Oxidative stress biomarker and gene regulation in Schizolobium parahyba var. amazonicum (Huber ex Ducke) Barneby (Paricá) under different cadmium concentrations and 24-epibrassinolide

Biomarcador de estresse oxidativo e regulação gênica em Schizolobium parahyba var. amazonicum (Huber ex Ducke) Barneby (Paricá) sob diferentes concentrações de cádmio e 24-epibrassinolídeo

Abstract

The study aims to investigate the expression of the AQP TIP1-1, HMA4, and P5CR genes in seedlings of Paricá (Schizolobium parahyba var. amazonicum (Huber ex Ducke) Barneby) subjected to oxidative stress induced by CdCl2, with the exogenous application of 24-EBL. This species, native to the Amazon, exhibits potential for cadmium bioaccumulation, although gaps remain regarding the genetic and hormonal mechanisms involved. The experiment was conducted in a growth chamber at the Laboratory for Studies on the Biodiversity of Higher Plants (EBPS) of the Federal Rural University of Amazonia (UFRA), Belém Campus, Pará, following a completely randomized design (CRD) in a 4×3 factorial scheme, totaling 60 experimental units, with four CdCl₂ treatments (0, 50, 100, and 150 µM) and three 24-epibrassinolide doses (0, 20, and 40 nM). Data were subjected to analysis of variance (ANOVA, p < 0.05), and differences among treatments were evaluated using Tukey’s test (p < 0.05). The results indicate that, despite the increase in MDA levels caused by Cd in Paricá seedlings, even with the application of 24-EBL, there was a positive regulation of the expression of the AQP TIP1-1, HMA4, and P5CR genes, particularly in the roots at a dosage of 40 nM of 24-EBL. This finding suggests that 24-EBL exerts a positive effect on the modulation of these genes under Cd-induced oxidative stress, both in the roots and in the shoot, indicating the activation of a possible defense and adaptation mechanism in response to the toxicity of this heavy metal.

Keywords:
phytoremediation; molecular biology; phytotoxicity; 24-epiBL

Resumo

O estudo teve como objetivo investigar a expressão dos genes AQP TIP1-1, HMA4 e P5CR em plântulas de Paricá (Schizolobium parahyba var. amazonicum (Huber ex Ducke) Barneby) submetidas a estresse oxidativo induzido por CdCl₂, com a aplicação exógena de 24-EBL. Essa espécie, nativa da Amazônia, apresenta potencial para bioacumulação de cádmio, embora ainda existam lacunas quanto aos mecanismos genéticos e hormonais envolvidos. O experimento foi conduzido em câmara de crescimento no Laboratório de Estudos da Biodiversidade de Plantas Superiores (EBPS) da Universidade Federal Rural da Amazônia (UFRA), Campus de Belém, Pará, seguindo um delineamento inteiramente casualizado (DIC) em esquema fatorial 4×3, totalizando 60 unidades experimentais, com quatro tratamentos de CdCl₂ (0, 50, 100 e 150 µM) e três doses de 24-epibrassinolídeo (0, 20 e 40 nM). Os dados foram submetidos à análise de variância (ANOVA, p < 0,05) e as diferenças entre os tratamentos foram avaliadas pelo teste de Tukey (p < 0,05). Os resultados indicam que, apesar do aumento nos níveis de MDA causado pelo Cd nas mudas de Paricá, mesmo com a aplicação de 24-EBL, houve regulação positiva da expressão dos genes AQP TIP1-1, HMA4 e P5CR, principalmente nas raízes na dosagem de 40 nM de 24-EBL. Esse achado sugere que o 24-EBL exerce efeito positivo na modulação desses genes sob estresse oxidativo induzido por Cd, tanto nas raízes quanto na parte aérea, indicando a ativação de um possível mecanismo de defesa e adaptação em resposta à toxicidade desse metal pesado.

Palavras-chave:
fitorremediação; biologia molecular; fitotoxicidade; 24-epiBL

1. Introduction

With the intensification of anthropogenic activities, such as minings and industrialization, there is a release of heavy metals into the environment, including mercury (Hg), arsenic (As), and cadmium (Cd), which contaminate soil and water resources, causing significant impacts on terrestrial and aquatic ecosystems (Shi et al., 2019; Ali et al. 2019; Balali-mood et al. 2021; Rashid et al., 2023). Cd is a heavy metal known for its toxicity; it does not naturally occur in its pure state and has physical properties similar to those of zinc (Ozyigit and Genc, 2020; Bastos et al., 2021). This metal, notable for its malleability and toxicity, often appears as a by-product of copper (Cu) and lead (Pb) extraction, and is easily cut due to its soft texture (Drabek et al., 2020). Major sources of contamination include batteries, pigments, metal alloys, and non-ferrous metal smelting (Mikhailenko et al., 2020).

In plants, although Cd is not an essential element, it shows affinity for sulfhydryl groups and thiol groups in proteins, allowing its circulation within plant tissues and altering the conformation of molecules, rendering them non-functional (Mahajan and Kaushal, 2018). Moreover, Cd toxicity affects the integrity of the cell membrane, increasing the content of malondialdehyde (MDA), an indicator of oxidative damage (Waheed et al., 2022). Oxidative stress results from the accumulation of reactive oxygen species, such as superoxide ions, hydrogen peroxide (H₂O₂), and hydroxyl radicals (OH) (Sieprawska et al., 2024). These substances promote the conversion of free fatty acids into harmful lipid peroxides, thereby affecting biological membranes (Cordiano et al., 2023). Cd ions also possess carcinogenic and mutagenic properties that cause DNA damage in plants, increasing the risk of neoplasia (Haider et al., 2021). At high levels, Cd negatively interferes with cell cycle control, leading to uncontrolled replication and tumor formation (Gu et al., 2021; Quadros et al., 2021; Zabka et al., 2021). Cd disrupts signaling processes and genetic regulation, affecting plant development and growth (Genchi et al., 2020).

Recent studies have shown that hormonal application can help reduce the toxic effects of Cd in plants (Bucker-Neto et al., 2017; Munawar et al., 2025). These hormones, known as phytohormones, act as chemical signals that trigger rapid stress responses (Ekinci et al., 2024). Although present in minimal amounts, they are capable of controlling various physiological functions by binding to specific receptors (Kebert et al., 2022). Their chemical structures are diverse, allowing both the activation and inhibition of processes in plants (Saini et al., 2021).

Specifically, the hormone 24-epibrassinolide (24-EBL), which belongs to the class of brassinosteroids (BRs), acts in cell division and elongation, and also influences processes such as germination, flowering, and resistance to environmental stresses (Alam et al., 2020; Alhammad et al., 2023; Kumar et al., 2023). In seedlings of Schizolobium parahyba var. amazonicum, a species endemic to the Amazon biome, subjected to chromium (Cr) stress, it has been observed that 24-EBL stimulates antioxidant defense mechanisms, as evidenced by increased enzymatic activity in plants treated with this phytohormone (Bastos et al., 2024).

Molecular studies indicate a close relationship between 24-EBL and the regulation of gene expression related to metabolism and biological defenses (Liu et al., 2023). This interaction between genes and 24-EBL helps plants develop advanced mechanisms for DNA repair and cellular detoxification, regulated by specific genes, as a defense against damage caused by Cd (Dutta et al., 2018; Dangl and Jones, 2019; Raza et al., 2020). The proper expression of these genes is crucial for maintaining cellular integrity (Pramanik et al., 2021).

The advancement of omics sciences has enabled a deeper understanding of hormonal influences and the mechanisms of plant resistance to heavy metals (El-Sappah et al., 2024). The difference in Cd concentration between roots and aerial parts is linked to its transport, affecting the ionic balance of cells (Ahmed et al., 2021). Osmotic stress caused by Cd²⁺ can modulate genes related to biological defense, such as moleculares regulators involved in the uptake, transport, detoxification, and tolerance of Cd in plants (Afzal et al., 2016; Anwar et al., 2018; Shaari et al., 2024). In this context, the selection of the AQP TIP1-1 gene is based on its role in regulating water flux and osmotic adjustment under water and ionic stress. The HMA4 gene is associated with the transport and compartmentalization of Cd²⁺, thereby reducing its cellular toxicity. Meanwhile, P5CR participates in proline biosynthesis, contributing to the mitigation of oxidative stress and cellular protection.

Despite the relevance of these mechanisms, studies addressing genetic regulation, cellular repair processes, and cadmium mobilization in plant species from the Amazon biome remain scarce. Therefore, the present study aims to evaluate the expression levels of the AQP TIP1-1, HMA4, and P5CR genes during the exogenous application of 24-epibrassinolide (24-EBL) in seedlings of Schizolobium parahyba var. amazonicum (Paricá) subjected to oxidative stress under different CdCl₂ concentrations.

2. Material and Methods

2.1. Plant material and growing conditions

The experiment was conducted from December 14 to 23, 2022, in a growth chamber at the Laboratory for Studies of Biodiversity in Higher Plants (EBPS), located at the Institute of Agricultural Sciences (ICA) of the Federal Rural University of the Amazon (UFRA), Belém Campus, Pará. The seeds were provided by the Seed Laboratory (LABSEM), UFRA, Belém Campus, totaling 600 seeds. In the initial stages of seedling production of Paricá (Schizolobium parahyba var. amazonicum (Huber ex Ducke) Barneby), the seeds were scarified using sandpaper no 80 and soaked in a solution containing 24-EBL (24-epibrassinolide) and deionized water (control) for 24 hours to help break dormancy. Immediately afterward, the seeds were sown in pots containing a substrate of sand washed in running water, autoclaved, and dried in an oven at 80°C (Nogueira et al., 2022).

2.2. Experimental design

The experimental design was completely randomized (DIC), in a 4x3 factorial scheme, with 12 treatments divided between 4 doses of CdCl₂ (0 µM, 50 µM, 100 µM and 150 µM) and 3 of brassinosteroids in the form of 24-epibrassinolide (0, 20 and 40nM of EBL) in 5 replicates per pot with 15 plants per pot.

2.3. Analysis of malondialdehyde (MDA) levels

The evaluation of lipid peroxidation was performed at the EBPS Laboratory and was estimated by measuring the amount of malondialdehyde (MDA) produced by the thiobarbituric acid reactive substances (TBARS) assay. Initially, 0.2 g of fresh leaf and root samples were weighed for tissue disruption in liquid nitrogen (N₂) using sterile pistils autoclaved at 80°C. The ground samples were homogenized in 1.5 mL of trichloroacetic acid (TCA), transferred to 2 mL Eppendorf tubes, and centrifuged at 12000 rpm for 20 minutes at 4°C. Then, 2 mL of 0.5% TBARS in 20% TCA were added to 5 μL of the supernatant and incubated in a water bath at 95°C for 60 minutes. The reaction was stopped on ice, followed by centrifugation at 10,000 rpm for 5 minutes at 4°C. The absorbance of the supernatant was measured at 532 and 660 nm. After subtracting the non-specific absorbance at 600 nm, the MDA concentration (μmol g⁻¹ FW) was determined using an extinction coefficient of 155 mM⁻¹ cm⁻¹ (Heath and Packer, 1968).

2.4. Gene expression

To initiate the molecular analyses, total RNA was extracted from the seedlings at the EBPS Laboratory, located on the UFRA campus. Initially, samples of seedlings subjected to the treatments (CdCl₂ × 24-EBL) and the control were separated. A total of 5 mg of fresh leaflets and roots were collected and placed in Eppendorf tubes containing 2 mL of a homemade RNAlater solution for subsequent storage in an ultra-freezer at -80°C until RNA extraction could begin. For RNA extraction, the TRIzol® reagent (Life Technologies) was used, following the manufacturer’s instructions. To preserve the genetic material, liquid nitrogen (N₂) was employed, followed by tissue disruption using sterile pistils autoclaved beforehand.

2.5. Quantification and purity of RNA samples

The assessment of RNA purity and quantification was carried out at the Laboratory of Applied Genetics (LGA), located on the UFRA campus, using a Biodrop Duo UV/Vis spectrophotometer. Subsequently, the purity of the samples was calculated by determining the ratio of absorbance measured at 260 and 280 nm (260/280 ratio). Results close to 1.8 were considered to indicate an acceptable level of purity. Afterward, the samples were diluted and adjusted to a concentration of 50 ng/μL and treated with DNase I, RNase-free (Thermo Scientific), following the manufacturer’s instructions.

2.6. Real-time qPCR molecular analysis

The qRT-PCR analyses were performed using the one-step method at the Serology and Molecular Biology Laboratory, UFRA Campus, Belém-PA. The samples were standardized in duplicate along with the genes listed in Table 1. To amplify a single product, the samples were adjusted to a final volume of 10 μL, containing 1x Power SYBR® Green RNA-to-CT™ One-Step Kit (Applied Biosystems, Foster City, CA, USA), 0.03 μL of reverse transcriptase, 4.4 μL of ultrapure water, 1 μL of RNA, and 0.36 μL of forward and reverse primer pairs (Table 1). All reactions were performed on a CFX96 Touch™ Real-Time Detection System thermal cycler (Bio-Rad, Hercules, CA, USA), following the protocol recommended by the kit manufacturer. Gene expression was estimated using the 2^-ΔΔCT method, with the actin gene used as a reference to normalize the target genes in this study.

Table 1
Oligonucleotide sequence for gene expression analysis in the leaves and roots of S. parahyba var. amazonicum for primer sequences using the qRT – PCR technique.

Gene	Primers	GenBank
AQP TIP1-1	F GTCACCTTCGGAGCCTTCAT R GGAGCAAGCAAGCAATGGTC	ID: 114732860
HMA4	F GCCAATGAACCCTCAGTCTCA R TGCTGACACCGTAACAAAAGT	ID: 114716322
P5CR	F TTCACCTTCACGCCTTCCTC R CTTGGCTGCTCTGCTACAGT	ID: 106752544
ACTIN	F GAAGCACCTCTCAACCCCAA R GGAAAGGACCGCCTGGATAG	ID: 14763233

• AQP TIP1-1 (Aquaporin Tonoplast Intrinsic Protein 1-1), HMA4 (Heavy Metal ATPase 4), P5CR (Pyrroline-5-Carboxylate Reductase) and Actin (Actin). Source: The Authors (2025).

2.7. Statistical analysis

The data obtained were subjected to statistical analysis using analysis of variance (ANOVA) in the R software, version 4.2.1. Means were compared using Tukey's test at a 5% probability level. Graphs were generated using R Studio software, version 1.3.1093, with the ggplot2 package and the “RColorBrewer” function.

3. Results

3.1. Influence of Cd and 24-EBL on the regulation of malondialdehydes (MDA)

Overall, the levels of the lipid peroxidation byproduct were observed with greater severity in the roots of seedlings under the endogenous effect of 24-EBL (Figure 1b), showing a significant difference (p < 0.05) as CdCl₂ concentrations increased (50 µM, 100 µM, and 150 µM). However, in the shoot extracts, the opposite was observed, with no statistical difference (p < 0.05) at CdCl₂ concentrations of 50 and 100 µM when compared to the treatment with 0 µM CdCl₂ and 24-EBL (Figure 1a). The 150 µM CdCl₂ dosage was the only one that showed a higher level of toxicity and cellular damage, indicated by elevated MDA production in both root (Figure 1b) and leaf (Figure 1a) samples, with high statistical significance (p < 0.05) compared to the samples without 24-EBL treatment.

Figure 1
Effect of CdCl₂ (0 µM, 50 µM, 100 µM, and 150 µM) and 24-EBL (0 nM, 20 nM, and 40 nM) on malondialdehyde (MDA) concentrations in the aerial (a) and root (b) structures of Schizolobium parahyba var. amazonicum (Huber ex Ducke) Barneby (PARICÁ). Caption: Lowercase letters indicate statistically significant differences among CdCl₂ treatments (p < 0.05) based on Tukey’s test; uppercase letters indicate statistically significant differences among 24-EBL treatments (p < 0.05) based on Tukey’s test.

In plants under the influence of 24-EBL (20 and 40 nM), specific responses were observed when exposed to a concentration of 50 µM CdCl₂, with a significant negative difference (p < 0.05) in the leaf blades (Figure 1a) and roots (Figure 1b) of Paricá seedlings, indicating early mitigating effects against MDA accumulation. However, a significant increase in oxidative stress levels was observed, as evidenced by the elevated MDA concentrations in plants exposed to 100 µM and 150 µM CdCl₂, even under 24-EBL treatment (20 and 40 nM). These changes showed statistically significant variations (p < 0.05), as shown in Figures 11b.

In summary, the highest concentration of oxidative stress markers (MDA) was observed in the roots of plants with no 24-EBL application under various CdCl₂ doses (50 µM, 100 µM, and 150 µM), with a probability of error below 5% compared to the control. However, stress-mitigating effects were observed only in plants exposed to 50 µM of CdCl2 under different 24-EBL applications (0, 20, and 40 nM), showing a significant negative difference (p < 0.05), indicating the first signs of MDA reduction. The phytotoxic effects caused by Cd2+ were exclusively observed at 100 µM and 150 µM CdCl₂ doses, regardless of 24-EBL application (0, 20, and 40 nM), with statistically significant variation (p < 0.05) compared to the control treatment, as shown in Figure 1a and Figure 1b.

3.2. Influence of Cd and 24-EBL on AQP TPI1:1 gene expression

The RT-PCR analyses corresponding to the Aquaporin TIP1:1 gene revealed a strong relationship with phytohormonal enrichment between 20 and 40 nM of 24-EBL, with high statistical significance (p < 0.05) directly associated with the leaflets of Paricá seedlings (Figure 2a), indicating the initial beneficial effects of 24-EBL application.

Figure 2
qRT-PCR analysis of the AQP1 TIP-1 gene in Schizolobium parahyba var. amazonicum (Huber ex Ducke) Barneby (PARICÁ) under different CdCl₂ and 24-EBL concentrations. (a) qRT-PCR of the AQP1 TIP-1 gene in leaflets; (b) qRT-PCR of the AQP1 TIP-1 gene in roots. Caption: Lowercase letters indicate statistically significant differences among CdCl₂ treatments (p < 0.05) based on Tukey’s test; uppercase letters indicate statistically significant differences among 24-EBL treatments (p < 0.05) based on Tukey’s test.

Figure 2b shows the expression levels of the AQP TIP1:1 gene in root tissues exposed to different concentrations of CdCl₂ (0, 50, 100, and 150 µM) and varying doses of 24-EBL (0, 20, and 40 nM). Specifically, in the root system of seedlings treated without 24-EBL application (Figure 2b), early signs of stress were observed through the gradual upregulation of AQP TIP1:1, with statistically significant differences (p < 0.05) as CdCl₂ concentrations increased. This pattern was not observed in the leaflets, where AQP TIP1:1 activity remained at low levels, showing no statistically significant differences (p < 0.05) in plants under endogenous 24-EBL treatments (Figure 2a).

Regarding the plant organ samples under the influence of 20 and 40 nM of 24-EBL, an upregulation of the AQP TIP1:1 gene was observed in both roots (Figure 2b) and aerial parts (Figure 2a), corresponding to the incorporation of 50 and 100 µM CdCl₂ into the substrate. This resulted in significant differences (p < 0.05) between treatments under the combined influence of Cd and 24-EBL when compared to the control. However, it is important to highlight the effects of phytohormonal supplementation with 24-EBL (0, 20, and 40 nM) on AQP TIP1:1 gene activity. Notably, the concentration of 150 µM of Cd²⁺ in both root (Figure 2b) and leaf (Figure 2a) structures showed a significant increase (p < 0.05) compared to the control group.

In summary, regarding the regulation of the AQP TIP1:1 gene, root structures stand out due to being the first organs to come into contact with the toxic metal Cd. Furthermore, a strong association with the 0, 20, and 40 nM 24-EBL treatments was confirmed throughout the experiment. In both leaf (Figure 2a) and root (Figure 2b) samples, statistically significant differences (p < 0.05) were observed at 20 and 40 nM concentrations across all CdCl2 doses (0, 50, 100, and 150 µM).

3.3. Influence of Cd and 24-EBL on HMA4 gene expression

The molecular assessments of HMA4 gene expression levels in plants under hormonal supplementation with 24-EBL (0, 20, and 40 nM) and no CdCl₂ application revealed a significant negative difference (p < 0.05) between the 20 and 40 nM treatments, specifically in the leaves (Figure 3a).

Figure 3
qRT-PCR analysis of the HMA4 gene in Schizolobium parahyba var. amazonicum (Huber ex Ducke) Barneby (PARICÁ) under different CdCl₂ and 24-EBL concentrations. (a) qRT-PCR of the HMA4 gene in leaflets; (b) qRT-PCR of the HMA4 gene in roots. Caption: Lowercase letters indicate statistically significant differences among CdCl₂ treatments (p < 0.05) based on Tukey’s test; uppercase letters indicate statistically significant.

However, upon exposure of the plants to the phytotoxic compounds of CdCl2 (0, 50, 100, and 150 µM), a notable statistical difference (p < 0.05) was observed, particularly in the roots (Figure 3b), under the influence of 24-EBL (0, 20, and 40 nM). Nevertheless, the leaf tissues showed distinct behavior, with HMA4 expression occurring only in seedlings treated with 20 and 40 nM of 24-EBL (Figure 3a).

In contrast, it is observed that the samples enriched with the phytohormone 24-EBL (20 and 40 nM) show greater regulation of HMA4, particularly associated with the 40 nM EBL dose in the leaves (Figure 3a) and under different levels of CdCl₂ toxicity (50, 100, and 150 µM). However, when considering the roots (Figure 3b) subjected to stress, a greater amplification of HMA4 is verified, with a statistically significant difference (p < 0.05) based on Tukey's test, but only between 50 and 100 µM of CdCl₂.

In summary, HMA4 gene expression levels showed a significant reduction in the leaves with 24-EBL application at concentrations between 20 and 40 nM, in the absence of CdCl₂. Upon CdCl₂ addition, a significant increase in expression was observed, especially in the roots, under 24-EBL stimulation. In the leaves, HMA4 activity was noted only with 24-EBL treatments between 20 and 40 nM. These data indicate a differential response between roots and leaves to hormonal treatment and Cd stress.

3.4. Influence of Cd and 24-EBL on P5CR gene expression

Similar to what was observed for the other target genes studied in the present research, a close relationship of the P5CR gene with root samples was verified as the doses of toxic CdCl₂ ions (0, 50, 100, and 150 µM) increased. There was a progressive amplification of P5CR in root cells, regardless of the 24-EBL treatment (0 nM, 20 nM, 40 nM), with a significant increase (p < 0.05) between treatments with CdCl₂ and 24-EBL compared to the control (Figure 4b).

Figure 4
qRT-PCR analysis of the P5CR gene in Schizolobium parahyba var. amazonicum (Huber ex Ducke) Barneby (PARICÁ) under different doses of CdCl₂ and 24-EBL. (a) qRT-PCR of the P5CR gene in leaflets; (b) qRT-PCR of the P5CR gene in the root system. Caption: Lowercase letters indicate statistically significant differences among CdCl₂ treatments (p < 0.05) based on Tukey’s test; uppercase letters indicate statistically significant differences among 24-EBL treatments (p < 0.05) based on Tukey’s test.

In Figure 4a, distinct expressions of P5CR in the leaves are observed. Plants with in situ production of 24-EBL (0 nM) showed suppression of P5CR, exhibiting no significant difference (p < 0.05) compared to the control, indicating early signs of biological instability. However, the opposite occurred in the leaves of plants treated with 24-EBL (20 and 40 nM), showing a significant difference at the 5% level according to Tukey’s test (Figure 4a).

Briefly, the P5CR gene showed a progressive increase in the roots as the concentrations of CdCl₂ rose, regardless of the presence of 24-EBL (Figure 4b). In the leaves, natural production of 24-EBL at 0 nM led to a reduction in P5CR regulation. However, with applications of 24-EBL at 20 and 40 nM (Figure 4a), a significant increase in P5CR expression was observed, suggesting an adaptive mechanism in Paricá seedlings.

4. Discussions

4.1. Effect of Cd and 24-EBL on the production of Malondialdehyde (MDA) levels

Roots are among the organs most affected by Cd ion toxicity due to their direct and constant contact with the soil (Pernía et al., 2019). This exposure leads to the formation of reactive oxygen species (ROS), which damage cellular membrane lipids and trigger lipid peroxidation (Mansoor et al., 2023). During this process, malondialdehyde (MDA) is formed as a byproduct and serves as a biochemical marker of oxidative damage to membranes (Zhang et al., 2021). The accumulation of MDA indicates oxidative stress and impairment of cellular membranes (Aguilar et al., 2024). As MDA levels increase, they signal the activation of early stress response mechanisms related to the chelation, immobilization, and compartmentalization of Cd ions (Rao et al., 2025). These high-efficiency biological repair systems prevent Cd transport and the spread of ROS to the aerial parts of the plant, thereby protecting the photosynthetic apparatus and supporting the maintenance of photochemical energy production (Huybrechts et al, 2019; Malecka et al., 2021).

Hormonal supplementation with 24-EBL in plants supports rapid biological responses to stress caused by elevated MDA formation (Avalbaev et al., 2024). This phytohormone activates cellular homeostasis mechanisms against Cd, such as the regulation of toxic ion fluxes in plant cells, chelation by phytochelatin proteins, and compartmentalization in vacuoles, thereby reducing toxicity and protecting cellular function (Ribeiro et al., 2020; Alam et al., 2021). Additionally, this hormonal compound promotes increased antioxidant activity, reducing the damage caused by ROS and improving the redox balance within the cell, creating a less favorable environment for MDA formation (Song et al., 2025). It also enhances cell membrane integrity and stimulates both root and shoot growth even under stress conditions (Zhang and Lan, 2021).

4.2. Effect of cadmium (Cd) and 24-EBL on the expression activity of the AQP TPI1:1 gene

Roots are the first plant organs to come into direct contact with Cd, triggering increased expression of AQP1:1 to facilitate both the dilution and compartmentalization of Cd within plant cells, thereby minimizing its toxicity (Kapilan et al., 2018; Li et al., 2025). In this context, the upregulation of AQP1:1 in roots contributes to the regulation of water transport, the elimination of Cd ions, and the reduction of small toxic molecules through the tonoplast located in the vacuolar membrane (Gattolin et al., 2009; Kayum et al., 2017; Guo et al., 2022). Moreover, its expression is associated with a reduction in ROS levels, protecting cells from oxidative damage and contributing to decreased Cd transport to the xylem, thereby helping to safeguard aerial tissues responsible for essential functions such as photosynthesis and gas exchange (Gallo-Franco et al., 2020).

The addition of the mitigator 24-EBL in plants directly influences the overexpression of AQP-TIP1, promoting the transport of water and small toxic solutes through the tonoplast, thereby helping to maintain cellular homeostasis (Morillon et al., 2001; Neri et al., 2021). During Cd exposure, AQP-TIP1 facilitates vacuolar volume regulation through transmembrane channels, allowing for the compartmentalization of Cd ions and reducing their concentration in the cytoplasm (Salvatierra et al., 2023; Martinez-Alonso et al., 2024). This action minimizes damage to cellular structures and contributes to the maintenance of turgor pressure and cellular metabolism (Arantes et al., 2020). Additionally, the TIP1;1 protein is involved in the indirect regulation of ROS levels, assisting in maintaining the cell’s redox balance (Gao et al., 2023). Its activity supports plant growth and the response to oxidative stress.

4.3. Effect of cadmium (Cd) and 24-EBL on the expression activity of the HMA4 gene

The HMA4 gene is closely associated with the traits of hyperaccumulation and hypertolerance to Zn and Cd in plants (Wiyono et al., 2021). Heavy Metal ATPase 4 (HMA4) is a transporter enzyme belonging to the P-type ATPase family, which specializes in transporting metal ions across plant cell plasma membranes (Ceasar et al., 2020). It uses energy derived from ATP (adenosine triphosphate) hydrolysis to pump heavy metals such as Zn²⁺, Cd²⁺ and Pb²⁺ out of the cytoplasm or into organelles, aiding in the detoxification and redistribution of these metals within the plant (Sahan et al., 2022). HMA4 contributes to the sequestration of metals into specific compartments or their translocation to less sensitive parts of the plant (Wang et al., 2019). This regulation helps maintain ionic homeostasis in plant cells under heavy metal stress (Moravcíková and Ziarovská, 2023).

The presence of high concentrations of Cd ions in the aerial parts leads to the generation of ROS, affecting photosynthesis, stomatal conductance, RuBisCO enzyme activity, and transpiration (Nogueira et al., 2019). The phytohormone 24-EBL acts as a key modulator of gene expression under Cd²⁺ stress, inducing the transcription of the HMA4 gene, which encodes the Heavy Metal ATPase 4 (Sun et al., 2024). This ATPase actively pumps Cd²⁺ ions out of the cytoplasm, reducing their toxicity (Batool et al., 2023). Additionally, 24-EBL stimulates antioxidant and signaling pathways that stabilize cell membranes, enhancing the efficiency of ion transport (Angulo-Bejarano et al., 2021). Consequently, HMA4 activity is potentiated, promoting metal homeostasis and alleviating oxidative stress (Skuza et al., 2022).

4.4. Effect of cadmium (Cd) and 24-EBL on the expression activity of the P5CR gene

Plant roots are the first line of contact with the environment, containing a higher concentration of binding sites and ion transporters, which increases Cd uptake compared to leaves (Iori et al., 2017; Souza et al., 2022; Sabella et al., 2022). Exposure to Cd induces various morphophysiological changes in plant roots, such as growth inhibition, cell wall thickening, collapse of root architecture, and increased production of ROS (Yan et al., 2023). In response, the P5CR gene (pyrroline-5-carboxylate reductase), involved in proline (Pro) biosynthesis, is activated. This amino acid acts as an osmoprotectant by balancing the osmotic potential of cells, maintaining water uptake, and preventing dehydration caused by Cd stress (Kisa, 2019). As an antioxidant, Pro neutralizes ROS derived from the phytotoxic effects of Cd, reducing oxidative damage to lipids, proteins, and DNA (Mushtaq et al., 2025). Pro also provides structural stabilization to cells, protecting membrane integrity and enzymes from stress-induced denaturation (Chen et al., 2021). Additionally, Pro participates in maintaining intracellular pH and serves as a reserve of energy and carbon during cell recovery (Dudziak et al., 2019). Studies on Amazonian species demonstrate that Pro maintains the integrity of nitrate reductase, a crucial enzyme in converting nitrate to nitrite, ensuring nitrogen uptake in Paricá seedlings even under Cd and nickel (Ni) stress (Souza et al., 2024). In Virola surinamensis (ucuúba), Cd exposure induced increased Pro regulation in roots, promoting both osmotic balance and tissue protection (Andrade Júnior et al., 2021).

At high concentrations, Cd can substitute magnesium (Mg²⁺) in chlorophyll and iron in ferredoxins in the leaves, directly affecting the structure and function of chlorophyll (Cosmo et al., 2023). This substitution compromises photosynthesis by reducing the efficiency of light absorption and electron transfer during the photosynthetic process (Rocha and Mahler, 2024). This leads to electron accumulation and excessive formation of ROS, causing oxidative damage to the leaves (Sachdev et al., 2021). Under stress conditions in leaf cells, 24-EBL binds to its receptor located on the plasma membrane, triggering an intracellular signaling cascade that activates the P5CR gene (Adamipour et al., 2025). This leads to mRNA production in the nucleus, which is subsequently translated into proline by ribosomes in the cytoplasm (Zhao et al., 2021; Usmani et al., 2025). Proline performs crucial roles as an osmoprotectant, antioxidant, and cellular stabilizer, contributing to the protection of proteins, membranes, and organelles against ROS (Miao et al., 2024). This results in increased tolerance to Cd stress and preservation of cellular integrity.

5. Conclusion

The study demonstrated an increase in MDA levels in Paricá seedlings exposed to 50, 100, and 150 µM Cd, even under 24-EBL application. In contrast, a progressive upregulation of AQP TIP-1, HMA4, and P5CR gene expression was observed, particularly in the roots, associated with the 40 nM 24-EBL dose. These results indicate that 24-EBL positively modulates gene regulation in response to cadmium-induced oxidative stress. This response suggests the activation of plant resilience mechanisms in both shoot and root systems. Further studies are required to elucidate the molecular mechanisms underlying species tolerance to Cd.

Acknowledgements

This work was carried out with financial support from Fundação Amazônia de Amparo a Estudos e Pesquisas (FAPESPA), Universidade Federal Rural da Amazônia (UFRA) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) and with technical support from the team that worked hard to implement the experiment and collect the data. We thank them all.

Data Availability Statement

The dataset analyzed or produced in this study can be requested from the corresponding author.

References

• ADAMIPOUR, N., NAZARI, F., NALOUSI, A.M. and SILVA, J.A.T., 2025. Evaluation of the molecular mechanism underlying proline metabolic and catabolic pathways and some morpho-physiological traits of tobacco (Nicotiana tabacum L.) plants under arsenic stress. BMC Plant Biology, vol. 25, no. 1, pp. 258. https://doi.org/10.1186/s12870-025-06262-x PMid:40000937.
  » https://doi.org/10.1186/s12870-025-06262-x
• AFZAL, Z., HOWTON, T.C., SUN, Y. and MUKHTAR, M.S., 2016. The Roles of Aquaporins in Plant Stress Responses. Journal of Developmental Biology, vol. 4, no. 1, pp. 9. https://doi.org/10.3390/jdb4010009 PMid:29615577.
  » https://doi.org/10.3390/jdb4010009
• AGUILAR, M.V.M., WERTONGE, G.S., BIRCK, T.P., LOVATO, L.R., ROSA, F.C.R., HINDERSMANN, J., MAYER, N.A., MOURA-BUENO, J.M., BRUNETTO, G. and TABALDI, L.A., 2024. Oxidative stress as markers in identification of aluminum-tolerant peach tree rootstock cultivars and clonal selections. Revista Brasileira de Ciência do Solo, vol. 48, pp. e0220112. https://doi.org/10.36783/18069657rbcs20220112
  » https://doi.org/10.36783/18069657rbcs20220112
• AHMED, M.K., SHALAN, A.E., AFFIFI, M., EL-DESOKY, M.M. and MÉNDEZ, S.L., 2021. Silver-doped cadmium selenide/graphene oxide-filled cellulose acetate nanocomposites for photocatalytic degradation of malachite green toward wastewater treatment. ACS Omega, vol. 6, no. 36, pp. 23129-23138. https://doi.org/10.1021/acsomega.1c02667 PMid:34549114.
  » https://doi.org/10.1021/acsomega.1c02667
• ALAM, P., BALAWI, T.A., ASHRAF, M. and AHMAD, P., 2021. 24-epibrassinolide (EBR) reduces oxidative stress damage induced by cadmium toxicity by restricting CD uptake and modulating some key antioxidant enzymes in maize plants. Pakistan Journal of Botany, vol. 53, no. 1, pp. 59-66. https://doi.org/10.30848/PJB2021-1(27)
  » https://doi.org/10.30848/PJB2021-1(27)
• ALAM, P., KAUR KOHLI, S., AL BALAWI, T., ALTALAYAN, F.H., ALAM, P., ASHRAF, M., BHARDWAJ, R. and AHMAD, P., 2020. Foliar application of 24-epibrassinolide improves growth, ascorbate-glutathione cycle, and glyoxalase system in brown mustard (Brassica juncea (L.) Czern.) under Cadmium Toxicity. Plants, vol. 9, no. 11, pp. 1487. https://doi.org/10.3390/plants9111487
  » https://doi.org/10.3390/plants9111487
• ALHAMMAD, B.A., AHMAD, A., SELEIMAN, M.F. and TOLA, E., 2023. Seed priming with nanoparticles and 24-epibrassinolide improved seed germination and enzymatic performance of Zea mays L. in Salt-Stressed Soil. Plants, vol. 12, no. 4, pp. 690. https://doi.org/10.3390/plants12040690 PMid:36840038.
  » https://doi.org/10.3390/plants12040690
• ALI, H., KHAN, E. and ILAHI, I., 2019. Environmental chemistry and ecotoxicology of hazardous heavy metals: environmental persistence, toxicity, and bioaccumulation. Journal of Chemistry, vol. 2019, no. 1, pp. 6730305. https://doi.org/10.1155/2019/6730305
  » https://doi.org/10.1155/2019/6730305
• ANDRADE JÚNIOR, W.V.A., OLIVEIRA NETO, C.F.O., SANTOS FILHO, B.G.S., CRUZ, E.D., AMARANTE, C.B., BARBOSA, A.V.C., NOGUEIRA, G.A.S., NASCIMENTO, V.R., SOUSA, D.J.P. and TEIXEIRA, J.S.S., 2021. Biochemical metabolism of young plants of Ucuúba (Virola surinamensis) in the presence of cadmium. BMC Plant Biology, vol. 21, pp. 151. https://doi.org/10.1186/s12870-021-02912-y
  » https://doi.org/10.1186/s12870-021-02912-y
• ANGULO-BEJARANO, P.I., PUENTE-RIVERA, J. and CRUZ-ORTEGA, R., 2021. Metal and metalloid toxicity in plants: an overview on molecular aspects. Plants, vol. 10, no. 4, pp. 635. https://doi.org/10.3390/plants10040635 PMid:33801570.
  » https://doi.org/10.3390/plants10040635
• ANWAR, A., LIU, Y., DONG, R., BAI, L., YU, X. and LI, Y., 2018. The physiological and molecular mechanism of brassinosteroid in response to stress: a review. Biological Research, vol. 51, no. 1, pp. 46. https://doi.org/10.1186/s40659-018-0195-2 PMid:30419959.
  » https://doi.org/10.1186/s40659-018-0195-2
• ARANTES, M.B.S., MARINHO, C.S., GOMES, M.M.A., SANTOS, R.S., GALVÃO, S.P. and VAZ, G.P., 2020. Brassinosteroid accelerates the growth of Psidium hybrid during acclimatization of seedlings obtained from minicuttings. Pesquisa Agropecuária Tropical, vol. 50, pp. 50. https://doi.org/10.1590/1983-40632020v5064743
  » https://doi.org/10.1590/1983-40632020v5064743
• AVALBAEV, A., FEDYAEV, V., LUBYANOVA, A., YULDASHEV, R. and ALLAGULOVA, C., 2024. 24-epibrassinolide reduces drought-induced oxidative stress by modulating the antioxidant system and respiration in wheat seedlings. Plants, vol. 13, no. 2, pp. 148. https://doi.org/10.3390/plants13020148 PMid:38256702.
  » https://doi.org/10.3390/plants13020148
• BALALI-MOOD, M., NASERI, K., TAHERGORABI, Z., KHAZDAIR, M.R. and SADEGHI, M., 2021. Toxic mechanisms of five heavy metals: mercury, lead, chromium, cadmium, and arsenic. Frontiers in Pharmacology, vol. 12, pp. 1-19. https://doi.org/10.3389/fphar.2021.643972 PMid:33927623.
  » https://doi.org/10.3389/fphar.2021.643972
• BASTOS, A.S.M., ALVES, A.C.B., BARROS, L.T.C., GOMES, L.S., NASCIMENTO, C.M., RIBEIRO, D.M., NOGUEIRA, G.A.S. and NETO, C.F.O., 2024. Avaliação de efeitos de cromo e 24-Epibrassinolídeo em parâmetros biométricos de Schizolobium parahyba var. amazonicum (Huber ex Ducke) Barneby (PARICÁ). Cuadernos de Educación y Desarrollo., vol. 16, no. 6, pp. 1-15. https://doi.org/10.55905/cuadv16n6-038
  » https://doi.org/10.55905/cuadv16n6-038
• BASTOS, R.S., ARAÚJO, J.L., AZEVEDO, V.S., FERREIRA, M.L.A., LIMA, L.R. and ROCHA, J.A., 2021. Cadmio complexes with biological activity: scientific and technological prospection. Research, Social Development, vol. 10, no. 5, pp. 1-15.
• BATOOL, T.S., ASLAM, R., GUL, A., PARACHA, R.Z., ILYAS, M., ABREU, K.D., MUNIR, F., AMIR, R. and WILLIAMS, L.E., 2023. Genome wide analysis of heavy metal ATPases (HMAs) in Poaceae species and their potential role against copper stress in Triticum aestivum. Scientifc Reports, vol. 13, pp. 7551. https://doi.org/10.1038/s41598-023-32023-7
  » https://doi.org/10.1038/s41598-023-32023-7
• BUCKER-NETO, L., PAIVA, A.L.S., MACHADO, R.D., ARENHART, R.A. and MARGIS-PINHEIRO, M., 2017. Interactions between plant hormones and heavy metals responses. Genetics and Molecular Biology, vol. 40, no. 1, suppl. 1, pp. 40. https://doi.org/10.1590/1678-4685-gmb-2016-0087 PMid:28399194.
  » https://doi.org/10.1590/1678-4685-gmb-2016-0087
• CEASAR, S.A., LEKEUX, G., MOTTE, P., XIAO, Z., GALLENI, M. and HANIKENNE, M., 2020. di-Cysteine Residues of the Arabidopsis thaliana HMA4 C-Terminus Are Only Partially Required for Cadmium Transport. Frontiers in Plant Science, vol. 11, pp. 560. https://doi.org/10.3389/fpls.2020.00560 PMid:32528485.
  » https://doi.org/10.3389/fpls.2020.00560
• CHEN, C., CUI, X., ZHANG, P., WANG, Z. and ZHANG, J., 2021. Expression of the pyrroline-5-carboxylate reductase (P5CR) gene from the wild grapevine Vitis yeshanensis promotes drought resistance in transgenic Arabidopsis. Plant Physiology and Biochemistry : PPB, vol. 168, pp. 168. https://doi.org/10.1016/j.plaphy.2021.10.004 PMid:34649022.
  » https://doi.org/10.1016/j.plaphy.2021.10.004
• CORDIANO, R., GIOACCHINO, M.D., MANGIFESTA, R., PANZERA, C., GANGEMI, S. and MINCIULLO, P.L., 2023. Malondialdehyde as a potential oxidative stress marker for allergy-oriented diseases: an update. Molecules (Basel, Switzerland), vol. 28, no. 16, pp. 5979. https://doi.org/10.3390/molecules28165979 PMid:37630231.
  » https://doi.org/10.3390/molecules28165979
• COSMO, B.M.N., ROSA, W.B., DANILUSSI, M.T.Y. and ZANETTI, W.A.L., 2023. Influência dos metais na fotossíntese. Revista Agronomia Brasileira, pp. 1-10. https://doi.org/10.29372/rab202347
  » https://doi.org/10.29372/rab202347
• DANGL, J.L. and JONES, J.D.G., 2019. A pentangular plant inflammasome. Science, vol. 364, no. 6435, pp. 31-32. https://doi.org/10.1126/science.aax0174 PMid:30948541.
  » https://doi.org/10.1126/science.aax0174
• DRABEK, M.C., PIEKUT, A., GUT, K. and GRABOWSK, M., 2020. Risk of cadmium, lead and zinc exposure from consumption of vegetables produced in areas with mining and smelting past. Scientific Reports, vol. 2020, pp. 1-9.
• DUDZIAK, K., ZAPALSKA, M., BORNER, A., SZCZERBA, H., KOWALCZYK, K. and NOWAK, M., 2019. Analysis of wheat gene expression related to the oxidative stress response and signal transduction under short-term osmotic stress. Scientific Reports, vol. 9, no. 1, pp. 2743. https://doi.org/10.1038/s41598-019-39154-w PMid:30808876.
  » https://doi.org/10.1038/s41598-019-39154-w
• DUTTA, S., MITRA, M., AGARWAL, P., MAHAPATRA, K., DE, S., SETT, U. and ROY, S., 2018. Oxidative and genotoxic damages in plants in response to heavy metal stress and maintenance of genome stability. Plant Signaling & Behavior, vol. 13, pp. 1-17. https://doi.org/10.1080/15592324.2018.1460048
  » https://doi.org/10.1080/15592324.2018.1460048
• EKINCI, M., SHAMS, M., TURAN, M., UCAR, S., YAPRAK, E., YUKSEL, E.A., AYDIN, M., ILHAN, E., AGARF, G., ERCISLI, S. and YILDIRIM, E., 2024. Chitosan mitigated the adverse effect of Cd by regulating antioxidant activities, hormones, and organic acids contents in pepper (Capsicum annum L.). Heliyon, vol. 10, no. 17, pp. e36867. https://doi.org/10.1016/j.heliyon.2024.e36867 PMid:39351296.
  » https://doi.org/10.1016/j.heliyon.2024.e36867
• EL-SAPPAH, A.H., ZHU, Y., HUANG, Q., CHEN B., SOAUD, S.A.., ELHAMID, M.A.A., YAN, K., LI, J. and EL-TARABILY, K.A., 2024. Plants’ molecular behavior to heavy metals: from criticality to toxicity. Frontiers in Plant Science, vol. 15, pp. 1423625. PMid:39280950.
• GALLO-FRANCO, J.J., SOSA, C.C., GHNEIM-HERRERA, T. and QUIMBAYA, M., 2020. Epigenetic control of plant response to heavy metal stress: a new view on aluminum tolerance. Frontiers in Plant Science, vol. 11, pp. 602625. https://doi.org/10.3389/fpls.2020.602625 PMid:33391313.
  » https://doi.org/10.3389/fpls.2020.602625
• GAO, M., WANG, Z., JIA, Z., ZHANG, H. and WANG, T., 2023. Brassinosteroids alleviate nanoplastic toxicity in edible plants by activating antioxidant defense systems and suppressing nanoplastic uptake. Environment International, vol. 174, pp. 107901. https://doi.org/10.1016/j.envint.2023.107901 PMid:37003216.
  » https://doi.org/10.1016/j.envint.2023.107901
• GATTOLIN, S., SORIEUL, M., HUNTER, P.R., KHONSARI, R.H. and FRIGERIO, L., 2009. In vivo imaging of the tonoplast intrinsic protein family in Arabidopsis roots. BMC Plant Biology, vol. 9, no. 1, pp. 133. https://doi.org/10.1186/1471-2229-9-133
  » https://doi.org/10.1186/1471-2229-9-133
• GENCHI, G., SINICROPI, M.S., LAURIA, G., CAROCCI, A. and CATALANO, A., 2020. The effects of Cadmium toxicity. International Journal of Environmental Research and Public Health, vol. 17, no. 11, pp. 3782. https://doi.org/10.3390/ijerph17113782 PMid:32466586.
  » https://doi.org/10.3390/ijerph17113782
• GU, Q., WANG, C., XIAO, Q., CHEN, Z. and HAN, Y., 2021. Melatonin Confers Plant Cadmium Tolerance: an Update. International Journal of Molecular Sciences, vol. 22, no. 21, pp. 11704. https://doi.org/10.3390/ijms222111704 PMid:34769134.
  » https://doi.org/10.3390/ijms222111704
• GUO, A., HAO, J., SU, Y., LI, B., ZHAO, N., ZHU, M., HUANG, Y., TIAN, B., SHI, G. and HUA, J., 2022. Two Aquaporin Genes, GhPIP2;7 and GhTIP2;1, positively regulate the tolerance of upland cotton to salt and osmotic stresses. Frontiers in Plant Science, vol. 12, pp. 780486. https://doi.org/10.3389/fpls.2021.780486 PMid:35222450.
  » https://doi.org/10.3389/fpls.2021.780486
• HAIDER, F., LIQUN, C., COULTER, J., CHEEMA, S.A., WU, J., ZHANG, R., WENJUN, M. and FAROOQ, M., 2021. Cadmium toxicity in plants: impacts and remediation strategies. Ecotoxicology and Environmental Safety, vol. 211, pp. 111887. https://doi.org/10.1016/j.ecoenv.2020.111887 PMid:33450535.
  » https://doi.org/10.1016/j.ecoenv.2020.111887
• HEATH, R.L. and PACKER, L., 1968. Photoperoxidation in isolated chloroplasts: I. Kinetics and stoichiometry of fatty acid peroxidation. Archives of Biochemistry and Biophysics, vol. 125, no. 1, pp. 1968. https://doi.org/10.1016/0003-9861(68)90654-1 PMid:5655425.
  » https://doi.org/10.1016/0003-9861(68)90654-1
• HUYBRECHTS, M., CUYPERS, A., DECKERS, J., IVEN, V., VANDIONANT, S., JO-ZEFCZAK, M. and HENDRIX, S., 2019. Cadmium and plant development: an agony from seed to seed. International Journal of Molecular Sciences, vol. 20, no. 16, pp. 3971. https://doi.org/10.3390/ijms20163971 PMid:31443183.
  » https://doi.org/10.3390/ijms20163971
• IORI, V., PIETRINI, F., BIANCONI, D., MUGHINI, G., MASSACCI, G. and ZACCHINI, M., 2017. Analysis of biometric, physiological, and biochemical traits to evaluate the cadmium phytoremediation ability of eucalypt plants under hydroponics. IForest : Biogeosciences and Forestry, vol. 10, no. 2, pp. pp. 416-421. https://doi.org/10.3832/ifor2129-009
  » https://doi.org/10.3832/ifor2129-009
• KAPILAN, R., VAZIRI, M. and ZWIAZEK, J.J., 2018. Regulation of aquaporins in plants under stress. Biological Research, vol. 51, no. 1, pp. 4. https://doi.org/10.1186/s40659-018-0152-0 PMid:29338771.
  » https://doi.org/10.1186/s40659-018-0152-0
• KAYUM, M.A., PARK, J., NATH, U.K., BISWAS, M.K., KIM, H.-T. and NOU, I.-S., 2017. Genome-wide expression profiling of aquaporin genes confer responses to abiotic and biotic stresses in Brassica rapa. BMC Plant Biology, vol. 17, no. 1, pp. 23. https://doi.org/10.1186/s12870-017-0979-5
  » https://doi.org/10.1186/s12870-017-0979-5
• KEBERT, M., KOSTIC, S., VUKSANOVIC, V., MARKIC, A.G., KIPROVSKI, B., ZORIC, M. and ORLOVI, S., 2022. Metal- and organ-specific response to heavy metal-induced stress mediated by antioxidant enzymes’ activities, polyamines, and plant hormones levels in populus deltoides. Plants, vol. 11, no. 23, pp. 3246. https://doi.org/10.3390/plants11233246 PMid:36501286.
  » https://doi.org/10.3390/plants11233246
• KISA, D., 2019. Responses of phytochelatin and proline-related genes expression associated with heavy metal stress in Solanum lycopersicum. Acta Botanica Croatica, vol. 78, no. 1, pp. 9-16. https://doi.org/10.2478/botcro-2018-0023
  » https://doi.org/10.2478/botcro-2018-0023
• KUMAR, N., SHARMA, V., KAUR, G., LATA, C., DASILA, H., PERVEEN, K., KHAN, F., GUPTA, V.K. and KHANAM, M.N., 2023. Brassinosteroids as promoters of seedling growth and antioxidant activity under heavy metal zinc stress in mung bean (Vigna radiata L.). Frontiers in Microbiology, vol. 14, pp. 1259103. https://doi.org/10.3389/fmicb.2023.1259103 PMid:37869675.
  » https://doi.org/10.3389/fmicb.2023.1259103
• LI, X., GUO, Y., LING, Q., GUO, Z., LEI, Y., FENG, X., WU, J. and ZHANG, N., 2025. Advances in the structure, function, and regulatory mechanism of plant plasma membrane intrinsic proteins. Genes, vol. 16, no. 1, pp. 10. PMid:39858557.
• LIU, X., ZHU, Q., LIU, W. and ZHANG, J., 2023. 24-Epibrassinolide confers zinc stress tolerance in watermelon seedlings through modulating antioxidative capacities and lignin accumulation. PeerJ, vol. 11, pp. e15330. https://doi.org/10.7717/peerj.15330 PMid:37187511.
  » https://doi.org/10.7717/peerj.15330
• MAHAJAN, P. and KAUSHAL, J., 2018. Role of phytoremediation in reducing cadmium toxicity in soil and water. Journal of Toxicology, vol. 2018, pp. 4864365. https://doi.org/10.1155/2018/4864365 PMid:30425738.
  » https://doi.org/10.1155/2018/4864365
• MALECKA, A., KONKOLEWSKA, A., HANĆ, A., CISZEWSKA, L., STASZAK, A.M., JARMUSZKIEWICZ, W. and RATAJCZAK, E., 2021. Activation of antioxidative and detoxifcative systems in Brassica juncea L. plants against the toxicity of heavy metals. Scientifc Reports, vol. 11, no. 1, pp. 22345. https://doi.org/10.1038/s41598-021-01827-w
  » https://doi.org/10.1038/s41598-021-01827-w
• MANSOOR, S., ALI, A., KOUR, N., BORNHORST, J., ALHARBI, K., RINKLEBE, J., MONEIM D.A.E., AHMAD P. and CHUNG, Y.S., 2023. Heavy metal induced oxidative stress mitigation and ROS scavenging in plants. Plants vol. 12, no. 16, pp. 3003. https://doi.org/10.3390/plants12163003
  » https://doi.org/10.3390/plants12163003
• MARTINEZ-ALONSO, A., NICOLÁS-ESPINOSA, J., CARVAJAL, M. and BÁRZANA, G., 2024. The differential expressions of aquaporins underline the diverse strategies of cucumber and tomato against salinity and zinc stress. Physiologia Plantarum, vol. 176, no. 1, pp. e14222. https://doi.org/10.1111/ppl.14222 PMid:38380715.
  » https://doi.org/10.1111/ppl.14222
• MIAO, R., LI, C., LIU, Z., ZHOU, X., CHEN, S., ZHANG, D., LUO, J., TANG, W., WANG, C. and WU, J., 2024. The role of endogenous brassinosteroids in the mechanisms regulating plant reactions to various abiotic stresses. Agronomy (Basel), vol. 2024, no. 2, pp. 1-14.
• MIKHAILENKO, A.V., RUBAN, D.A., ERMOLAEV, V.A. and LOON, A.J.V., 2020. Cadmium Pollution in the Tourism Environment: A Literature Review. Geosciences, vol. 10, no. 6, pp. 242. https://doi.org/10.3390/geosciences10060242
  » https://doi.org/10.3390/geosciences10060242
• MORAVCÍKOVÁ, D. and ZIAROVSKÁ, J., 2023. The Effect of Cadmium on plants in terms of the response of gene expression level and activity. Plants, vol. 12, no. 9, pp. 1848. https://doi.org/10.3390/plants12091848 PMid:37176906.
  » https://doi.org/10.3390/plants12091848
• MORILLON, R., CATTEROU, M., SANGWAN, R.S., SANGWAN, B.S. and LASSALLES, J.P., 2001. Brassinolide may control aquaporin activities in Arabidopsis thaliana. Planta, vol. 212, no. 2, pp. 199-204. https://doi.org/10.1007/s004250000379. PMid:11216840.
• MUNAWAR, A., AKRAM, M.S., ALI, S., SARKER, P.K. and EL-SHEIKH, M.A., 2025. Deciphering morphological and biochemical modulations in mungbean by application of ethylene precursor and inhibitors under cadmium stress. Scientific Reports, vol. 15, no. 1, pp. 15294. https://doi.org/10.1038/s41598-025-96375-y PMid:40312526.
  » https://doi.org/10.1038/s41598-025-96375-y
• MUSHTAQ, N.U., SALEEM, S., RASOOL, A., SHAH, W.H., TAHIR, I., SETH, C.S. and REHMAN, R.U., 2025. Proline tagging for stress tolerance in plants. International Journal of Genomics, vol. 2025, no. 1, pp. 9348557. https://doi.org/10.1155/ijog/9348557 PMid:40207093.
  » https://doi.org/10.1155/ijog/9348557
• NERI, A., TRAVERSARI, S., ANDREUCCI, A., FRANCINI, A. and SEBASTIANI, L., 2021. The role of aquaporin overexpression in the modulation of transcription of heavy metal transporters under Cadmium Treatment in Poplar. Plants, vol. 10, no. 1, pp. 54. PMid:33383680.
• NOGUEIRA, G.A.S., BRITO, A.E.A., NASCIMENTO, V.R., ALBUQUERQUE, G.D.P., BOTELHO, A.S., SOUZA, L.C., FREITAS, J.M.N., AMARANTE, C.B., OKUMURA, R.S., CONCEIÇÃO, H.E.O., VIANA, R.G. and NETO, C.F.O., 2019. Physiological and Growth Responses in the (Schizolobium amazonicum Huber ex Ducke) seedlings subjected to cadmium doses. Journal of Agricultural Science (Toronto), vol. 11, no. 8, pp. 217. https://doi.org/10.5539/jas.v11n8p217
  » https://doi.org/10.5539/jas.v11n8p217
• NOGUEIRA, G.A.S., BRITO, A.E.A., RESENDE, V.N., ALBUQUERQUE, G.D.P., AMARANTES, C.B., OLIVEIRA, J.T., SILVA, P.A. and OLIVEIRA NETO, C.F., 2022. Nitrogen and carbon metabolism evaluation in paricá plants subjected to different cadmium concentrations. Bioscience Journal, vol. 38, pp. 1-10. https://doi.org/10.14393/BJ-v38n0a2022-61137
  » https://doi.org/10.14393/BJ-v38n0a2022-61137
• OZYIGIT, A.H. and GENC, B.N., 2020. Cadmium in plants, humans and the environment. Frontiers in Life Sciences and Related Technologies, vol. 1, no. 1, pp. 12-21.
• PERNÍA, B., CALABOKIS, M., NORIS, K., BUBIS, J., GUERRA, M. and CASTRILLO, M., 2019. Effects of cadmium in plants of Sphagneticola trilobata (L.) Pruski. Bioagro, vol. 31, no. 2, pp. 133-142.
• PRAMANIK, D., SHELAKE, R.M., KIM, M.J. and KIM, J.Y., 2021. CRISPR-Mediated Engineering across the Central dogma in plant biology for basic research and crop improvement. Molecular Plant, vol. 14, no. 1, pp. 127-150. https://doi.org/10.1016/j.molp.2020.11.002 PMid:33152519.
  » https://doi.org/10.1016/j.molp.2020.11.002
• QUADROS, I.P.S., MADEIRA, N.N., LORIATO, V.A.P., SAIA, T.F.F., SILVA, J.C., SOARES, F.A.F., CARVALHO, J.R., REIS, P.A.B., FONTES, E.P.B., CLARINDO, W.R. and FONTES, R.L.F., 2021. Cadmium‐mediated toxicity in plant cells is associated with the DCD/NRP‐mediated cell death response. Plant, Cell & Environment, vol. 45, no. 2, pp. 556-571. PMid:34719793.
• RAO, M.J., DUAN, M., ZHOU, C., JIAO, J., CHENG, P., YANG, L., WEI, W., SHEN, Q., JI, P., YANG, Y., CONTEH, O., YAN, D., YUAN, H., RAUF, A., AI, J. and ZHENG, B., 2025. J. I. P; YANG, Y. Antioxidant Defense System in Plants: Reactive Oxygen Species Production, Signaling, and Scavenging During Abiotic Stress-Induced Oxidative Damage. Horticulturae, vol. 11, no. 5, pp. 477. https://doi.org/10.3390/horticulturae11050477
  » https://doi.org/10.3390/horticulturae11050477
• RASHID, A., SCHUTTE, B.J., ULERY, A., DEYHOLOS, M.K., SANOGO, S., LEHNHOFF, E.A. and BECK, L., 2023. Heavy metal contamination in agricultural soil: environmental pollutants affecting crop health. Agronomy (Basel), vol. 13, no. 6, pp. 1521. https://doi.org/10.3390/agronomy13061521
  » https://doi.org/10.3390/agronomy13061521
• RAZA, A., HABIB, M., KAKAVAND, S.N., ZAHID, Z., ZAHRA, N., SHARIF, R. and HASANUZZAMAN, M., 2020. Phytoremediation of Cadmium: physiological, biochemical, and molecular mechanisms. Biology (Basel), vol. 9, no. 7, pp. 1-46. https://doi.org/10.3390/biology9070177 PMid:32708065.
  » https://doi.org/10.3390/biology9070177
• RIBEIRO, A.T., OLIVEIRA, V.P., SILVA, B.R.S., BATISTA, B.L. and LOBATO, A.K.S., 2020. 24-Epibrassinolide mitigates nickel toxicity in young Eucalyptus urophylla S.T. Blake plants: nutritional, physiological, biochemical, anatomical and morphological responses. Annals of Forest Science, vol. 77, no. 1, pp. 5. https://doi.org/10.1007/s13595-019-0909-9
  » https://doi.org/10.1007/s13595-019-0909-9
• ROCHA, N.S. and MAHLER, C.F., 2024. Analysis of sorption/desorption of cadmium and lead in the legal amazon soils. An International Journal of Geotechnical and Geoenvironmental Engineering, vol. 47, no. 1, pp. e2024014022.
• SABELLA, E., APRILE, A., TENUZZO, B.A., CARATA, E., PANZARIN, E., LUVISI, A., BELLIS, L. and VERGINE, M., 2022. Effects of Cadmium on Root Morpho-Physiology of Durum Wheat. Frontiers in Plant Science, vol. 13, pp. 936020. https://doi.org/10.3389/fpls.2022.936020 PMid:35812940.
  » https://doi.org/10.3389/fpls.2022.936020
• SACHDEV, S., ANSARI, A.S., ANSARI, M.I., FUJITA, M. and HASANUZZAMAN, M., 2021. Abiotic stress and reactive oxygen species: generation, signaling, and defense mechanisms. Antioxidants, vol. 10, no. 2, pp. 277. https://doi.org/10.3390/antiox10020277 PMid:33670123.
  » https://doi.org/10.3390/antiox10020277
• SAHAN, M., MERAKLI, N. and MEMON, A., 2022. Expression of some metal transporter ATPases in Brassica rapa Grownunder Cadmium Stress. Turkish Journal of Agriculture - Food Science and Technology, vol. 10, no. sp1, pp. 2685-2690. https://doi.org/10.24925/turjaf.v10isp1.2685-2690.5640
  » https://doi.org/10.24925/turjaf.v10isp1.2685-2690.5640
• SAINI, S., KAUR, N. and PATI, P.K., 2021. Phytohormones: key players in the modulation of heavy metal stress tolerance in plants. Ecotoxicology and Environmental Safety, vol. 223, pp. 112578. https://doi.org/10.1016/j.ecoenv.2021.112578 PMid:34352573.
  » https://doi.org/10.1016/j.ecoenv.2021.112578
• SALVATIERRA, A., MATELUNA, P., TORO, G., SOLÍS, S. and PIMENTEL, P., 2023. Genome-Wide Identification and Gene Expression Analysis of Sweet Cherry Aquaporins (Prunus avium L.) under Abiotic Stresses. Genes, vol. 14, no. 4, pp. 940. https://doi.org/10.3390/genes14040940 PMid:37107698.
  » https://doi.org/10.3390/genes14040940
• SHAARI, N.E.M., TAJUDIN, M.T.F.M., KHANDAKER, M.M., MAJRASHI, A., ALENAZI, M.M., ABDULLAHI, U.A. and MOHD, K.S., 2024. Cadmium toxicity symptoms and uptake mechanism in plants: a review. Brazilian Journal of Biology, vol. 84, pp. 2024. https://doi.org/10.1590/1519-6984.252143 PMid:35239785.
  » https://doi.org/10.1590/1519-6984.252143
• SHI, G.L., LI, D.J., WANG, Y.F., LIU, C.H., HU, Z.B., LOU, L.Q., RENGEL, Z. and CAI, Q.S., 2019. Accumulation and distribution of arsenic and cadmium in winter wheat (Triticum aestivum L.) at different developmental stages. The Science of the Total Environment, vol. 667, pp. 667. https://doi.org/10.1016/j.scitotenv.2019.02.394 PMid:30833251.
  » https://doi.org/10.1016/j.scitotenv.2019.02.394
• SIEPRAWSKA, A., SZYDLO, E.R., SKÓRKA, M., TELK, A. and FILE, M., 2024. Assessment of the oxidative stress intensity and the integrity of cell membranes under the manganese nanoparticles toxicity in wheat seedlings. Scientific Reports, vol. 14, no. 1, pp. 3121. https://doi.org/10.1038/s41598-024-53697-7 PMid:38326390.
  » https://doi.org/10.1038/s41598-024-53697-7
• SKUZA, L., SZUCKO-KOCIUBA, I., FILIP, E. and BOZEK, I., 2022. Natural Molecular Mechanisms of Plant Hyperaccumulation and Hypertolerance towards Heavy Metals. International Journal of Molecular Sciences, vol. 23, no. 16, pp. 9335. https://doi.org/10.3390/ijms23169335 PMid:36012598.
  » https://doi.org/10.3390/ijms23169335
• SONG, W., LI, H., ZHAO, Z., SI, R., DENG, W., WANG, M. and LI, Y., 2025. 24-Epibrassinolide Enhanced Plant Antioxidant System and Cadmium Bioavailability Under Soil Cadmium Stress. Plants, vol. 14, no. 5, pp. 765. https://doi.org/10.3390/plants14050765 PMid:40094715.
  » https://doi.org/10.3390/plants14050765
• SOUZA, L.D., DRAGO, C.T., ROSA, B.N.M., TEIXEIRA, J.P., SILVA, T.M., GONÇALVES, L.F., SILVA, L.R., RIBEIRO, V.K.C., OLIVEIRA, T.J.M., NASCIMENTO, V.R., BRITO, A.E.A., NOGUEIRA, G.A.S. and NETO, C.F.O., 2024. Growth and metabolic functions of Schizolobium amazonicum subjected to nickel doses. Brazilian Journal of Biology, vol. 84, pp. 84. https://doi.org/10.1590/1519-6984.283010
  » https://doi.org/10.1590/1519-6984.283010
• SOUZA, N.D., SANT’ANNA NETO, A., SANTOS JUNIOR, A.J., OLIVEIRA, A.C.L., SAMPAIO, D.A., CUPERTINO, G. F. M., GONÇALVES, A.N. and DIAS JÚNIOR, A.F., 2022. A Brazilian Amazon species with high potential to phytoextract potential toxic elements. Floresta e Ambiente, vol. 29, no. 1, pp. 1-8.
• SUN, J.Y., GUO, R., JIANG, Q., CHEN, C.Z., GAO, Y.Q., JIANG, M., SHEN, R.F., ZHU, X.F. and HUANG, J., 2024. Brassinosteroid decreases cadmium accumulation via regulating gibberellic acid accumulation and Cd fixation capacity of root cell wall in rice (Oryza sativa). Journal of Hazardous Materials, vol. 469, pp. 133862. https://doi.org/10.1016/j.jhazmat.2024.133862
  » https://doi.org/10.1016/j.jhazmat.2024.133862
• USMANI, L., SHAKIL, A., KHAN, I., ALVI, T., SINGH, S. and DAS, D., 2025. Brassinosteroids in micronutrient homeostasis: mechanisms and implications for plant nutrition and stress resilience. Plants, vol. 14, no. 4, pp. 598. https://doi.org/10.3390/plants14040598 PMid:40006858.
  » https://doi.org/10.3390/plants14040598
• WAHEED, A., HAXIM, Y., ISLAM, W., AHMAD, M., ALI, S., WEN, X., KHAN, K.A., GHRAMH, H.A., ZHANG, Z. and ZHANG, D., 2022. Impact of Cadmium stress on growth and physio-biochemical attributes of Eruca sativa Mill. Plants, vol. 11, no. 21, pp. 2981. https://doi.org/10.3390/plants11212981
  » https://doi.org/10.3390/plants11212981
• WANG, J., LIANG, S., XIANG, W., DAI, H., DUAN, Y., KANG, F. and CHAI, T., 2019. A repeat region from the Brassica juncea HMA4 gene BjHMA4R is specifically involved in Cd²⁺ binding in the cytosol under low heavy metal concentrations. BMC Plant Biology, vol. 19, no. 1, pp. 89. https://doi.org/10.1186/s12870-019-1674-5 PMid:30819104.
  » https://doi.org/10.1186/s12870-019-1674-5
• WIYONO, C.D.A.P., INOUE, C. and CHIEN, M.F., 2021. HMA4 and IRT3 as indicators accounting for different responses to Cd and Zn by hyperaccumulator Arabidopsis halleri ssp. Gemmifera. Plant Stress, vol. 2, pp. 100042. https://doi.org/10.1016/j.stress.2021.100042
  » https://doi.org/10.1016/j.stress.2021.100042
• YAN, Q., FANG, H., WANG, D., XIAO, X., DENG, T., LI, X., WEI, F., LIU, J. and LIN, C., 2023. Transfer and transformation characteristics of Zn and Cd in soil rotation plant (Brassica napus L and Oryza sativa L) system and its infuencing factors. Scientifc Reports, vol. 13, pp. 7393. https://doi.org/10.1038/s41598-023-34377-4
  » https://doi.org/10.1038/s41598-023-34377-4
• ZABKA, A., WINNICKI, K., POLIT, J.T., WRÓBLEWSKI, M. and MASZEWSKI, J., 2021. Cadmium (II)-Induced oxidative stress results in replication stress and epigenetic modifications in root meristem cell Nuclei of Vicia faba. Cells, vol. 10, no. 3, pp. 640. https://doi.org/10.3390/cells10030640 PMid:33805688.
  » https://doi.org/10.3390/cells10030640
• ZHANG, Y. and LAN, Q., 2021. Epibrassinolide improves the growth performance of Sedum lineare upon Zn stress through boosting antioxidative capacities. PLoS One, vol. 16, no. 9, pp. e0257172. https://doi.org/10.1371/journal.pone.0257172 PMid:34492083.
  » https://doi.org/10.1371/journal.pone.0257172
• ZHANG, Y., LUAN, Q., JIANG, J. and LI, Y., 2021. Prediction and utilization of malondialdehyde in exotic pine under drought stress using near-infrared spectroscopy. Frontiers in Plant Science, vol. 12, pp. 735275. https://doi.org/10.3389/fpls.2021.735275 PMid:34733301.
  » https://doi.org/10.3389/fpls.2021.735275
• ZHAO, H., GUAN, J., LIANG, Q., ZHANG, X., HU, H. and ZHANG, J., 2021. Effects of cadmium stress on growth and physiological characteristics of sassafras seedlings. Scientifc Reports, vol. 11, pp. 9913. https://doi.org/10.1038/s41598-021-89322-0.

Edited by

• Editor:
  Takako Matsumura Tundisi

Publication Dates

• Publication in this collection
  10 July 2026
• Date of issue
  2026

History

• Received
  13 Dec 2025
• Accepted
  18 Mar 2026