Open-access Probiotic yeast Saccharomyces cerevisiae Az-12 isolated from pomegranate juice presented inhibitory effects against pathogenic bacteria

Levedura probiótica Saccharomyces cerevisiae Az-12 isolada de suco de romã apresentando efeitos inibitórios contra bactérias patogênicas

Abstract

The potential probiotic yeast was isolated from the Kyzyl Anor pomegranate variety growing in the Turkestan region (Kazakhstan). The yeast strain was identified as Saccharomyces cerevisiae Az-12. Molecular genetic identification was carried out using the Sanger sequencing method. The degree of homology of the S. cerevisiae Az-12 strain with the strain MH608341.1 Saccharomyces cerevisiae isolate extr03 was 99.65%. Antagonistic effect of the yeast against pathogenic bacteria was confirmed according inhibition zones for Staphylococcus aureus 13.5 ± 0.05 mm; the inhibition zones for Escherichia coli 12.8 ± 0.05 mm; and 10.7 ± 0.05 mm for Pseudomonas aeruginosa. Scanning microscopy of S. cerevisiae Az-12 and S. aureus confirmed the adhesive ability of the yeast cell surface to S. aureus. S. cerevisiae Az-12 were chosen as the most promising, as they are able to quickly ferment juices. Functional drinks containing pomegranate juice and yeast with a probiotic effect can be considered as a useful synbiotic product formulation.

Keywords:
pomegranate juice; probiotics; Saccharomyces cerevisiae Az-12; inhibitory effect; bacteria

Resumo

A levedura probiótica potencial foi compreendida da variedade de romã Kyzyl Anor que cresce na região do Turquestão (Cazaquistão). A cepa de levedura foi identificada como Saccharomyces cerevisiae Az-12. A identificação genética molecular foi realizada pelo método de sequenciamento de Sanger. O grau de homologia da cepa S. cerevisiae Az-12 com a cepa MH608341.1 Saccharomyces cerevisiae isolado extr-03 foi de 99,65%. O efeito antagônico da levedura contra bactérias patogênicas foi confirmado de acordo com as zonas de inibição para Staphylococcus aureus 13,5 ± 0,05 mm; as zonas de inibição para Escherichia coli 12,8 ± 0,05 mm; e 10,7 ± 0,05 mm para Pseudomonas aeruginosa. A microscopia de varredura de S. cerevisiae Az-12 e S. aureus confirmou a capacidade de adesão da superfície celular de levedura a S. aureus. S. cerevisiae Az-12 foram escolhidas como as mais promissoras, pois são capazes de fermentar sucos rapidamente. Bebidas funcionais contendo suco de romã e fermento com efeito probiótico podem ser consideradas como uma formulação de produto simbiótico útil.

Palavras-chave:
suco de romã; probióticos; Saccharomyces cerevisiae Az-12; efeito inibitório; bactérias

1. Introduction

An analysis of the health status of the Kazakhstan population shows that many residents have health problems. This is connected both with the rhythm of life and with the consumption of fast food, the environment also has a great influence (Abilkayir, 2019). Pomegranate fruits, belonging to the Punicaceae family, are an important source of sugars, vitamins, minerals, antioxidant polyphenols, especially tannins, anthocyanins and ellagic acid derivatives, which are beneficial for health. Therefore, recently there has been a massive increase in the popularity of the use of pomegranate (Stockton and Al-Dujaili, 2022; Rinaldi et al., 2013; Kaplan et al., 2001; Gil et al., 2000; Danesi and Ferguson, 2017; Calín-Sánchez et al., 2013; Cano-Lamadrid et al., 2017). Pomegranate has been clinically and experimentally proven to play a protective role against atherosclerosis, hypertension, cancer, type II diabetes, and obesity (McFarlin et al., 2009; Al-Muammar and Khan, 2012).

A number of scientists suggest that fruit juices can serve as a suitable medium for the cultivation of probiotic microorganisms. At the same time, fruit juices already have an established market sector as a functional drink. Such juices are regularly consumed, which is extremely important when creating a new drink through the use of probiotics (Siti et al., 2016; Sheehan et al., 2007).

Modern methods of fermentation of plant products make it possible to use the metabolism of microorganisms to obtain valuable products (Wenli et al., 2022; Erkmen and Bozoglu, 2016a; Erkmen and Bozoglu, 2016b; Christensen et al., 2022; Feng et al., 2018, Pessoa et al., 2023). Saccharomyces cerevisiae is a widely used organism in both genetic engineering, electroporation manipulation (Alqosaibi et al., 2022) and fermentation industry (Willaert, 2017), scientists have identified the probiotic and beneficial potential of yeast for the human body. (Chigaeva and Dudikova, 2017; Guslandi et al., 2000, 2003).

Saccharomyces cerevisiae var. boulardii (Sb) is a yeast used in preparations with proven probiotic efficacy (McFarland, 2006; Beaugerie and Petit, 2004; Czerucka et al., 2007; Agarbati et al., 2020). Potentially probiotic yeast can be used to produce various fermented foods, improving their nutritional and organoleptic properties (Staniszewski and Kordowska-Wiater, 2021). There is information about the genome of Sb is a strain in an attempt to trace the genomic causes of this yeast's probiotic behavior. It has been found that proteins that appear to be specifically present in Sb are also present in some Saccharomyces cerevisiae (Sc) strains (Khatri et al., 2013). Sb was found not to form spores on sporulation medium even after one week of incubation (Edwards-Ingram et al., 2007). One of the hypotheses proposed to explain the probiotic activity of Sb against enteropathogenic microorganisms is antagonism by the formation of inhibitory compounds (Rajkowska et al., 2012). However, there are only a few studies that have shown that this yeast inhibits the growth of various bacteria. This effect has been demonstrated for Proteus mirabilis, Proteus vulgaris, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Pseudomonas aeruginosa and Escherichia coli (Rajkowska et al., 2012; Pontier-Bres et al., 2014). In vivo studies show that the protective reflex against S. typhimurium, Shigella flexneri and Clostridium difficile found in mice fed yeast-treated food was not associated with a decrease in the overall bacterial population in the gut (Rodrigues et al., 2000). Other properties that could explain the protective effect against enteropathogenic bacteria are immunomodulation, modulation of the production of substances with antitoxic action (Martins et al., 2005).

Thus, the aim of this study was the evaluate antagonistic effect of S. cerevisiae-Az-12 isolated from pomegranate on the pathogenic bacteria.

2. Materials and Methods

2.1. Isolation and identification of S. cerevisiae-Az-12

Pure culture of the yeast S. Cerevisiae Az-12 was isolated from pomegranate juice, cultural and morphological properties and physiological and biochemical properties were determined in accordance with standard methods accepted in microbiology according to researches (Saparbekova et al., 2019).

Wort agar, Sabur agar (glucose-peptone media), and YPD medium (Yeast Extract-Peptone-Dextrose) were used as nutrient media for the cultivation and study of yeast.

Molecular genetics identification of microorganisms was performed by Sanger sequencing. Genomic DNA from 1 day-old cultures was isolated using the Plant/Fungi DNA Isolation Kit from Norgen Biotek Corp (Canada) according to the manufacturer's protocol. The concentration of DNA in the samples was determined using a Qubit fluorometer (Invitrogen, USA) on the scale for dsDNAHS.

Universal primers of the ITS-region yeast such as ITS1 (5,-TCCGTAGGTGAACCTGCGG-3,) and ITS 2(5,-TCCTCCGCTTATTGATATGC-3,) were used in this work.

The reaction mixture for amplification consisted of: 12.5 µLQ5® Hot Start High-Fidelity 2X MasterMix, 1.25 µl Forward primer (10 µm), 1.25 µl Reverse primer (10 µm), 1.5 µl DNA, and 8.5 water. The total volume of the PCR mixture was 25 µl. PCR with universal primers was performed on an amplifier Eppendorf in the amplification mode: 94 °C-30 sec; 55 °C-1 min; 72 °C-40 sec-a total of 30 cycles; 72 °C-10 min. PCR products were stained and added to 1.2% agarose gel. They were visualized in a UV transilluminator.

2.2. Study of antagonistic abilities of S. cerevisiae Az-12

The antagonistic abilities of S. cerevisiae Az-12 were investigated with the following opportunistic or pathogenic bacteria: Escherichia coli, Enterococcus faecalis, Pseudomonas aeruginosa, Salmonella typhimurium, Staphylococcus aureus.

Antagonistic effect of the yeast was studied on the YPD medium using the agar plate method. The method is based on the observation of parallel growth of strains: indicator and antagonistic. Agar recesses with a diameter of 14 mm were aseptically cut from agar with YPD, overgrown with lawn S. cerevisiae Az-12 incubated for 48 hours at 37 °C. For the co-cultivation of yeast and opportunistic and pathogenic microorganisms, a modified medium was used, similar in content and consistency to the intestinal medium.

The modified medium consisted of the following components (in g•L-1 of distilled water): starch 5.0, pectin 2.0, guar gum 1.0, xylan 2.0, arabinogalactan 2.0, inulin 1.0, casein 3.0, peptone 3.33, trypton 5.0, raffinose 10.0, bile acid salts - 0.4, yeast extract - 4.5, FeSO4 • 7H2O - 0.005, NaCl - 6.16, KCl - 4.5, KH2PO4 - 0.5, MgSO4 • 7H2O -1.25, CaCl 2 • 6H2O - 0.15, NaHCO3 - 1.5, cysteine - 0.8, chemine - 0.05; pH was adjusted to 6.2.

The analysis of yeast and bacterial growth was carried out with an initial inoculation of CFU (Colony-Forming Unit) 105 CFU mL-1, incubation was carried out at 37°C under anaerobic conditions. The number of microorganisms was estimated by counting every 2 hours on the first day, then after 4 hours of incubation. For yeast, CFU• mL-1 values were determined by applying appropriate dilutions to the YPD agar medium with the addition of gentamicin (40 mg in 100mL) and for bacteria by applying to the nutrient agar. Pathogenic or opportunistic human bacteria: Escherichia coli, Salmonella Typhimurium, Enterococcus faecalis, Pseudomonas aeruginosa and Staphylococcus aureus were used as indicator microorganisms.

To study the adhesion of S. aureus to S. cerevisiae Az-12 yeast cells during their joint cultivation, a JSM-6490LM scanning electron microscope with an Energy INCA 350 energy dispersive X-ray microanalysis system and an HKL Basic system was used.

3. Results and Discussion

From fresh juices (grapes, apples, pomegranates, plums, pears, apricots, etc., growing in the South Kazakhstan region), 180 species of yeast have been isolated. 71 pure cultures were identified, most of yeast belong to Saccharomyces.

Two strains of yeast Saccharomyces cerevisiae Gul -8 (isolated from grapes) and Saccharomyces cerevisiae Az - 12 (isolated from pomegranate) were chosen as the most promising, since they are able to ferment fruit juices relatively quickly (Saparbekova et al., 2019). The leading factors were also organoleptic indicators: fruity smell, pleasant natural sweet-sour taste and the absence of visible turbidity. Consumption of beverages prepared with probiotics containing active microbial cells and their metabolites improves the functional properties of beverages. Fermentation of pomegranate juice was carried out at room temperature 25°C for 24 hours using 5 g of yeast per 100 ml of freshly squeezed juice.

A one-day old culture of the yeast S. cerevisiae Gul -8 and S.cerevisiae Az-12 were used for DNA isolation. The separation of the nutrient medium is carried out by centrifuging the culture for 5 minutes at 1000 ×g. Removal of the supernatant made it possible to get rid of the remnants of the nutrient medium. DNA isolation was carried out sequentially by first lysing the yeast cell and then removing bioorganic compounds, including carbohydrates, lipids, proteins, RNA, etc.

For separation of RNA, 30 μl of RNaseA solution was used; after addition of the enzyme, the mixture was incubated for 5 minutes at 37°C. For complete purification from fermentation and denaturation products, 10 μl of 4 M ammonium acetate solution and 1 ml of 100% ethanol were used. After intensive mixing, the tube was centrifuged for 3 minutes at maximum speed (14500 rpm) at room temperature. After removing the supernatant at room temperature, the precipitate with DNA was dried and dissolved in 100 µl of TE buffer.

Molecular genetic identification is carried out using the Sanger sequencing method.

Genomic DNA from 1 day old cultures of the yeast S. cerevisiae Gul -8 and S. cerevisiae Az - 12 was isolated using «Plant/Fungi DNA Isolation Kit» companies Norgen Biotek Corp. (Canada) according to the manufacturer's protocol. The DNA concentration in the samples was determined using a fluorometer Qubit (Invitrogen, USA) according to the scale for dsDNA HS.

The universal primers of the yeast ITS region were used: ITS1 (5,-TCCGTAGGTGAACCTGCGG-3,) and ITS 2 (5,-TCCTCCGCTTATTGATATGC-3,). The amplification reaction mixture consisted of: 12.5 µl Q5® Hot Start High-Fidelity 2X Master Mix, 1,25 µl Forward primer (10 µM), 1,25 µl Reverse primer (10 µM), 1,5 µl DNA and 8,5 µl water. The total volume of the PCR mixture was 25 µl.

PCR with universal primers was carried out on an Eppendorf amplifier at the amplification mode: 94ºС - 30 sec; 55ºС - 1 min; 72ºС - 40 sec - 30 cycles in total; 72ºС - 10 min. The PCR products were stained and loaded onto a 1.2% agarose gel. Visualized in a UV transilluminator.

The sequencing reaction was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applide Biosystems) according to the manufacturer's instructions [BigDye® Terminator v3.1 Cycle Sequencing Kit Protocol Applied Biosystems USA], followed by separation of the fragments on a 3500 DNA Analyzer (Applied Biosystems). The sequencing results were processed using the SeqA program (Applied Biosystems). The obtained nucleotide sequences of the ITS region of fungal DNA were compared with the data from the Gene Bank database (www.ncbi.nih.gov) using the BLAST program. Phylogenetic analysis was performed using MEGA6 software. Nucleotide sequence alignment was performed using the ClustalW algorithm. The Neiighbor-Joining (NJ) method was used to build phylogenetic trees.

The DNA concentration according to the readings of the Quibit fluorometer was -60,8 ng/µl. As a result of amplification with ITS primers, a PCR product of about 550 bp was obtained (Figure 1).

Figure 1
PCR product of Saccharomyces cerevisiae Gl-8 and Saccharomyces cerevisiae Az-12 obtained with ITS primers Note: M - O'GeneRuler 1 kb DNA Ladder length marker.

The results of the analysis of the ITS gene sequences in the studied strains are presented in the form of phylogenetic trees built in the MEGA 6 program using the Neiighbor-Joining cluster method for calculating genetic distances.

The nucleotide sequence of the PCR product Saccharomyces cerevisiae Gl-8:

GGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTT

The degree of homology of the strain S. cerevisiae Gl-8 with the strain MH608341.1 Saccharomyces cerevisiae isolate extr03, (Figure 2).

Figure 2
The degree of homology of the strain Saccharomyces cerevisiae Gl-8 with the strain MH608341.1 Saccharomyces cerevisiae isolate extr03.

The degree of homology of the strain S. cerevisiae Gl-8 with the strain MH608341.1 Saccharomyces cerevisiae isolate extr03 составила 100%.

The nucleotide sequence of the strain Saccharomyces cerevisiae Az-12:

TTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTTGTTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTT

The degree of homology of the S. cerevisiae Az-12 strain with the S. cerevisiae isolate extr03 strain MH608341.1 was 99.65%, (Figure 3).

Figure 3
The degree of homology of the Saccharomyces cerevisiae Az-12 strain with the Saccharomyces cerevisiae isolate extr03 strain MH608341.1.

The genome of S. boulardii is so similar to Saccharomyces cerevisiae that they should be classified as conspecific (Edwards-Ingram et al., 2007). However, a single genome sample may not be enough to study the probiotic properties of the studied yeasts. Understanding the evolution and quantitative variation among Sb strains would require an entire sequencing, including complete genomes.

One of the most valuable properties of probiotic yeast is its antibacterial activity against pathogenic and opportunistic human microorganisms: E. coli, E. faecalis, P.aeruginosa, S. typhimurium and S. aureus. The inhibitory mechanisms of the yeast S. cerevisiae in relation to the above-listed bacteria are shown in a number of studies (Hatoum et al., 2012).

S.cerevisiae Az-12 strain isolated from pomegranate was a facultative aerobic, easily ferments glucose, fructose, sucrose, maltose, maltotriose, did not use galactose, consumes a small amount of pentose-arabinose, xylose and ribose, and used many simple compounds glycerin as a carbon source, as a result of the fermentation of sugars, it formed CO2 and ethyl alcohol. The optimal temperature range is 37±1°C, which was close to the temperature of the human body. The cells grow in the range from 5°C to 45°C. The optimal pH value of the medium was 3.5-5.5. It retains viability in the pH range from 1.2 to 10. It grows when the bile content in the medium is up to 3.0%.

S. cerevisiae Az-12 colonies on malt agar wort was small, smooth, and convex, with even edges. The average cell size was 5.0 × 6.4 microns. The shape of the cells was mostly rounded, (Figure 4). It was propagated by budding. It did not form a spore.

Figure 4
Yeast culture Saccharomyces cerevisiae Az-12 (from pomegranate juice).

Studies conducted to determine the action of the yeast S.cerevisiae Az-12 on pathogenic or opportunistic bacteria showed that this strain exhibits features of the probiotic culture of S.cerevisiae var. boulardi. A clear antagonism of yeast against bacteria was confirmed only for E.coli, P. aeruginosa, and S.s aureus. Consistent results were obtained for the S. cerevisiae Az-12 strain isolated from pomegranate growing in the Turkestan region. The inhibition zones are equal (12.8 ± 0.05) mm for E.coli; (13.5 ± 0.05) mm for S. aureus and (10.7 ± 0.05) mm for P. aeruginosa.

For the joint cultivation of yeast and pathogenic and opportunistic microorganisms, a modified medium was used, similar in content and consistency to the intestinal medium.

The study of the antibacterial activity of S.cerevisiae Az-12 was carried out in two variants. In the first variant, the growth of a monoculture in a modified medium was studied (Figure 5A).

Figure 5
Joint and separate cultivation of yeast and bacterial strains of human pathogens.

In the second variant, the growth of microorganisms was studied during the co-cultivation of yeast and a bacterial strain of human pathogens.

P. aeruginosa is one of the most common infectious agents, especially in immunocompromised individuals. The pathogenicity of P. aeruginosa is expressed by the presence of sufficient mobility and the ability to form toxins.

In the case of co-cultivation of P. aeruginosa strains with the yeast S. cerevisiae Az-12 in mixed cultures, a decrease in the number of bacterial cells was observed. A monoculture of P. aeruginosa in exponential phase has a maximum level of 7.7 log CFU • mL-1 after 24 hours. Subsequently, on the second day, there was a decrease in viable cells by 1.5 times. In a mixed culture with yeast, we found a 43% decrease in bacterial cells on the first day and almost 50% after 48 hours. This is evidence of the negative effects of yeast on P. aeruginosa. The development and growth of yeast S. cerevisiae Az-12 during co-cultivation with P.aeruginosa also decreases, but not so dramatically (Figure 5B).

Escherichia coli is a bacteria that occurs naturally in the human intestine. In most cases, E. coli strains are harmless, but some strains can cause food poisoning, especially if they are heavily contaminated.

In the modified medium, a stable growth of E. coli culture is observed on the first day, reaching a maximum 9.5 log units. Subsequently, due to a decrease in nutrients, they are reduced to 4.1 log units. When E.coli is co-cultured with the yeast Saccharomyces cerevisiae Az-12, there is a significant decrease in the number of viable E. coli cells to 3.4 log units on the second day. This suggests a significant suppressive effect of probiotic yeast on E. coli. It is necessary to note the negative impact of E. coli on the development of S.cerevisiae Az-12, as compared with a monoculture, their number decreases on the second day in a mixed culture by more than 1.8 times. The results of experiments with E.coli and S.cerevisiae Az-12 with separate and joint cultivation (Figure 5C).

The number of viable cells of S. aureus, S. cerevisiae Az-12 in separate and joint cultivation (Figure 5D). S.aureus is one of the most common microorganisms that cause diseases of the skin and mucous membranes of the upper respiratory tract. Up to 40% of the population are temporary or permanent carriers of this bacterium. At the same time, S. aureus can cause many diseases, from mild skin infections to deadly diseases, among which pneumonia ranks first.

The monoculture of S. aureus in a modified medium develops rapidly. The maximum growth of this culture reaches 8.1 log CFU mL -1. The stationary growth phase lasts 28 hours.

The probiotic yeast S. cerevisiae Az-12 strongly and negatively influenced the growth of S. aureus. Co-cultivation of S. cerevisiae Az-12 and S. aureus leads to a decrease in the causative agent of infections almost from the first hours of cultivation. At 32 hours of co-cultivation, the number of viable S. aureus cells was almost halved. The growth of the yeast S.cerevisiae Az-12 during co-cultivation in the first hours also decreased in comparison with the control. However, at 32 hours, there is a slight increase in the amount of the studied culture.

Despite the fact that there is some evidence of the antagonistic effect of yeast on human pathogens, the mechanism of its action is not clearly defined. In our study, we used scanning microscopy techniques to evaluate the adhesion of bacterial cells to the yeast probiotic cell wall. After co-cultivation, a 1 ml sample of the culture suspension containing S. cerevisiae Az-12 and S. aureus was taken. The probiotic strain S. cerevisiae Az-12 (Figure 6) and S. aureus were microscopically examined using a scanning electron microscope JSM-6490LM with Energy INCA 350 energy dispersive X-ray microanalysis sustem and HKL Basic system. Using the method of scanning microscopy, based on a subjective assessment of the relative position of the yeast cell and S. aureus, positive results were obtained confirming the adhesive ability of S. aureus to the surface of the yeast cell (Figure 7).

Figure 6
yeast Saccharomyces cerevisiae Az-12 (Magnification 5000 times).
Figure 7
Adhesion of Staphylococcus aureus to wall of the yeast Saccharomyces cerevisiae Az-12 (Magnification 5000 times).

Thus, an important initial event in bacterial pathogenesis is the adherence of bacteria through their surface organelles to the host intestinal cells. The use of S. cerevisiae Az-12 as a probiotic for humans, can counteract the adhesion of pathogens to host tissues by providing alternative sites of adhesion to enterobacteria and thus prevent infections. They can also eliminate pathogens from the gastrointestinal tract of infected patients by removing them from the body in a yeast-cell-bound state.

4. Conclusions

Currently, in the Republic of Kazakhstan, the epidemiological picture for the class and types of diseases of the digestive system remains disappointing (Kausova et al., 2019; Suleimenova and Kuatbayeva, 2014). Consumption of pomegranate juice improves food digestion (Tsang et al., 2012) and pomegranate extract containing volatile substances, anthocyanins (Jurga et al., 2021) has also been shown to reduce blood pressure, insulin resistance, and stress hormone levels (Stockton et al., 2015).

Non-dairy probiotic products can be used by consumers of all food groups, including vegans and vegetarians, as well as consumers with dairy allergies. In this regard, the use of means of correction of the intestinal microbiota (probiotics, prebiotics, synbiotics) in the treatment of inflammatory bowel diseases is attractive and can serve as a worthy alternative to antibiotics (Avalueva et al., 2010). If the drink is prepared using materials of plant origin, then their oligosaccharides and fiber act as prebiotics. Both components (probiotic strain(s) and prebiotic substrate) exist in a synergistic relationship in the product and contribute to several nutritional and gut health benefits (Divakar and Poonam, 2022).

The strain of S. cerevisiae Az-12 isolated from pomegranate. The degree of homology of the Saccharomyces cerevisiae Az-12 strain with the S. cerevisiae isolate extr03 strain MH608341.1 was 99.65%. S. cerevisiae Az-12 caused a statistically significant reduction of pathogenic bacteria. The inhibition zones are (12.8 ± 0.05) for E. coli; (13.5 ± 0.05) mm for S.aureus and (10.7 ± 0.05) for P. aeruginosa. The use of S. cerevisiae Az-12 can limit bacterial invasiveness and infections caused by human pathogens due to the adhesive surface of the yeast, the ability to excrete from the gastrointestinal tract in a bound state. S. cerevisiae Az-12 is registered as a non-pathogenic microorganism in the Republican Collection of Microorganisms, Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan.

Summarizing the results of our study showed that Saccharomyces cerevisiae-Az-12 has the properties of probiotic yeast, in particular, antibacterial activity against pathogenic and opportunistic human microorganisms and shows features similar to other registered probiotic yeasts.

Acknowledgements

The research was carried out with the financial support of the Ministry of Education and Science of the Republic of Kazakhstan, under the project AP09563292 "Development of technology for the extraction of biologically active substances from plant raw materials with a multi-enzyme preparation, followed by enrichment of fruit juices and fermented beverages".

References

  • ABILKAYIR, N.A., 2019. Population health as a major of quality of life. News of the National Academy of Sciences of the Republic of Kazakhstan, vol. 2, no. 332, pp. 20-27. http://dx.doi.org/10.32014/2019.2519-1629.16
    » http://dx.doi.org/10.32014/2019.2519-1629.16
  • AGARBATI, A., CANONICO, L., MARINI, E., ZANNINI, E., CIANI, M. and COMITINI, F., 2020. Potential Probiotic yeasts sourced from natural environmental and Spontaneous processed foods. Foods, vol. 9, no. 3, pp. 287. http://dx.doi.org/10.3390/foods9030287 PMid:32143376.
    » http://dx.doi.org/10.3390/foods9030287
  • AL-MUAMMAR, M.N. and KHAN, F., 2012. Obesity: the preventive role of the pomegranate (Punica granatum). Nutrition (Burbank, Los Angeles County, Calif.), vol. 28, no. 6, pp. 595-604. http://dx.doi.org/10.1016/j.nut.2011.11.013 PMid:22342388.
    » http://dx.doi.org/10.1016/j.nut.2011.11.013
  • ALQOSAIBI, A.I., MAHMOUD, A., KOTB, E., HUANGI, Y., AL-DHUAYAN, I.S., ALHAZMI, S., BAHLOU, A.A., OKASHA, S.T., OTAIBI, H., ALYAMI, N. and LOUIS, E. 2022. Saccharomyces cerevisiaeOS303 expression of an alkaline protease from a newly isolatedBacillus subtilisD9. Brazilian Journal of Biology = Revista Brasileira de Biologia, vol. 82, e262214. https://doi.org/10.1590/1519-6984.262214
    » https://doi.org/10.1590/1519-6984.262214
  • AVALUEVA, E. B., USPENSKY, YU. P., TKACHENKO, E. I., SITKIN, S. I., 2010. Usage of Saccharomyces boulardii in the treatment of patients with inflammatory bowel diseases (results of a clinical study). Experimental and Clinical Gastroenterology, no. 7, pp. 103-111.
  • BEAUGERIE, L. and PETIT, J.C., 2004. Antibiotic-associated diarrhea. Best Practice & Research. Clinical Gastroenterology, vol. 18, no. 2, pp. 337-352. http://dx.doi.org/10.1016/j.bpg.2003.10.002 PMid:15123074.
    » http://dx.doi.org/10.1016/j.bpg.2003.10.002
  • CALÍN-SÁNCHEZ, Á., FIGIEL, A., HERNÁNDEZ, F., MELGAREJO, P., LECH, K. and CARBONELL-BARRACHINA, Á.A., 2013. Chemical composition, antioxidant capacity, and sensory quality of pomegranate (Punica granatum L.) arils and rind as affected by drying method. Food and Bioprocess Technology, vol. 6, no. 6, pp. 1644-1654. http://dx.doi.org/10.1007/s11947-012-0790-0
    » http://dx.doi.org/10.1007/s11947-012-0790-0
  • CANO-LAMADRID, M., LECH, K., MICHALSKA, A., WASILEWSKA, M., FIGIEL, A., WOJDYŁO, A. and CARBONELL-BARRACHINA, Á.A., 2017. Influence of osmotic dehydration pre-treatment and combined drying method on physico-chemical and sensory properties of pomegranate arils, cultivar Mollar de Elche. Food Chemistry, vol. 232, pp. 306-315. http://dx.doi.org/10.1016/j.foodchem.2017.04.033 PMid:28490079.
    » http://dx.doi.org/10.1016/j.foodchem.2017.04.033
  • CHIGAEVA, A.V. and DUDIKOVA, G. N., 2017. Scientific review: theoretical and practical aspects of designing probiotics. Biological Sciences, no. 2, pp. 157-166.
  • CHRISTENSEN, L.F., GARCIA-BEJAR, B., BANG-BERTHELSEN, C.H. and HANSEN, E.B., 2022. Extracellular microbial proteases with specificity for plant proteins in food fermentation. International Journal of Food Microbiology, vol. 381, pp. 109889. http://dx.doi.org/10.1016/j.ijfoodmicro.2022.109889 PMid:36057216.
    » http://dx.doi.org/10.1016/j.ijfoodmicro.2022.109889
  • CZERUCKA, D., PICHE, T. and RAMPAL, P., 2007. Review article: yeasts as probiotics - Saccharomyces boulardii. Alimentary Pharmacology & Therapeutics, vol. 26, no. 6, pp. 767-778. http://dx.doi.org/10.1111/j.1365-2036.2007.03442.x PMid:17767461.
    » http://dx.doi.org/10.1111/j.1365-2036.2007.03442.x
  • DANESI, F. and FERGUSON, L.R., 2017. Could pomegranate juice help in the control of Inflammatory diseases? Nutrients, vol. 9, no. 9, pp. 958. http://dx.doi.org/10.3390/nu9090958 PMid:28867799.
    » http://dx.doi.org/10.3390/nu9090958
  • DIVAKAR, D. and POONAM, S.N., 2022. Nutrition and Health through the use of probiotic strains in fermentation to produce non-dairy functional beverage products supporting gut microbiota. Foods, vol. 11, no. 18, pp. 2760. http://dx.doi.org/10.3390/foods11182760 PMid:36140888.
    » http://dx.doi.org/10.3390/foods11182760
  • EDWARDS-INGRAM, L., GITSHAM, P., BURTON, N., WARHURST, G., CLARKE, I., HOYLE, D., OLIVER, S.G. and STATEVA, L., 2007. Genotypic and physiological characterization of Saccharomyces boulardii, the probiotic strain of Saccharomyces cerevisiae. Applied and Environmental Microbiology, vol. 73, no. 8, pp. 2458-2467. http://dx.doi.org/10.1128/AEM.02201-06 PMid:17293506.
    » http://dx.doi.org/10.1128/AEM.02201-06
  • ERKMEN, O. and BOZOGLU, T.F., 2016a. Food microbiology: principles into practice Basic principles of food fermentation. Chichester, UK: Wiley and Sons, vol. 2: Microorganisms in Food Preservation and Processing, pp. 228-252. http://dx.doi.org/10.1002/9781119237860.ch39
    » http://dx.doi.org/10.1002/9781119237860.ch39
  • ERKMEN, O. and BOZOGLU, T.F., 2016b. Food microbiology: principles into practice Microbial metabolism of food components. Chichester, UK: Wiley and Sons, vol. 2: Microorganisms in Food Preservation and Processing, pp. 217-227. http://dx.doi.org/10.1002/9781119237860.ch38
    » http://dx.doi.org/10.1002/9781119237860.ch38
  • FENG, R., CHEN, L. and CHEN, K., 2018. Fermentation trip: amazing microbes, amazing metabolisms. Annals of Microbiology, vol. 68, no. 11, pp. 717-729. http://dx.doi.org/10.1007/s13213-018-1384-5
    » http://dx.doi.org/10.1007/s13213-018-1384-5
  • GIL, M.I., TOMÁS-BARBERÁN, F.A., HESS-PIERCE, B., HOLCROFT, D.M. and KADER, A.A., 2000. Antioxidant activity of pomegranate juice and its relationship with phenolic composition and processing. Journal of Agricultural and Food Chemistry, vol. 48, no. 10, pp. 4581-4589. http://dx.doi.org/10.1021/jf000404a PMid:11052704.
    » http://dx.doi.org/10.1021/jf000404a
  • GUSLANDI, M., MEZZI, G. and TESTONI, P.A., 2003. A pilot trial of Saccharomyces boulardii in ulcerative colitisi. European Journal of Gastroenterology & Hepatology, vol. 15, no. 6, pp. 697-698. http://dx.doi.org/10.1097/00042737-200306000-00017 PMid:12840682.
    » http://dx.doi.org/10.1097/00042737-200306000-00017
  • GUSLANDI, M., MEZZI, G., SORGHI, M. and TESTONI, P.A., 2000. Saccharomyces boulardii in Maintenance Treatment of Crohn’s Disease. Digestive Diseases and Sciences, vol. 45, no. 7, pp. 1462-1464. http://dx.doi.org/10.1023/A:1005588911207 PMid:10961730.
    » http://dx.doi.org/10.1023/A:1005588911207
  • HATOUM, R., LABRIE, S. and FLISS, I., 2012. Antimicrobial and probiotic properties of yeasts: from fundamental to novel applications. Frontiers in Microbiology. Frontiers in Microbiology, vol. 3, pp. 1-12. http://dx.doi.org/10.3389/fmicb.2012.00421 PMid:23267352.
    » http://dx.doi.org/10.3389/fmicb.2012.00421
  • JURGA, B., GAMZE, G., KOUAME, F.O., HASIM, K. and SERKAN, S., 2021. Elucidation of Volatiles, Anthocyanins, Antioxidant and Sensory Properties of cv. Caner Pomegranate (Punica granatum L.) Juices Produced from Three Juice Extraction Methods. Foods, vol. 10, no. 7, pp. 1497. http://dx.doi.org/10.3390/foods10071497 PMid:34203382.
    » http://dx.doi.org/10.3390/foods10071497
  • KAPLAN, M., HAYEK, T., RAZ, A., COLEMAN, R., DORNFELD, L., VAYA, J. and AVIRAM, M., 2001. Pomegranate juice supplementation to atherosclerotic mice reduces macrophage lipid peroxidation, cellular cholesterol accumulation and development of atherosclerosis. The Journal of Nutrition, vol. 131, no. 8, pp. 2082-2089. http://dx.doi.org/10.1093/jn/131.8.2082 PMid:11481398.
    » http://dx.doi.org/10.1093/jn/131.8.2082
  • KAUSOVA, G.K., BULESHOV, M.A., UTEULIYEV, E.S. and ZHAKSYLYK, A.A., 2019. Analysis of the incidence of digestive organs among the population in Kazakhstan. Bulletin of KazNMU, vol. 4, pp. 300-302.
  • KHATRI, I., AKHTAR, A., KAUR, K., TOMAR, R., PRASAD, G.S., RAMYA, T.N.C. and SUBRAMANIAN, S., 2013. Gleaning evolutionary insights from the genome sequence of a probiotic yeast Saccharomyces boulardii. Gut Pathogens, vol. 5, no. 1, pp. 30. http://dx.doi.org/10.1186/1757-4749-5-30 PMid:24148866.
    » http://dx.doi.org/10.1186/1757-4749-5-30
  • MARTINS, F.S., NARDI, R.M.D., ARANTES, R.M.E., ROSA, C.A., NEVES, M.J. and NICOLI, J.R., 2005. Screening of yeasts as probiotic based on capacities to colonize the gastrointestinal tract and to protect against enteropathogen challenge in mice. The Journal of General and Applied Microbiology, vol. 51, no. 2, pp. 83-92. http://dx.doi.org/10.2323/jgam.51.83 PMid:15942869.
    » http://dx.doi.org/10.2323/jgam.51.83
  • MCFARLAND, L.V., 2006. Meta-analysis of Probiotics for the prevention of antibiotic associated diarrhea and the treatment of Clostridium difficile disease. The American Journal of Gastroenterology, vol. 101, no. 4, pp. 812-822. http://dx.doi.org/10.1111/j.1572-0241.2006.00465.x PMid:16635227.
    » http://dx.doi.org/10.1111/j.1572-0241.2006.00465.x
  • MCFARLIN, B.K., STROHACKER, K.A. and KUEHT, M.L., 2009. Pomegranate seed oil consumption during a period of high-fat feeding reduces weight gain and reduces type 2 diabetes risk in CD-1 mice. British Journal of Nutrition, vol. 102, no. 1, pp. 54-59. http://dx.doi.org/10.1017/S0007114508159001 PMid:19079947.
    » http://dx.doi.org/10.1017/S0007114508159001
  • PESSOA, V.A., SOARES, L.B.N., SILVA, G.L., VASCONCELOS, A.S., SILVA, J.F., FARIÑA, J.I., OLIVEIRA-JUNIOR, S.D., SALES-CAMPOS, C. and CHEVREUIL, L.R., 2023. Production of mycelial biomass, proteases and protease inhibitors by Ganoderma lucidum under different submerged fermentation conditions. Brazilian Journal of Biology = Revista Brasileira de Biologia, vol. 83, pp. e270316. http://dx.doi.org/10.1590/1519-6984.270316 PMid:37162094.
    » http://dx.doi.org/10.1590/1519-6984.270316
  • PONTIER-BRES, R., MUNRO, P., BOYER, L., ANTY, R., IMBERT, V., TERCIOLO, C., ANDRÉ, F., RAMPAL, P., LEMICHEZ, E., PEYRON, J.F. and CZERUCKA, D., 2014. Saccharomyces boulardii Modifies Salmonella Typhimurium Traffic and Host Immune Responses along the Intestinal Tract. PLoS One, vol. 9, no. 8, pp. 1-12. http://dx.doi.org/10.1371/journal.pone.0103069 PMid:25118595.
    » http://dx.doi.org/10.1371/journal.pone.0103069
  • RAJKOWSKA, K., KUNICKA-STYCZYŃSKA, A. and RYGALA, A., 2012. Probiotic Activity of Saccharomyces cerevisiae var. boulardii Against Human Pathogens. Food Technology and Biotechnology, vol. 50, pp. 230-236.
  • RINALDI, M., CALIGIANI, A., BORGESE, R., PALLA, G., BARBANTI, D. and MASSINI, R., 2013. The effect of fruit processing and enzymatic treatments on pomegranate juice composition, antioxidant activity and polyphenols content. Lebensmittel-Wissenschaft + Technologie, vol. 50, no. 1, pp. 355-359. http://dx.doi.org/10.1016/j.lwt.2013.02.015
    » http://dx.doi.org/10.1016/j.lwt.2013.02.015
  • RODRIGUES, A.C., CARA, D.C., FRETEZ, S.H., CUNHA, F.Q., VIEIRA, E.C., NICOLI, J.R. and VIEIRA, L.Q., 2000. Saccharomyces boulardii stimulates slgA production and the phagocytic system of gnotobiotic mice. Journal of Applied Microbiology, vol. 89, no. 3, pp. 404-414. http://dx.doi.org/10.1046/j.1365-2672.2000.01128.x PMid:11021572.
    » http://dx.doi.org/10.1046/j.1365-2672.2000.01128.x
  • SAPARBEKOVA, A.A., LATIF, A.S. and AKHMEDOVA, Z.R., 2019. Selection of active yeast strains for fermented beverages from plant materials. News of the National Academy of Science of the Republic of Kazakhstan, vol. 3, no. 51, pp. 73-79.
  • SHEEHAN, V.M., ROSS, P. and FITZGERALD, G.F., 2007. Assessing the acid tolerance and the techn ological robustness of probiotic cultures for fortification in fruit juices. Innovative Food Science & Emerging Technologies, vol. 8, no. 2, pp. 279-284. http://dx.doi.org/10.1016/j.ifset.2007.01.007
    » http://dx.doi.org/10.1016/j.ifset.2007.01.007
  • SITI, M.M., LEE, S.C., HESHAM, A.E., FADZILAH, A.A.M. and ROSLINDA, A.M., 2016. Review on Fruit Juice Probiotication: pomegranate. Current Nutrition and Food Science, vol. 12, pp. 4-11. http://dx.doi.org/10.2174/1573401311666151015213508
    » http://dx.doi.org/10.2174/1573401311666151015213508
  • STANISZEWSKI, A. and KORDOWSKA-WIATER, M., 2021. Probiotic and potentially probiotic yeasts: characteristics and food application. Foods, vol. 10, no. 6, pp. 1306. http://dx.doi.org/10.3390/foods10061306 PMid:34200217.
    » http://dx.doi.org/10.3390/foods10061306
  • STOCKTON, A. and AL-DUJAILI, E.A.S., 2022. Effect of pomegranate extract consumption on satiety parameters in healthy volunteers: a preliminary randomized study. Foods, vol. 11, no. 17, pp. 2639. http://dx.doi.org/10.3390/foods11172639 PMid:36076824.
    » http://dx.doi.org/10.3390/foods11172639
  • STOCKTON, A., AL-DUJAILI, E.A.S., MCDOUGALL, G., DAVIDSON, I., DRUMMOND, S. and WYNESS, L., 2015. Effect of pomegranate extract consumption on cardiovascular disease risk factors, stress hormones and quality of lifeinhumanvolunteers: an exploratory randomised, double-blind, placebo-controlled trial. EC Nutrition, vol. 2, no. 4, pp. 396-411.
  • SULEIMENOVA, Z. I. and KUATBAYEVA, A.M., 2014. The situation of acute intestinal infections in the Republic of Kazakhstan. Bulletin of the Almaty State Institute of Advanced Medical Training, no. 1, pp. 98-101.
  • TSANG, C., SMAIL, N.F., ALMOOSAWI, S., DAVIDSON, I. and AL-DUJAILI, E.A., 2012. Intake of polyphenol-rich pomegranate pure juice influences urinary glucocorticoids, blood pressure and homeostasis model assessment of insulin resistance in human volunteers. Journal of Nutritional Science, vol. 1, pp. e9. http://dx.doi.org/10.1017/jns.2012.10 PMid:25191556.
    » http://dx.doi.org/10.1017/jns.2012.10
  • WENLI, S., MOHAMAD, H.S. and MIN, L., 2022. Research progress of fermented functional foods and protein factory-microbial fermentation technology. Fermentation (Basel, Switzerland), vol. 8, no. 12, pp. 688. http://dx.doi.org/10.3390/fermentation8120688
    » http://dx.doi.org/10.3390/fermentation8120688
  • WILLAERT, R.G., 2017. Yeast biotechnology. Fermentation (Basel, Switzerland), vol. 3, no. 1, pp. 6. http://dx.doi.org/10.3390/fermentation3010006
    » http://dx.doi.org/10.3390/fermentation3010006

Publication Dates

  • Publication in this collection
    11 Aug 2023
  • Date of issue
    2023

History

  • Received
    13 Feb 2023
  • Accepted
    04 June 2023
location_on
Instituto Internacional de Ecologia R. Bento Carlos, 750, 13560-660 São Carlos SP - Brasil, Tel. e Fax: (55 16) 3362-5400 - São Carlos - SP - Brazil
E-mail: bjb@bjb.com.br
rss_feed Acompanhe os números deste periódico no seu leitor de RSS
Ir para o topo Reportar erro