KK, Stanford KI. Effects of Exercise to Improve Cardiovascular Health. Front Cardiovasc Med. 2019;6:69.
- 17 Park SH, Yoon JH, Seo DY, Kim TN, Ko JR, Han J. Resistance Exercise Training Attenuates the Loss of Endogenous GLP-1 Receptor in the Hypothalamus of Type 2 Diabetic Rats. Int J Environ Res Public Health. 2019;16(5):830.
- 18 Kimura M, Tateishi N, Shiota T, Yoshie F, Yamauchi H, Suzuki M, et al. Long-term exercise down-regulates leptin receptor mRNA in the arcuate nucleus. Neuroreport. 2004;15(4):713-6.
- 19 Xavier JLP, Scomparin DX, Pontes CC, Ribeiro PR, Cordeiro MM, Marcondes JA, et al. Litter Size Reduction Induces Metabolic and Histological Adjustments in Dams throughout Lactation with Early Effects on Offspring. An Acad Bras Cienc. 2019;91(1):e20170971.
- 20 Capriglioni Cancian CR, Leite NC, Montes EG, Fisher SV, Waselcoski L, Lopes Stal EC, et al. Histological and Metabolic State of Dams Suckling Small Litter or MSG-Treated Pups. ScientificWorldJournal. 2016;2016:1678541.
- 21 Plagemann A, Heidrich I, Götz F, Rohde W, Dörner G. Obesity and enhanced diabetes and cardiovascular risk in adult rats due to early postnatal overfeeding. Exp Clin Endocrinol. 1992;99(3):154-8.
- 22 Fischer SV, Capriglioni Cancian CR, Montes EG, de Carvalho Leite N, Grassiolli S. Swimming training prevents metabolic imprinting induced by hypernutrition during lactation. Clin Nutr ESPEN. 2015;10(1):e13-20.
- 23 Plagemann A. Perinatal nutrition and hormone-dependent programming of food intake. Horm Res. 2006;65 Suppl 3:83-9.
- 24 Habbout A, Li N, Rochette L, Vergely C. Postnatal overfeeding in rodents by litter size reduction induces major short- and long-term pathophysiological consequences. J Nutr. 2013;143(5):553-62.
- 25 Rodrigues AL, de Moura EG, Passos MC, Dutra SC, Lisboa PC, Dutra P, et al. Postnatal early overnutrition changes the leptin signalling pathway in the hypothalamic-pituitary-thyroid axis of young and adult rats. J Physiol. 2009;587(Pt 11):2647-61.
- 26 Rodrigues VS, Moura EG, Peixoto TC, Soares PN, Lopes BP, Bertasso IM, et al. The model of litter size reduction induces long-term disruption of the gut-brain axis: an explanation for the hyperphagia of Wistar rats of both sexes. Physiol Rep. 2022;10(3):e15191.
- 27 Rinaldi W, Gomes RM, Scomparin DX, Grassiolli S, Ribeiro TA, Fabricio GS, et al. Low-intensity and moderate exercise training improves autonomic nervous system activity imbalanced by postnatal early overfeeding in rats. J Int Soc Sports Nutr. 2014;11(1):25.
- 28 Parra-Vargas M, Ramon-Krauel M, Lerin C, Jimenez-Chillaron JC. Size Does Matter: Litter Size Strongly Determines Adult Metabolism in Rodents. Cell Metab. 2020;32(3):334-40.
- 29 Souza LL, Moura EG, Lisboa PC. Litter Size Reduction as a Model of Overfeeding during Lactation and Its Consequences for the Development of Metabolic Diseases in the Offspring. Nutrients. 2022;14(10):2045.
- 30 Capriglioni Cancian CR, Leite NC, Montes EG, Fisher SV, Waselcoski L, Lopes Stal EC, et al. Histological and Metabolic State of Dams Suckling Small Litter or MSG-Treated Pups. ScientificWorldJournal. 2016;2016:1678541.
- 31 Voltarelli FA, Gobatto CA, de Mello MA. Determination of anaerobic threshold in rats using the lactate minimum test. Braz J Med Biol Res. 2002;35(11):1389-94.
- 32 Nery CS, Pinheiro IL, Muniz GS, de Vasconcelos DA, de França SP, do Nascimento E. Murinometric evaluations and feed efficiency in rats from reduced litter during lactation and submitted or not to swimming exercise. Rev Bras Med Esporte. 2011;17(1):49-55.
- 33 Lundbaek K. Intravenous glucose tolerance as a tool in definition and diagnosis of diabetes mellitus. BMJ. 1962;1(5291):1507-13.
- 34 Bernardis LL, Patterson BD. Correlation between 'Lee index' and carcass fat content in weanling and adult female rats with hypothalamic lesions. J Endocrinol. 1968;40(4):527-8.
- 35 Li B, Xi X, Roane DS, Ryan DH, Martin RJ. Distribution of glucokinase, glucose transporter GLUT2, sulfonylurea receptor-1, glucagon-like peptide-1 receptor and neuropeptide Y messenger RNAs in rat brain by quantitative real time RT-PCR. Brain Res Mol Brain Res. 2003;113(1-2):139-42.
- 36 Svidnicki PV, de Carvalho Leite N, Venturelli AC, Camargo RL, Vicari MR, de Almeida MC, et al. Swim training restores glucagon-like peptide-1 insulinotropic action in pancreatic islets from monosodium glutamate-obese rats. Acta Physiol (Oxf). 2013;209(1):34-44.
- 37 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-? ? C(T)) Method. Methods. 2001;25(4):402-8.
- 38 Rinaldi W, Ribeiro TA, Marques AS, Fabricio GS, Tófolo LP, Gomes RM, et al. Efeito da redução de ninhada sobre as respostas autonômicas e metabólicas de ratos Wistar. Rev Nutr. 2012;25(3):321-30.
- 39 Plagemann A. Perinatal programming and functional teratogenesis: impact on body weight regulation and obesity. Physiol Behav. 2005;86(5):661-8.
- 40 Waterland RA, Garza C. Early postnatal nutrition determines adult pancreatic glucose-responsive insulin secretion and islet gene expression in rats. J Nutr. 2002;132(3):357-64.
- 41 Fiorotto ML, Burrin DG, Perez M, Reeds PJ. Intake and use of milk nutrients by rat pups suckled in small, medium, or large litters. Am J Physiol. 1991;260(6 Pt 2):R1104-13.
- 42 Conceição EP, Trevenzoli IH, Oliveira E, Franco JG, Carlos AS, Nascimento-Saba CC, et al. Higher white adipocyte area and lower leptin production in adult rats overfed during lactation. Horm Metab Res. 2011;43(7):513-6.
- 43 Lisboa PC, Conceição EP, de Oliveira E, Moura EG. Postnatal overnutrition programs the thyroid hormone metabolism and function in adulthood. J Endocrinol. 2015;226(3):219-26.
- 44 Oh-ishi S, Kizaki T, Toshinai K, Haga S, Fukuda K, Nagata N, et al. Swimming training improves brown-adipose-tissue activity in young and old mice. Mech Ageing Dev. 1996;89(2):67-78.
- 45 Purdy JC, Shatzel JJ. The hematologic consequences of obesity. Eur J Haematol. 2021;106(3):306-19.
- 46 Pecht T, Gutman-Tirosh A, Bashan N, Rudich A. Peripheral blood leucocyte subclasses as potential biomarkers of adipose tissue inflammation and obesity subphenotypes in humans. Obes Rev. 2014;15(4):322-37.
- 47 Furuncuoglu Y, Tulgar S, Dogan AN, Cakar S, Tulgar YK, Cakiroglu B. How obesity affects the neutrophil/lymphocyte and platelet/lymphocyte ratio, systemic immune-inflammatory index and platelet indices: a retrospective study. Eur Rev Med Pharmacol Sci. 2016;20(7):1300-6.
- 48 Rawish E, Nording H, Münte T, Langer HF. Platelets as Mediators of Neuroinflammation and Thrombosis. Front Immunol. 2020;11:548631.
- 49 Yim HE, Ha KS, Bae IS, Yoo KH, Hong YS, Lee JW. Overweight, hypertension and renal dysfunction in adulthood of neonatally overfed rats. J Nutr Biochem. 2013;24(7):1324-33.
- 50 Lee SJ, Sanchez-Watts G, Krieger JP, Pignalosa A, Norell PN, Cortella A, et al. Loss of dorsomedial hypothalamic GLP-1 signaling reduces BAT thermogenesis and increases adiposity. Mol Metab. 2018;11:33-46.
- 51 Gorski JN, Dunn-Meynell AA, Levin BE. Maternal obesity increases hypothalamic leptin receptor expression and sensitivity in juvenile obesity-prone rats. Am J Physiol Regul Integr Comp Physiol. 2007;292(5):R1782-91.
- 52 Lin S, Storlien LH, Huang XF. Leptin receptor, NPY, POMC mRNA expression in the diet-induced obese mouse brain. Brain Res. 2000;875(1-2):89-95.
- 53 Aréchiga-Ceballos F, Alvarez-Salas E, Matamoros-Trejo G, Amaya MI, García-Luna C, de Gortari P. Pro-TRH and pro-CRF expression in paraventricular nucleus of small litter-reared fasted adult rats. J Endocrinol. 2014;221(1):77-88.
- 54 Schumacher R, Rossetti MF, Lazzarino GP, Canesini G, García AP, Stoker C, et al. Temporary effects of neonatal overfeeding on homeostatic control of food intake involve alterations in POMC promoter methylation in male rats. Mol Cell Endocrinol. 2021;522:111123.
- 55 Davidowa H, Plagemann A. Hypothalamic neurons of postnatally overfed, overweight rats respond differentially to corticotropin-releasing hormones. Neurosci Lett. 2004371(1):64-8.
- 56 Ronveaux CC, Tomé D, Raybould HE. Glucagon-like peptide 1 interacts with ghrelin and leptin to regulate glucose metabolism and food intake through vagal afferent neuron signaling. J Nutr. 2015;145(4):672-80.
- 57 Plagemann A, Harder T, Brunn M, Harder A, Roepke K, Wittrock-Staar M, et al. Hypothalamic proopiomelanocortin promoter methylation becomes altered by early overfeeding: an epigenetic model of obesity and the metabolic syndrome. J Physiol. 2009;587(Pt 20):4963-76.
- 58 Kim MH, Li Y, Zheng Q, Jiang L, Myers MG Jr, Wu WS, et al. LepRb+ cell-specific deletion of Slug mitigates obesity and nonalcoholic fatty liver disease in mice. J Clin Invest. 2023;133(4):e156722.
- 59 Hall E, Dayeh T, Kirkpatrick CL, Wollheim CB, Dekker Nitert M, Ling C. DNA methylation of the glucagon-like peptide 1 receptor (GLP1R) in human pancreatic islets. BMC Med Genet. 2013;14(1):76.
- 60 Zhao J, Tian Y, Xu J, Liu D, Wang X, Zhao B. Endurance exercise is a leptin signaling mimetic in hypothalamus of Wistar rats. Lipids Health Dis. 2011;10(1):225.
- 61 Zampieri TT, Bohlen TM, Silveira MA, Lana LC, de Paula DG, Donato J Jr, et al. Postnatal Overnutrition Induces Changes in Synaptic Transmission to Leptin Receptor-Expressing Neurons in the Arcuate Nucleus of Female Mice. Nutrients. 2020;12(8):2425.
- 62 Skowronski AA, Shaulson ED, Leibel RL, LeDuc CA. The postnatal leptin surge in mice is variable in both time and intensity and reflects nutritional status. Int J Obes (Lond). 2022;46(1):39-49..
- 63 Sanz C, Vázquez P, Navas MA, Alvarez E, Blázquez E. Leptin but not neuropeptide Y up-regulated glucagon-like peptide 1 receptor expression in GT1-7 cells and rat hypothalamic slices. Metabolism. 2008;57(1):40-8.
- 64 Kashimoto RK, Toffoli LV, Manfredo MH, Volpini VL, Martins-Pinge MC, Pelosi GG, et al. Physical exercise affects the epigenetic programming of rat brain and modulates the adaptive response evoked by repeated restraint stress. Behav Brain Res. 2016;296:286-9.
- 65 Liu SJ, Cai TH, Fang CL, Lin SZ, Yang WQ, Wei Y, et al. Long-term exercise training down-regulates m6A RNA demethylase FTO expression in the hippocampus and hypothalamus: an effective intervention for epigenetic modification. BMC Neurosci. 2022;23(1):54.








NL: normal litter; SL: small litter; NLSed: normal litter and sedentary rats; NLExe: normal litter and exercised rats; SLSed: small litter sedentary rats; SLExe: small litter exercised rats; IpGTT: intraperitoneal (ip) glucose tolerance test; IpITT: intraperitoneal (ip) insulin tolerance tests.
Data are means±SD. Male rats (10 -11) were used in groups originated from at least 5 different litters. The line(s) above of graphic indicate p values for F effects (E: exercise; L: litter and I: interaction) in two-way Anova test. Letters above bars show statistical differences, Tukey post-hoc test (p<0. 05) for; a: NLSed; b: NLExe; c: SLSed; d: SLExe.
Data are means±SD. Data are means±SD. Male rats (10 -11) were used in groups originated from at least 5 different litters. The line(s) above of graphic indicate p values for F effects (E: exercise; L: litter and I: interaction) in two-way Anova test. Letters above bars show statistical differences, Tukey post-hoc test (p<0. 05) for; a: NLSed; b: NLExe; c: SLSed; d: SLExe.
Data are means±SD. Data are means±SD. Male rats (10 -11) were used in groups originated from at least 5 different litters. The line(s) above of graphic indicate p values for F effects (E: exercise; L: litter and I: interaction) in two-way Anova test. Letters above bars show statistical differences, Tukey post-hoc test (p<0. 05) for; a: NLSed; b: NLExe; c: SLSed; d: SLExe.
Data are means±SD. Data are means±SD. Male rats (7-8) were used in groups originated from at least 5 different litters. The line(s) above of graphic indicate p values for F effects (E: exercise; L: litter and I: interaction) in two-way Anova test. Letters above bars show statistical differences , Tukey post-hoc test (p<0. 05) for; a: NLSed; b: NLExe; c: SLSed; d: SLExe.