Abstract
Ramie (Boehmeria nivea and Boehmeria tenacissima) is a widely used fiber crop. Traditional water retting or chemical boiling method performed in order to extract ramie fiber seriously pollute the environment and severely damage the fiber, so biological method is the general trend of the fiber-extracting industry. Some strains (687), involving 26 genera and 43 species, were collected from the three samples, which produce hydrolyzed circles in the selective culture medium in order to detect the degumming effect and to compare the enzyme activity. Among these strains, 13 of them did not produce cellulase and had a ramie decreasing weight rate above 25 %, which were regarded as efficient ramie-degumming strains named from R1 to R13. R1 to R13 belonged to Amycolata autotrobutylicun, Bacillus subtilis, Clostridium acetobutylicum, Bacillus subtilis, Rhizobium leguminosarum, Bacteroides finegoldii, Streptomyces lividans, Bacillus amyloliquefaciens, Clostridium acetobutylicum, Pseudomonas brassicacearum, Bacillus pumilus, Bacillus licheniformis, Pectobacterium wasabiae respectively. Bacteroides sp., Rhizobium sp. and Pseudomonas sp. were firstly reported to be used in ramie-degumming. At the same time, the pectinase was the key enzyme in the ramie-degumming process.
fiber; bio-extracting; microorganism; resource
GENETICS AND PLANT BREEDING
Diversity and characterization of ramie-degumming strains
Shengwen Duan§; Zhengchu Liu*, §; Xiangyuan Feng, Ke Zheng; Lifeng Cheng; Xia Zheng
Chinese Academy of Agriculture Sciences/Inst. of Bast Fiber Crops, 348# West Xianjiahu Road, Yuelu District, Hunan 410205 - Changsha - China
ABSTRACT
Ramie (Boehmeria nivea and Boehmeria tenacissima) is a widely used fiber crop. Traditional water retting or chemical boiling method performed in order to extract ramie fiber seriously pollute the environment and severely damage the fiber, so biological method is the general trend of the fiber-extracting industry. Some strains (687), involving 26 genera and 43 species, were collected from the three samples, which produce hydrolyzed circles in the selective culture medium in order to detect the degumming effect and to compare the enzyme activity. Among these strains, 13 of them did not produce cellulase and had a ramie decreasing weight rate above 25 %, which were regarded as efficient ramie-degumming strains named from R1 to R13. R1 to R13 belonged to Amycolata autotrobutylicun, Bacillus subtilis, Clostridium acetobutylicum, Bacillus subtilis, Rhizobium leguminosarum, Bacteroides finegoldii, Streptomyces lividans, Bacillus amyloliquefaciens, Clostridium acetobutylicum, Pseudomonas brassicacearum, Bacillus pumilus, Bacillus licheniformis, Pectobacterium wasabiae respectively. Bacteroides sp., Rhizobium sp. and Pseudomonas sp. were firstly reported to be used in ramie-degumming. At the same time, the pectinase was the key enzyme in the ramie-degumming process.
Keywords: fiber, bio-extracting, microorganism, resource
Introduction
Ramie, including Boehmeria nivea and Boehmeria tenacissima, belongs to Urticaceae, Boehmeria genus, which is regarded as one of the oldest textile fiber yield plants (Ghosh and Ghosh, 1995). It grows from 25º S to 39º N, mainly in China, Brazil, India, the Philippines, and Vetnam (Xiong, 2008). Ramie has furrow shaped air containing space, slender dissepiment, tenacity, and porosity. It is a good raw material textile for air permeability, moisture absorption and heat elimination, which is one of the strongest vegetable fiber known in the world today. It possesses highest strength and length, good durability and absorbency with excellent lustre. These remarkable characters make it rather more suitable for use in the manufacture of wide variety of textiles and cordage products (Dempsey, 1975; Mussig et al., 1998). Food and Agriculture Organization of the United Nations reported that 280,000 t ramie was harvested in 410,000 ha planting areas in 2007 in the world (Xiong, 2008).
Ramie contains 20 % ~ 40 % gum mainly composed of pectin and hemicellulose, but only the purely degummed ramie can be used for spinning and weaving. Traditional degumming methods are water retting and chemical boiling, which seriously pollute the environment and severely damage the fiber (Bhattacharyya and Paul, 1976; Gupta et al., 1976). Since 1954, scientists have done researches in biological ramie-degumming and enzymic degumming method (Paul and Bhattacharya, 1979). For bio-procession can override the defects caused by traditional procession, bio-degumming is the general trend of the ramie process (Liu et al., 2001; Zhou, 1978). However, the non-cellulose components are complicated, and the abundance and quantity of enzymes secreted by single microorganism are hard to match specifically with the components of non-cellulose (Puls et al., 1997), so few strains have been chosen successfully for large-scale industrial applications (Basu et al., 2009).
The diversity and character of ramie-degumming strains is reported for the first time, which will promote the development of ramie bio-degumming technology.
Materials and Methods
The water sample was from a large ramie retting pool from 2 to 200 cm in depth with temperature of 24~27 ºC, the soil sample was from a farmland sown with ramie from 5 to 20 cm in depth, and the humus sample was from rotten ramie. The three samples were collected from Yuanjiang, China (28º50' N, 112º22' E), Fuyang, China (32º55' N, 115º48' E) and Xiaoshang, China (30º16' N, 120º 25' E), respectively.
The strains T11-01 without degumming function was selected and deposited by the authors, which was chosen as the control bacterium for the ramie degumming strains.
Each sample was added to a conical flask containing 200 mL sterile water. After mixing, 15 g ramie was put into the conical flask, then cultured at 30 ºC for 20 h. Ten mL the last cultured liquor was taken to another enrichment culture using ramie for 20 h, and then repeated for three times. One mL such enrichment culture liquor was put to dilute and isolate in selective culture medium at 30 ºC for 10 h. Finally the single colony was got from the selective culture medium. Each liter of the selective culture medium contained 0.5 g K2HPO4, 0.5 g NaH2PO4, 2.0 g (NH4)2SO4, 0.2 g MgSO4·7H2O, and 0.1 g CaCl2, 1 g ramie powder. The strains were purified and routinely cultured at 30 ºC on nutrient broth agar medium (g L-1): 10.0 peptone, 3.0 beef extract, 5.0 NaCl, and 20 agar, and on Martin agar medium (g L-1): 10.0 glucose, 5.0 peptone, 1.0 K2HPO4, 0.5 (NH4)2SO4, and 20 agar respectively, then maintained as glycerol suspension (20 %, w/v) at -70 ºC.
To exclude the strains producing cellulase, the strain suspensions were cultured in the selective medium at 30 ºC for 36~48 h. If hydrolyzed circles appeared around the strains colonies, it was as positive, otherwise, it was as negative (Dong and Cai, 2001). One liter of the cellulose decomposing culture medium contained NH4NO3 1.0 g, CaCl2 0.1 g, K2HPO4 0.5 g, FeCl3 0.02 g, KH2PO4 0.5 g, yeast powder 0.05 g, MgSO4·7H2O 0.5 g, NaCl 1.0 g, fiber powder 8 g and agar 15 g.
Four mL fermentation fluid of strain was put into conical flask containing 200 mL sterile water and dried ramie (M0). After static cultivating at 30 ºC for 1~6 days, rinsing was performed, after it, drying to a constant weight (M1), and then the weight decreasing rate was calculated. The weight decreasing rate V= (M0 - M1)/M0 × 100 %. If the weight decreasing rate was above 25 %, it was regarded as the effective degumming strain (Zeng and Xiang, 2007).
The dried ramie was boiled for 2 h in the fixed condenser-Allihn type containing 200 mL of 20 g L-1 NaOH. The sample was picked out, washed, and finally dried to a constant weight. We recorded the weight, and calculated the residual gum rate, and evaluated the degumming effect by weight decreasing rate and residual gum rate (Jiang and Shao, 2005).
Morphology, physiology and biochemistry properties of the selected strains were analyzed according to Bergey's Manual of Determinative Bacteriology (9th edition) and identified them by the 16S rRNA or 18S rRNA gene sequence.
The bacteria genomic DNA was extracted using UNIQ-10 Column Strains Genomic DNA Extraction Kit (produced by Shanghai Sangon, China), and the fungus genomic DNA was extracted using Biospin Fungus Genomic DNA Extraction Kit (produced by Biospin).The 50 µL reaction mixture for PCR of rRNA gene contained 0.5 µM each of the forward and reverse primers (16S rDNA 27F: AGAGTTTGATCMTGGCTCAG, 1492R: TACGGYTACCTTGTTACGACTT; 18S rDNA NS1: GTAGTCATATGCTTGTCTC, NS8: TCCGCAGGTTCACCTACGGA), 25 µL Taq PCR Mix (Shanghai Sangon, China), 50 ng of DNA, and 20 µL H2O. The cycling conditions were as follows: 5 min at 95 ºC for pre-denaturation, followed by 0.5 min at 94 ºC for denaturation, 1 min at 52 ºC for annealing, 1 min at 72 ºC for extension for 30 cycles, and, finally, preservation at 72 ºC for 10 min. Purification and sequencing were carried out by Dalian TaKaRa Co., Ltd. using the dideoxy chain termination method with 3730 XL DNA sequencer (Applied Biosystems, USA). The 16S rRNA gene sequences were aligned using the Clustal-X program (Thompson et al., 1997). A phylogenetic tree was constructed using the neighbor-joining method (Saitou and Nei, 1987) and the maximum-parsimony method (Fitch, 1972) in the MEGA3 Program (Kumar et al., 2004) with bootstrap values based on 1,000 replications (Felsenstein, 1985).
The enzyme activity was defined as the amount of the enzyme required for 1 µmol substrate to be released per minute. The enzyme activity of the strains was detected in the fermentation liquor at 8 h by DNS method (Wang et al., 2009) and hydrolyzed circles method.
The optimization components in selective plates were as follows: (i) Xylanase activity detection: oats xylan was used as the substrate, and Congo Red as the dye-stuff (Teather and Wood, 1982; Huang et al., 2006); (ii) Mannanase activity detection: konjac gum was used as the substrate, and trypan blue as the dye-stuff (Mendoza et al., 1995). (iii) Pectinase activity detection: orange pectin was used as the substrate, and brilliant green as the dye-stuff (Keen et al., 1984).
Results and Discussion
Some (687) strains were collected from the three samples, which produce hydrolyzed circles in the selective culture medium. The strains were identified according to morphological features, physiological-biochemical characteristics and 16S rDNA (18S rDNA) sequences. One hundred seventy two representative sequence data had been submitted to GenBank (sequence numbers: EU982468-EU982547, FJ544315-FJ544406, and GU097444-GU097456). The 687 strains involved 26 genera and 43 species; they belonged to 599 bacteria, 8 actinomycetes, 65 filamentous fungi, and 15 yeasts, accounting for 87.19 %, 1.16 %, 9.46 %, and 2.18 % respectively. The resources were widespread, which were isolated from soil, water, humus, accounting for 42.21 %, 23.44 %, and 34.35 % respectively (Table 1).
Among these 687 strains, 13 of them did not produce cellulase and degrade above 25 % of the non- cellulose, which were regarded as efficient ramie-degumming strains named from R1 to R13. R1, and R7 to R9 were sampled from Fuyang soil, R2 to R6 from Yuanjiang water, and R10 to R13 from Xiaoshan humus. Based on the 16S rRNA gene sequences, the heredity tree of the strains was constructed (Figure 1), and the main phenotypic characteristics (Table 2). R1 to R13 belonged to Amycolata autotrobutylicun, Bacillus subtilis, Clostridium acetobutylicum, Bacillus subtilis, Rhizobium leguminosarum, Bacteroides finegoldii, Streptomyces lividans, Bacillus amyloliquefaciens, Clostridium acetobutylicum, Pseudomonas brassicacearum, Bacillus pumilus, Bacillus licheniformis, Pectobacterium wasabiae respectively.
Fifteen kinds of strains have been reported to degrade the non-cellulose of bast fiber crops, including Clostridium sp. (He and Feng, 1997; Munshi and Chattoo, 2008), Micrococcus sp. (Sun, 1981), Actinomycete sp. Brühlmann et al., 1994), Erwinia sp. (Peng et al., 1995; Munshi and Chattoo, 2008), Amycolata sp., Streptomyces lividans Brühlmann et al., 2000), Paenibacillus polymyxa (Yang et al., 2001), Bacillus sp. (Zheng et al., 2001; Munshi and Chattoo 2008), Pseudomonas sp. (Munshi and Chattoo, 2008), Achromobacter sp., Zoogloea sp., Cytophaga sp. (Munshi and Chattoo, 2008), Aspergillus sp., Humicola sp., and Penicillium sp. (Baracat et al., 1989; Deshpande and Gurucharanam, 1985). Seven kinds of them belonged to ramie-degumming strains, i.e., Clostridium sp. (He and Feng, 1997), Actinomycete sp. (Brühlmann et al., 1994), Erwinia carotovorum (Peng et al., 1995), Amycolata sp., Streptomyces lividans (Brühlmann et al., 2000), Bacillus subtilis (Sun et al., 1979), Bacillus pumilus (Basu et al., 2009), some other alkalophilic Bacillus (Cao et al., 1992; Zheng et al., 2001), and Aspergillus sp. (Deshpande and Gurucharanam, 1985). Therefore, Bacteroides sp., Rhizobium sp. and Pseudomonas sp. were firstly reported to be used in ramie-degumming.
Both R1 and R7 grew slowly. After vaccination, the degummed solution were clear in the early 48 h and it became muddy in 72 h. Ramie became soft in 90 h and the fiber dispersed in 120 h. After vaccination, the degummed solutions of other 11 strains were clear in 5 h, and became muddy in 12 h. Ramie became soft in 24 h and dispersed naturally in 36 h.
By degumming, non- cellulose had been degraded by 30.5 %, and the residual gum rate was 17.16 %. Among them, R13 had the best degumming effect, whose average rate of material loss was 34.7 %, and the residual gum rate was 14.6 %. The second was R3 and R9, but R1 and R7 were the worst, whose average rates of material loss were 25.3 % and 25.7 % respectively, and the residual gum rates were 19.4 % and 18.7 % respectively (Table 3).
Strains R2, R3, R4, R5, R6, R7, R8, R9 and R11 formed obvious hydrolyzed circles and higher enzyme activity in the three different culture medium plates, while R1 could not form hydrolyzed circles in konjac gum plate, R12 could not form hydrolyzed circles in xylan plate, and R10 could not form hydrolyzed circles in both konjac gum plate and xylan plate (Table 4). The control stain T11-01 without degumming function could not form hydrolyzed circles in pectin plate, but could form hydrolyzed circles in both konjac gum plate and xylan plate.
All the 13 strains of degumming strains secreted pectinase. R10, R12 and R13 did not secret xylanase, and R1 and R10 did not secret mannanase either. R10 and R13 had powerful degumming ability. The control strain T11-01 did not secret pectinase, but secreted xylanase and mannanase. Cao et al. selected four strains designated as NT-2, NT-6, NT-33 and NT-82, which all could produce pectinase (Cao et al, 1992). Pectinolytic activity played an active role in degumming of ramie bast fibers (Brühlmann et al, 1994; Brühlmann et al, 2000; Zheng et al., 2001). Xylanase also played an important role in the degradation of residual gum (Zheng et al., 2001), and, we found strain R10, R12 and R13 did not secret xylanase, however, they had better degomming function. Therefore, pectinase was the key enzyme of ramie degumming, and the xylanase and mannanase were just assistants.
Acknowledgements
We are grateful for the financial support by Hunan Provincial Natural Science Foundation of China (11JJ4021) and China Agriculture Research System for bast and leaf fiber crops (CARS-19).
Received March 18, 2011
Accepted October 11, 2011
Edited by: Leonardo Oliveira Medici
References
- Baracat, M.C.; Valentim, C.; Muchovej, J.J.; Silva, D.O. 1989. Selection of pectinolytic fungi for degumming of natural fibers. Biotechnology Letters 12: 899-902.
- Basu, S.; Saha, M.N.; Chattopadhyay, D.; Chakrabarti, K. 2009. Large-scale degumming of ramie fibre using a newly isolated Bacillus pumilus DKS1 with high pectate lyase activity. Journal of Industrial Microbiology & Biotechnology 36: 239-245.
- Bhattacharyya, S.K.; Paul, N.B. 1976. Susceptibility of ramie with different gum contents to microbial damage. Current Science 45: 417-418.
- Brühlmann, F.; Kim, K.S.; Zimmerman, W.; Fiechter, A. 1994. Pectinolytic enzymes from actinomycetes for the degumming of ramie bast fibers. Applied and Environmental Microbiology 60: 2107-2112.
- Brühlmann, F.; Leupin, M.; Erismann, K.H.; Fiechter, A. 2000. Enzymatic degumming of ramie bast fibers. Journal of Biotechnology 76: 43-50.
- Cao, J.W.; Zheng, L.S.; Chen, S.Y. 1992. Screening of pectinase producer from alkalophilic bacteria and study on its potential application in degumming of ramie. Enzyme and Microbial Technology 14: 1013-1016.
- Dempsey, J.M. 1975. Fiber Crops. University Press of Florida, Gainesville, FL, USA.
- Deshpande, K.S.; Gurucharanam, K. 1985. Degumming of ramie fibres: role of cell wall degrading enzymes of Aspergillus versicolor. Indian Journal of Botany 8: 79-81.
- Dong, X.Z.; Cai, M.Y. 2001. Identification Manual for Routine Bacteriology. Scientific Press, Beijing, China (in Chinese).
- Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791.
- Fitch, W.M. 1972. Toward defining the course of evolution, minimum change for a specific tree topology. Systematic Zoology 20: 406-416.
- Ghosh, G.K.; Ghosh, S. 1995. Indian Textiles: Past and Present. APH Publishing, New Delhi, India.
- Gupta, D.P.C.; Sen, K.; Sen, K.S. 1976. Degumming of decorticated ramie for textile purposes. Cellulose Chemical Technology 10: 285-291.
- He, S.J.; Feng, X.M. 1997. Study on ramie by anaerobic bacteria degumming. III. Identification of degumming strains. China's Fiber Crops 19: 33-35 (in Chinese).
- Huang, J.L.; Wang, G.X.; Xiao, L. 2006. Cloning, sequencing and expression of the xylanase gene from a Bacillus subtilis strain B10 in Escherichia coli Bioresource Technology 97: 802-808.
- Jiang, F.C.; Shao, K. 2005. Method of Quantitative Analysis of Ramie Chemical Components GB 5889-1986. Standards Press of China, Beijing, China (in Chinese).
- Keen, N.T.; Dahlbeck, D.; Staskawicz, B.; Belser, W. 1984. Molecular cloning of pectate lyases genes from Erwinia chrysanthemi and their expression in Escherichia coli Journal of Bacteriology 159: 825-831.
- Kumar, S.; Tamura, K.; Nei, M. 2004. MEGA3, integrated software for molecular evolutionary genetics analysis and sequence alignment briefings. Bioinformatics 5: 150-163.
- Liu, Z.C.; Peng, Y.D.; Luo, C.A.; Feng, X.Y. 2001. Study on industrial application of a new technique for ramie degunming by microorganism. Journal of Textile Research 22: 27-29 (in Chinese).
- Mendoza, N.S.; Arai, M.; Sugimoto, K.; Ueda, M.; Kawaguchi, T.; Joson, L.M. 1995. Cloning and sequencing of β-mannanase gene from Bacillus subtilis NM-39. Biochimica et Biophysica Acta 1243: 552-554.
- Munshi, T.K.; Chattoo, B.B. 2008. Bacterial population structure of the jute-retting environment. Microbial Ecology 56: 270-282.
- Mussig, J.; Martens, R.; Haring, H. 1998. Hemp fiber as a textile resource. Textile Asia 29: 39-50.
- Paul, N.B.; Bhattacharya, S.K. 1979. The microbial degumming of raw ramie fibre. Journal of Textile Institute 10: 157-162.
- Peng, Y.D.; Feng, X.Y.; Liu, Z.C.; Sun, Q.X. 1995. Study on characters of bacteria for ramie degumming. China'S Fiber Crops 17: 32-35 (in Chinese).
- Puls, J. 1997. Chemistry and biochemistry of hemicellulose: relationship between hemicellulose structure and enzymes required for hydrolysis. Die Makromolekulare Chemie. Macromolecular Symposia 120: 183-196.
- Saitou, N.; Nei, M. 1987. The neighbor-joining method, a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4: 406-425.
- Sun, Q.X.; Wang, M.S.; Xun, M.C.; Gong, X.L.; Hao, L.M.; Shao, J.C.; Zhang, Y.Z. 1979. Study on ramie-degumming using Bacillus subtilis T66. Plant Fibers and Products 1: 31-35 (in Chinese).
- Sun, Q.X. 1981. Bio-degumming of bast fiber crops. China's Fiber Crops 3: 38-41 (in Chinese).
- Teather, R.M.; Wood, P.J. 1982. Use of Congo red-polysaccharide interactions in enumeration and characterization of cellulolytic bacteria from bovine rumen. Applied and Environmental Microbiology 43: 777-780.
- Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D. 1997. The Clustal-X windows interface, flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24: 4876-4882.
- Wang, X.S.; Liu, Z.C.; Li, B.; Feng, X.Y.; Duan, S.W.; Zheng, K.; Cheng, L.F. 2009. Study on the construction of special compound enzyme engineering strain for bio-extracting herbaceous fiber. Journal of Anhui Agricultural Science 37: 3928-3930 (in Chinese).
- Xiong, H.P. 2008. Breeding of Bast Fiber Crops. China Agriculture Press, Beijing, China (in Chinese).
- Yang, L.F.; Liu, Z.C.; Peng, Y.D.; Feng, X.Y.; Yang, X.A. 2001. Preliminary study on the types of retting enzymes from Baclillus polymyxa T1163 in the course of Kenaf fermention process. China's Fiber Crops 23: 11-18 (in Chinese).
- Zeng, Y.; Xiang, X.Z. 2007. Screening of strains for microbial degumming of rami. Journal of Textile Reseach 28: 73-75 (in Chinese).
- Zheng, L.S.; Du, Y.M.; Zhang, J.Y. 2001. Degumming of ramie fibers by alkalophilic bacteria and their polysaccharide-degrading enzymes. Bioresource Technology 78:





