Abstract
This study aimed to construct a bicistronic DNA vaccine expressing fusion antigen Hsp65-Esat-6 of Mycobacterium tuberculosis with cytokine GM-CSF as a molecular adjuvant (pIRES-Hsp65-ESAT-6-GM-CSF, pIRHEG), and the immune response in mice. C57BL/6 mice were immunized with the recombinant plasmid to detect the titer of antibodies, lymphocyte proliferation, the ratio of CD4+, CD8+T cell and IFN ~ γ,IL-2 secretion. The titer of antibody, lymphocyte proliferation, the ratio of CD4+T and CD8+T cells and IFN ~ γ, IL-2 secretion of pIRHEG group was significant higher than other recombinant plasmid groups, which significant differed by statistical mean. The bicistronic DNA vaccine could induce an effective immune response in mice and could be used as vital ingredient of a new tuberculosis vaccine candidate.
Hsp65; Esat6; GM-CSF
HUMAN AND ANIMAL HEALTH
Enhanced immune response of a bicistronic DNA vaccine expressing fusion antigen Hsp65-Esat-6 of Mycobacterium Tuberculosis with GM-CSF as a molecular adjuvant
Yan Dong; Jun-Yuan Gong; Xin Liu ; Jun-Wu Li*
Department of Biotechnology; College of Life Science and Technology; Jinan University; Guangzhou - China
ABSTRACT
This study aimed to construct a bicistronic DNA vaccine expressing fusion antigen Hsp65-Esat-6 of Mycobacterium tuberculosis with cytokine GM-CSF as a molecular adjuvant (pIRES-Hsp65-ESAT-6-GM-CSF, pIRHEG), and the immune response in mice. C57BL/6 mice were immunized with the recombinant plasmid to detect the titer of antibodies, lymphocyte proliferation, the ratio of CD4+, CD8+T cell and IFN ~ γï¼IL-2 secretion. The titer of antibody, lymphocyte proliferation, the ratio of CD4+T and CD8+T cells and IFN ~ γ, IL-2 secretion of pIRHEG group was significant higher than other recombinant plasmid groups, which significant differed by statistical mean. The bicistronic DNA vaccine could induce an effective immune response in mice and could be used as vital ingredient of a new tuberculosis vaccine candidate.
Key words: Hsp65, Esat6, GM-CSF
INTRODUCTION
It is estimated that nearly one-third of the world's population is infected with Mycobacterium tuberculosis (MTB). Every year about 1,000 million new cases of its infection appear and 200 million people die of tuberculosis (Wallis et al. 2010). Vaccine represents the key tool of preventing MTB. Although the Bacillus Calmette-Guerin (BCG) vaccine has been widely used against MTB for nearly 100 years, it has not contributed significantly to the reduction in incidence of MTB, with merely only 50% rate of the success. Along with the migration and HIV infection, some new and easily-spreading MTB strains and multiple drug-resistant strains make the traditional anti-TB drugs fail to play an effective role (Hesseling et al. 2007; Azzopardi et al. 2009; Stefan et al. 2010). It is very likely that MTB may become endemic in the immunized population and cause new public problems. Therefore, it is pressing to develop a novel vaccine.
Currently, DNA vaccine has gained more attention with greater development since it maintains a long immune response and is safe as a recombinant subunit vaccine. It is effective as a live attenuated vaccine in systemic immune response, with easier cloning of DNA molecule and no requirement of protein synthesis's in vitro, extraction and purification (Hanif et al. 2010). The MTB hot shock protein 65 (heat shock protein 65, Hsp65), one of earliest MTB antigen studied, may have the intense protection immune response in the animal in vivo to MTB's infection (Yoshida et al. 2006; Sechi et al. 2006; Okada et al. 2007). It can provide stable and reliable basis protective immunity for anti-M. tuberculosis infection. The small-molecular dose of secretory protein ESAT-6 is an extremely strong antigenic protein expressed in the MTB complex, in which a large quantity of B and T cell epitopes are present (Abramo et al. 2006; Van et al. 2010). It can increase the capacity of macrophage inhibition of the growth and cytotoxicity of M. tuberculosis intracellular level. During the long course of cultivation in vitro, ESAT-6 is missing from virulent M. tuberculosis that may lead to BCG instability of immunization effect (Brodin et al. 2004; Khera et al. 2005).
Granulocyte macrophage colony-stimulating factor (GM-CSF) as a good gene adjuvant, can increase the effectiveness of DNA vaccines by improving human body's immune level (Qiu et al. 2007; Zhang et al. 2007). This study aimed to construct a bicistronic DNA vaccine expressing fusion antigen Hsp65-Esat-6 of Mycobacterium tuberculosis with cytokine GM-CSF as a molecular adjuvant (pIRES-Hsp65-ESAT-6-GM-CSF, pIRHEG) and the immune response in mice, to lay the foundation for the further development of a new DNA vaccine resistance for Mycobacterium tuberculosis infection.
METHODS
Construction and identification of pIRES-Hsp65-ESAT-6-GM-CSF plasmids
The whole-genome was extracted from MTB H37Rv by M. tuberculosis genomic DNA extraction kit (beads) (Shanghai DOBIO, China), and used it as a template to amplify the Hsp65 and Esat6 gene. the sequences of gene-specific primers for Hsp65 forward: 5'-CGGCTAGC ATGGCCAAGACAATTGCGTACG-3', including restriction enzyme cutting site NheI (TaKaRa BIO Inc, Japan) and initiation codon, and reverse: 5′- CAGAATTCGTCACCTTTACCGCATCG -3′, including restriction enzyme cutting site EcoRI and without termination codon. Esat6 forward: 5′- CAGAATTCGGTGGCGGTGGAAGCGGCGGTGGCGGAAGCGGCGGTGGCGGCAGCACAGAGCAGCAGTGGAATTTC-3′, including restriction enzyme cutting site EcoRI and a hydrophobic peptide consisted of 15 amino acids, and reverse: 5'-GCACGCGTCTATGCGAACATCCCAGTGACG-3′, including restriction enzyme cutting site MluI and termination codon. CDS forward: 5'-CATCTAGAATGTGGCTGCAGAGCCTGCT-3', including restriction enzyme cutting site XbaI and initiation codon ATG, and reverse: 5'-ATGCGGCCGCTCACTCCTGGACTGGCTC-3', including restriction enzyme cutting site NotI and termination codon TGA. Vector pORF-GM-CSF was used as a template. The two gene fragments Hsp65-ESAT-6 and GM-CSF were cloned into pIRES vector with the two multiple cloning sites (MCSA and MCSB). Finally a recombinant plasmid named pIRHEG, which was identified by PCR, double digested with XbaI and NotI restriction enzyme analysis and sequencing, was obtained.
Detection of recombinant plasmids expression
The recombinant plasmids (pIRES-Hsp65-ESAT-6-GM-CSF (pIRHEG), pIRES-Hsp65-ESAT-6 (pIRHE), pIRES-Hsp65 (pIRH), pIRES-ESAT-6 (pIRE)) and empty plasmid vector pIRES were transfected into HepG-2 cells, then the expression of proteins was detected by Western-blot and enzyme-linked immunosorbent assay (ELISA). The expressed proteins were separated by 10% SDS-PAGE, electro-transferred onto a nitrocellulose membrane. The membrane was blocked with nonfat milk, then incubated with 1:1000 dilution of mouse anti-human Hsp65 or 1:500 dilution of mouse anti-human ESAT6, and then incubated with corresponding a 1:5000 dilution of horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG. The immunochemical detection was performed by an enhanced chemiluminescence (ECL) system (Thermo Fisher Scientific Inc. USA) to visualize specific immune-reactive bands. Transfected HepG-2 cells culture supernatants were collected separately after 24 and 48 h, using Double-antibody sandwich ELISA to detect of the GM-CSF protein expression level according to the instruction of kit (R&D Systems, USA).
Animal immunization
Female C57BL/6 mice (6-8 weeks old) were randomly divided into seven groups (total 140): pIRES-Hsp65 group (pIRH); pIRES-ESAT-6 group (pIRE); pIRES-Hsp65-ESAT-6 group (pIRHE); pIRES-Hsp65-ESAT-6-GM-CSF group (pIRHEG) (Endotoxin-free plasmids were prepared using an EndoFree plasmid purification mega prep kit, Qiagen); BCG group; pIRES group; and PBS group, twelve mice per group. Mice were immunized three times at 2-week intervals bilateral anterior tibial muscle injection with 100 µg pIRH, pIRE, pIRHE, pIRHEG or pIRES. The control animals (PBS group) were sham-immunized with 100 µl PBS. The BCG group was vaccinated subcutaneously with 0.5 mg once at the first immunization. Mice were sacrificed to conduct the analysis of immune responses at 2, 4 and 6 weeks after the immunization. Blood samples were collected and kept at - 20°C for usage. The study was carried was approved by the Ethics and Animal Care Committee of First Affiliated Hospital of Jinan University for all animal procedures and the experimental protocol.
Evaluation of antibody responses
An indirect enzyme-linked immunosorbent assay (ELISA) was used for determining the specific antibody. Serum was collected every week after the immunization by tail bleeding and stored at -70°C for further analysis. Plates were coated with PPD protein at a final concentration of 10 µg / ml at 4°C overnight. After blocking with 1% BSA-PBS, serum (1:100 dilution) was added in duplicate at 37°C after 1.5 h. HRP-conjugated goat anti-mouse IgG was added, followed by OPD substrate addition. The absorbance was measured in a microplate reader at 490 nm. Monitor was used to detect the levels of serum antibody in immunized mice for eight weeks duration.
Proliferation of splenocyte
Lymphocyte proliferation of immunized mice were measured by MTT assay [3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide]. At 2, 4, 6 weeks after the first immunization, mice were scarified and their spleens were aseptically removed and splenocyte were prepared as single cell suspensions. The cells were plated in 96-well flat-bottomed microtitre plates in triplicate at 2×107 cells per well. RPMI 1640 (GIBCO, UK) supplemented with 10% fetal calf serum was added to each well and stimulated with 50 µl PPD (the Ministry of Health, Chengdu Institute of Biological Products) at 1 mg/l. Lymphocytes stimulated with the medium alone were used as a negative control. The cells were incubated for 48 h at 37°C in humid atmosphere of 5% CO2 and then 20 ml of MTT (5 mg/ml) (Sigma) was added to each well. After additional incubation for 4 h, the supernatant were carefully aspirated and 200 µl of DMSO was added into each well and absorbance of the soluble formazan was measured at 570 nm by automatic microplate reader (Bio-Rad, USA).
Percentages of splenocyte subsets
The splenocyte from mice were prepared and cultured. Then they were seeded in 6-well flat-bottom plates at a concentration of 5 × 106 cells per well and in duplicate for culture with 1.5 ml PPD (1 mg/l ), The plate was incubated for 72 h at 37°C in humid atmosphere of 5% CO2. Then the cells were washed with PBS, then rabbit anti-mouse CD4+-PE (eBioscience, San Diego, CA, USA) and rabbit anti-mouse CD8+-fluorescein isothiocyanate (eBioscience) were added and incubated for 1 h at room temperature. Subsequently the cells were washed three times and the proportions of CD4+ T and CD8+ T cells were determined by flow cytometry.
IFN- γ and IL-2 concentration of the lymphocyte secreted
The splenocyte of immunized mice were cultured by the same operation in the proliferation assays for 72 h. Following incubation, the supernatant from each well were removed and kept at - 20°C for the evaluation of secreted IFN-γ and IL-2 level. The concentrations of IFN-γ and IL-2 in the culture supernatant were measured by murine cytokine enzyme-linked immunosorbent assay kits (R&D systems, USA).
Statistical analysis of data
All the measurement data represented the mean ± standard errors (x±s). Statistical software SPSS was used to perform the statistical analysis. Differences among the groups were analysed with stochastic analysis of variance. Differences were considered significant when a probability value of < 0.05 was obtained.
RESULTS
Detection of recombinant vaccine expression
When pIRHEG, pIRHE, pIRH, pIRE and pIRES plasmide were transfected into HepG-2 cells, the expression proteins were detected by the Western-blot. The results showed that protein expression was 75 KD of pIRHEG and pIRHE groups as expected. Protein expression ESAT6 was 10 KD and Hsp65 was 65 KD as the same as anticipated (Fig. 1).
The levels of cytokine GM-CSF were measured by using Microplate reader in pIRHEG group. In two different periods, compared with the pIRES group,
the levels of GM-CSF cytokine of pIRHEG group had a statistically significant difference (P < 0.01); compared with the pIRES-GM group, the levels of GM-CSF cytokine of pIRHEG group had no significant difference (P > 0.05). The results showed that the expression of Hsp65-Esat6 fusion gene in the upstream multiple cloning sites of the vector pIRES did not significantly affect the downstream cloning site of GM-CSF protein expression (Fig. 2).
Evaluation of antibody responses
Humoral immune responses were determined by measuring the total IgG in sera collected from the immunized mice at 2, 4, 6 and 8 weeks after the immunization. The IgG level was increased with the prolongation of immune time. Figure 3 illustrates the levels of antibody response in the sera of mice immunized with recombinant plasmids and PBS in different time point, using TB-PPD as the antigen. The IgG titre of pIRHEG group was higher than other recombinant plasmid groups and BCG group (P < 0.05). The IgG titres of BCG group had no significant difference between other experimental groups (pIRHE, pIRH, pIRE) (P > 0.05). Three weeks after the first immunization, there were significant difference (P < 0.05) between the experimental groups (pIRHEG, pIRHE, pIRH, pIRE) and the control group (pIRES, PBS) in the titer of antibody. Compared with the two control groups, pIRHEG group showed significant difference (P < 0.01). However, there was no significant difference between the two control groups (P > 0.05).
Proliferation of splenocyte
The SI value was calculated as the ratio of absorbent value at 570 nm of splenocyte pools incubated with the TB-PPD to that of pools incubated with medium only. Figure 4 showed that the SI values in the experimental groups were always higher than the control group. At two weeks after the first immunization, the SI values between the experimental group and in the control groups had no significant difference (P > 0.05). At six weeks after the first immunization, the SI values in single gene experimental groups decreased than at four weeks. But the SI values in fusion gene experimental groups kept increasing. The SI values in the pIRHEG group and BCG group were significantly higher than any other recombinant plasmid groups (P < 0.05). However, there was no significant difference in the SI value between the pIRHEG group and BCG group (P > 0.05).
Percentages of splenocyte subsets
The proportions of splenocyte subsets stimulated by the TB-PPD were determined by flow cytometry. Figure 5 showed that CD4+ T cells and CD8+ T cells increased significantly in the immunization groups. At two weeks after the first immunization, the ratio of CD4+ and CD8+ T cell between the experimental groups had no significant difference (P > 0.05). At four and six weeks after the first immunization, the ratio of CD4+ and CD8+ T cells in the pIRHEG group and BCG group were significantly higher than any other recombinant plasmid groups (P < 0.05). However, there was no significant difference in the ratio of CD4+ and CD8+ T cell between the pIRHEG group and BCG group (P > 0.05).
IFN- γ and IL-2 concentration of the lymphocyte secreted
IFN-γ and IL-2 secretion is indicative of Th1-biased responses. Murine cytokine enzyme-linked immunosorbent assay kit was used to detect the levels of IFN-γ and IL-2 secreted by splenocyte in all immunized mouse groups. Results clearly showed that after stimulation with the TB-PPD in vitro, the concentrations of IFN-γ in the experimental group and BCG group were maintained in a high level. At two weeks after the first immunization there were no significant differences between the groups (P > 0.05). At four and six weeks after the first immunization, the levels of IFN-γ in the pIRHEG group and the BCG group were significantly higher than any other groups (P < 0.05). However, there was no significant difference between the pIRHEG group and BCG group (P > 0.05). Other experimental groups had no significant difference (P > 0.05). At six weeks after the first immunization, the levels of IFN-γ in single gene experimental groups decreased than at four weeks (Fig. 6).
At two weeks after the first immunization, the concentrations of IL-2 in the groups had no significant difference (P > 0.05). At four and six weeks after the first immunization, the levels of IL-2 in the pIRHEG group and the BCG group were significantly higher than any other groups (P < 0.05). However, there was no significant difference between the pIRHEG group and BCG group (P > 0.05) (Fig. 6).
DISCUSSION
Although, a separate gene encoding Hsp65 or Esat6 antigen resistance to M. tuberculosis in the role of infection has been confirmed, the role of single gene expression antigen is less than the BCG (Morris et al. 2000; Agger et al. 2006). Trail to add other immune stimuli, such as cytokines or other protective antigens have shown the beneficial results. As an adjuvant, GM-CSF has been used in gene vaccine. If the DNA vaccines were mixed injection with the constructed encoding GM-CSF plasmid, it might interfere with the immune function (Hu et al. 2004; Dou et al. 2005). The adjuvant and target gene were cloned into upstream and downstream two multiple cloning sites of bicistronic pIRES elements to make both the target gene and adjuvant has the same local micro-environment and their expression is noninterference and respectively (Martínez et al. 2001). Under this guidance, our study constructed recombinant plasmid pIRHEG with Hsp65-Esat-6 fusion antigen gene and GM-CSF co-expression. By PCR, restriction enzyme digestion and sequencing confirmed that vector was successfully constructed. Western blot and ELISA confirmed the stable expression of recombinant antigen proteins with the control group pIRHE, pIRH and pIRE.
M. tuberculosis is the intracellular parasite bacterial. The body's immune response to MTB depends on the cellular immune response and evaluation of humoral immune response of MTB vaccine is an important indicator. The success of a vaccine against the intracellular pathogens as MTB mainly depends on the regulated activation of two types of T lymphocyte: CD4+ and CD8+ T cells. Studies have shown that mycobacterial infection can induce the spleen lymphocyte proliferation, IFN-γ, IL-2/As Th1-type cytokines can activate the macrophages to kill mycobacteria, the amount of its expression has a direct relationship with the protective effect of the vaccine (Vordermeier et al. 2002).
At four and six weeks after the immunization, the value of spleen lymphocyte proliferation, the ratio of CD4+ and CD8+ T cell and the level of IFN-γ, IL-2 in pIRHEG group were significantly higher than the other recombinant DNA vaccine groups. At six weeks after the immunization, the value of spleen lymphocyte proliferation and the level of IFN-γ in single-gene DNA vaccine groups were decreased than at four weeks. The values of spleen lymphocyte proliferation and the level of IFN-γ in the fusion gene DNA vaccine groups were increased after the immunization. The results indicated that the single-gene DNA vaccine induced cellular immune response were earlier than the fusion gene. The proliferation of CD4+ T cell producing IFN-γ could activate the macrophages to fight against the early infection and the proliferation of CD8+ T cell could promote the bacterial schizolysis by secreting porforin, granulysin and extracellular enzyme. Further investigation showed the capability of humoral immune response of the constructed DNA vaccine. The results showed that the DNA vaccine groups and BCG group had better performance in varying degrees, especially the level of antibodies of pIRHEG group was significantly higher than other recombinant DNA group and BCG group. The study showed that the pIRHEG DNA vaccine could induce strong cellular and humoral immune responses in mice, but its immune responses was not improved obviously compare with the BCG.
CONCLUSIONS
In summary, the use of the single-gene and fusion gene DNA vaccine involved in this study of immunize mice could activate the humoral immune response and cellular immune responses against M. tuberculosis. The adjuvant and fusion gene co-expression pIRHEG vaccine are significantly better than single-gene vaccine and fusion gene DNA vaccine pIRHE group. The GM-CSF can enhance the function and increase the number of antigen presenting cells, regulate the intensity of immune response in the immune response against M. tuberculosis. The results of this study provide a new approach for the development of new tuberculosis vaccines. It should have a good application prospect in tuberculosis DNA vaccines development if further studies on the role of fusion DNA vaccine in the immune protection in vivo are undertaken.
ACKNOWLEDGMENTS
This study was supported by the Science and Technology Plan of Guangdong Province, No. [2006] A20101006 and Major National Science and Technology (S&T) Special Projects (2008ZX10002-009).
Received: May 08, 2012;
Accepted: July 14, 2013.
References
- Abramo C, Meijgaarden KE, Garcia D, Franken KL, Klein MR, Kolk AJ, et al. Monokine induced by interferon gamma and IFN- response to a fusion protein of Mycobacterium tuberculosis ESAT-6 and CFP-10 in Brazilian tuberculosis patients. Microbes Infect 2006; 8(1): 45-51.
- Agger EM, Rosenkrands I, Olsen AW, Hatch G, Williams A, Kritsch C, et al. Protective immunity to tuberculosis with Ag85B-ESAT-6 in a synthetic cationic adjuvant system IC31. Vaccine 2006; 24(26): 5452-5460.
- Azzopardi P, Bennett CM, Graham SM, Duke T. Bacille Calmette-Guerin vaccine-related disease in HIV-infected children: a systematic review. Int J Tuberc Lung Dis 2009; 13(1): 1331-1344.
- Brodin P, Rosenkrands I, Andersen P, Cole ST, Brosch R. ESAT-6 proteins: protective antigens and virulence factors. Trends Microbiol 2004; 12(11): 500-508.
- Dou J, Chen JS, Wang J, Chen GB, Zhao FS, Tang Q, et al. Novel constructs of tuberculosis gene vaccine and its immune effect in mice. Cell Mol Immunol 2005; 2(1): 57-62.
- Hanif SN, Al-Attiyah R, Mustafa AS. DNA vaccine constructs expressing Mycobacterium tuberculosis-specific genes induce immune responses. Scand J Immunol 2010; 72(5): 408-415.
- Hesseling AC, Marais BJ, Gie RP, Schaaf HS, Fine PE, Godfrey-Faussett P, et al. The risk of disseminated Bacille Calmette-Guerin (BCG) disease in HIV-infected children. Vaccine 2007; 25(1): 14-18.
- Hu J, Cladel NM, Wang Z, Han R, Pickel MD, Christensen ND. GM-CSF enhances protective immunity to cottontail rabbit papillomavirus E8 genetic vaccination in rabbits. Vaccine 2004; 22(9-10): 1124-1130.
- Khera A, Singh R, Shakila H, Rao V, Dhar N, Narayanan PR, et al. Elicitation of efficient, protective immune responses by using DNA vaccines against tuberculosis. Vaccine 2005; 23(48-49): 5655-5665.
- Martínez-Salas E, Ramos R, Lafuente E. López de Quinto S. Functional interactions in internal translation initiation directed by viral and cellular IRES elements. J Gen Virol 2001; 82(Pt5): 973-984.
- Morris S, Kelley C, Howard A, Li Z, Collins F. The immunogenicity of single and combination DNA vaccines against tuberculosis. Vaccine 2000; 18(20): 2155- 2163.
- Okada M, Kita Y, Nakajima T, Kanamaru N, Hashimoto S, Nagasawa T, et al. Evaluation of a novel vaccine (HVJ - liposome/HSP65 DNA + IL-12 DNA) against tuberculosis using the cynomolgus monkey model of TB. Vaccine 2007; 25(16): 2990-2993.
- Qiu JT, Chang TC, Lin CT, Chen YM, Li FQ, Soong YK, et al. Novel codon-optimized GM-CSF gene as an adjuvant to enhance the immunity of a DNA vaccine against HIV-1 Gag. Vaccine 2007; 25(2): 253-263.
- Sechi LA, Mara L, Cappai P, Frothingam R, Ortu S, Leoni A, et al. Immunization with DNA vaccines encoding different mycobacterial antigens elicits a Th1 type immune response in lambs and protects against Mycobacterium avium subspecies paratuberculosis infection. Vaccine 2006; 24(3): 229-235.
- Stefan HE K, Gregory H, Paul-Henri L. New vaccines for tuberculosis. Lancet 2010; 375(9731): 2110-2119.
- Van Dissel JT, Arend SM, Prins C, Bang P, Tingskov PN, Lingnau K, et al. Ag85B - ESAT-6 adjuvanted with IC31 promotes strong and long-lived Mycobacterium tuberculosis specific T cell responses in naive human volunteers. Vaccine 2010; 28(20): 3571-3581.
- Vordermeier HM, Chambers MA, Cockle PJ, Whelan AO, Simmons J, Hewinson RG. Correlation of ESAT-6 specific gamma interferon production with pathology in cattle following Mycobacterium bovis BCG vaccination against experimental bovis tuberculosis. Infect Immun 2002; 70(6): 3026-3032.
- Wallis RS, Pai M, Menzies D, Doherty TM, Walzl G, Perkins MD, et al. Biomarkers and diagnostics for tuberculosis: progress, needs, and translation into practice. Lancet 2010; 375(9729): 1920-1937.
- Yoshida S, Tanaka T, Kita Y, Kuwayama S, Kanamaru N, Muraki Y, et al. DNA vaccine using hemagglutinating virus of Japan-liposome encapsulating combination encoding mycobacterial heat shock protein 65 and interleukin-12 confers protection against Mycobacterium tuberculosis by T cell activation. Vaccine 2006; 24(8): 1191-1204.
- Zhang X, Divangahi M, Ngai P, Santosuosso M, Millar J, Zganiacz A, et al. Intramuscular immunization with a monogenic plasmid DNA tuberculosis vaccine: Enhanced immunogenicity by electroporation and co-expression of GM-CSF transgene. Vaccine 2007; 25(7): 1342-1352.






