Open-access Cactus-endophyte partnerships uncovered: genotype-dependent assemblages and growth-promoting functions in arid forages

ABSTRACT:

Semiarid-adapted species often harbor endophytic populations that help mitigate host plant stress. Thus, we evaluated the diversity and plant growth-promoting potential of endophytic bacteria from highly drought-resistant (HDR) (Opuntia undulata, O. stricta, and O. ficus-indica) and less-drought-resistant (LDR) (all O. cochenillifera) forage cactus cultivars. Purified isolates were characterized using BOX-PCR and grouped into 186 strains. We investigated the presence of acdS and nifH, indole-3-acetic acid (IAA), siderophore production, calcium phosphate solubilization, and osmotic stress adaptation in vitro, and these characteristics led to 25 groups at 100 % similarity. Representatives from each group were sent for 16S sequencing. Of the 186 strains, 24 were positive for acdS, 41 for nifH, 30 produced IAA, 75 produced siderophores, 15 solubilized phosphorus, and 66 supported at least one level of osmotic stress. Twelve genera were identified with 95-100 % identicality to the NCBI gene bank, including Acinetobacter, Bacillus, Burkholderia, Citrobacter, Desertihabitans, Enterobacter, Leclercia, Priestia, Pseudomonas, Ralstonia, Staphylococcus, and Stenotrophomonas. The HDR group had a higher proportion of acdS- and nifH-positive strains and more in vitro growth-promoting mechanisms. Although these results indicate a higher occurrence of bacteria with potential stress-reduction effects in the more resistant genotypes, this must be confirmed in plants under stressful environments.

Keywords:
acdS and nifH genes; abiotic stress mitigation; drought resistant; semiarid and arid environment; microorganism of biotechnological potential

Climate changes impact food production and affect most of the world's population (IPCC, 2022; Rodrigues et al., 2023). Drought stress reduces the yield and quality of most crops (Seleiman et al., 2021) and may be mitigated by endophytic bacteria (Fouda et al., 2021).

Endophytic bacteria reside in plant tissues exerting no damage and frequently have one or more mechanisms that promote plant growth or help mitigate biotic or abiotic stresses (Hardoim et al., 2015; Alves et al., 2023), usually called plant-growth-promoting bacteria (PGPB). PGPB are frequently associated with stress reduction through mechanisms such as suppression by ACC-deaminase, increased root length due to IAA production, increased P availability by phosphorus solubilization, or plant growth enhanced by biological nitrogen fixation (Pacifico et al., 2019; Alves et al., 2023).

Previous studies have demonstrated that bacterial strains from one plant species can also boost plant growth in other species, particularly under stressful conditions such as moderate drought or reduced soil fertility (Antunes et al., 2019; Cherif-Silini et al., 2019; Jochum et al., 2019; Alves et al., 2023). Azospirillum strains isolated from maize (Zea mays L.) have become the standard inoculant for both maize and wheat in Brazil (Santos et al., 2021).

Another example is how Pseudomonas sp. and Pantoea agglomerans reduced drought stress in both drought-tolerant and drought-sensitive wheat cultivars (Naderi et al., 2022). Similarly, endophytic bacteria from Euphorbia trigona Mill. enhanced drought tolerance and growth in tomato (Eke et al., 2019). Currently a commercial based on Bacillus aryabhattai isolated from the cactus Cereus jamacaru DC. rhizosphere is marketed for drought resistance in Brazil (Kavamura et al., 2013; NOOA Brasil, 2021).

Plants from arid and saline environments are frequently studied as sources of plant growth promoters (Cerqueira et al., 2012; Lima et al., 2015; Jain et al., 2021; Alves et al., 2023; Mendonça et al., 2024). Forage cactus (Opuntia spp.) is a major forage crop in the tropical semiarid region of Brazil, demonstrating exceptional drought resilience (Silva et al., 2015; Govindasamy et al., 2022). The cultivars currently recommended exhibit varying levels of drought resistance (Silva and Sampaio, 2015), but these cultivars have not been studied concerning their bacterial endophytes. Therefore, we investigated the diversity of endophytic bacteria and their plant-growth-promoting traits in six forage cactus cultivars, classified as highly drought-resistant or less drought-resistant.

Forage cactus was collected at the Active Germplasm Bank of the Instituto Agronômico de Pernambuco (8°26’02.8" S, 37°03’21.1" W, altitude 644 m) located in the municipality of Arcoverde, in the state of Pernambuco, Brazil, with a BSh semiarid climate with average annual temperature of 23.5 °C according to Climate Data (Clima-Date, 2022). Three cladodes were collected from each of six genotypes, with three classed as HDR (‘orelha de elefante africana’ – OEA, O. undulata, Griffiths ‘orelha de elefante mexicana’ – OEM, O. stricta (Haw.) Haw., and ‘IPA 20’, O. ficus-indica (L.) Mill.) and three as LDR (‘miúda de nopalea’, ‘F21’ and ‘IPA Sertânia’, all classed as O. cochenillifera (L.) Mill.), based on their field survival under major several-year droughts (Silva and Sampaio, 2015). All cladodes were stored at 24 °C until isolation.

Before isolation, the cladodes were washed with detergent and superficially disinfected with 70 % ethanol for 30 s, 2.5 % sodium hypochlorite for 5 min, and triple-washed in sterile distilled water, as a standard practice for endophytic isolation in other plant parts (Mendonça et al., 2024). After this, 10 g of samples were ground with 90 mL of autoclaved 8.5 % (m:v) NaCl solution and serially diluted 10× from 10–1 to 10–6. 1 mL from each dilution was streaked in triplicate on tryptic soy agar (TSA) Petri dishes and incubated at 28 °C, to allow for a larger sampling size than a more restricted medium would.

The plates were observed daily, and isolated colonies were used for purification. Overall, the population was determined by counting in the dilutions which yielded 30 to 300 individual colonies. All isolates were submitted to DNA extraction by bead beating (Cullen and Hirsch, 1998), following a five-day incubation in tryptic soy (TS) medium at ca. 16 rad s–1. DNA samples were observed using a 0.5 % agarose gel at 100 V for 30 min and visualization under UV light.

DNA fingerprinting was conducted by BOX-PCR (BOX-A1R - CTACGGCAAGGCGACGCTGACG (Versalovic et al, 1994), coloring with Sybr Green and precipitation with Luria Broth (LB) before electrophoresis in 1.7 % agarose gel at 65 V for 6 h with a 100-base pair (bp) molecular marker (Sinapse) for reference, visualization and documentation under UV light. Dendrograms were drawn using the Gelj software (version 2.3, 2015) with the Jaccard coefficient and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) algorithm (Delamuta et al., 2017). Groups with 100 % similarity were deemed to be individual strains and used for diversity evaluation through the Shannon diversity and Simpson indexes, and for all remaining evaluations.

All strains were evaluated by PCR for the presence of ACC deaminase (DegACCf – GGBGGVAAYAARMYVMGSAAGCTYGA and DegACCr – TTDCCHKYRTANACBGGRTC) (Nikolic et al, 2011) and nitrogenase (FGPH192 – TACGGCAARGGTGGNATH (Simonet et al, 1991) and PolR3 - ATSGCCATCATYTCRCCG (Poly et al, 2001)) (genes, colored with Sybr Green, and precipitated with LB. This was followed by electrophoresis in a 1 % agarose gel at 100 V for 30 min with a 100 bp molecular marker (Sinopse). For both genes, fragments with ca. 450 bp were considered positive.

For IAA production, each strain was cultivated in Tryptic soy broth (TSB) media (10 %) with 5 mM of L-tryptophan at ca. 16 rad s–1 for five days, followed by centrifugation of 1.5 mL at 9500 g for 5 min. Fifty µL of the supernatant was transferred to ELISA plates in triplicate, and 200 µL of Salkovisk solution was added (Sergeeva et al., 2002). After 30 min in the dark, each strain was read by a Biotek H1 microplate reader at 530 nm. IAA production was evaluated by a standard curve and classified as low (< 15 ng mL–1), average (≥ 15 and ≤ 30), high (≥ 30 and < 45 ng mL–1), and very high (> 45 ng mL–1) yield (Brigido et al., 2017).

For siderophore production, each strain was cultivated in King's B medium under similar conditions to IAA production, followed by the same centrifugation protocol, transference of 100 µL to ELISA plates in triplicate, and 100 µL of chrome azurol S solution (Schwyn and Neilands, 1987). The same evaluation protocol, with the use of the Payne equation (Payne, 1994), was applied to classify as low (< 30 %), average (> 30 and ≤ 50 %), and high (> 50 %) yields (Arora and Verma, 2017).

For calcium phosphate solubilization, each strain was cultivated in yeast mannitol (YM) medium under conditions similar to the previous analysis and inoculated in three points of a Petri dish with NBRIP medium, incubated for 15 days at 28 °C, and identified as solubilizers by a solubilization halo (Nautiyal, 1999). A solubilization index was determined by a ratio of the halo and colony diameters and classified as low (< 2), average (2 > and < 4)- and high (> 4) solubilizers.

Osmotic stress resistance was evaluated by growth on water restricted medium (Mergeay et al., 1985) using PEG8000. Each strain was cultivated in YM medium under similar conditions, except for 48 h, followed by inoculation YM medium with 0, 10, 20 and 30 % of PEG8000, and 100 µL were inoculated into the ELISA plates. After five days of growth, the growth was read at 600 nM by a Biotek H1 microplate reader, with an optical density ≥ 2, the level which indicates osmoadaptive strains (Nordstedt and Jones, 2020).

All strains were grouped according to the growth promotion mechanisms using PAST (PAleontological Statistics, version 4.03), and a representative from each 100 % group was selected for 16S sequencing after PCR (primers 27F – AGAGTTTGATCMTGGCTCAG and 1492R – TACGGTTAACCTTGTTACGACTT) (Weisburg et al, 1991). PCR products were evaluated as previously described, and those with ca. 1,400 bp (Neilan et al., 1997) were sent for nucleotide sequencing at Macrogen. The nucleotide sequences received were submitted to quality check using BioEdit (Sequence Alignment Editor, version 7.2.5.0) and compared to national center for the biotechnology information (NCBI) using MEGABLAST for molecular identity evaluation utilizing Clustal W in the MEGA (Molecular Evolutionary Genetics Analysis, version 11, 2021).

Bilateral t tests were used to compare population, strain number, and diversity indexes between the two cultivar groups at 10 % significance, considering cultivars as repetitions for each cultivar group. The χ2 was used at the same significance level to compare the presence of genes for ACC Deaminase and nitrogenase and the different levels of IAA and siderophore production, phosphate solubilization, and osmotic adaptation.

Although the HDR's average endophytic bacteria populations and isolate numbers were higher than those of the LDR, this difference was not significant (Table 1). Overall, 241 isolates were obtained, of which 190 had successful DNA extraction, yielding 185 unique strains with 100 % similarity. The diversity indexes also presented the same pattern of higher values for the HDR group, though not significantly.

Table 1
Averages and standard deviations for endophytic bacteria population, number of isolates and strains and diversity indexes for forage cacti from two different drought resistance levels.

Bacterial characteristics like acdS or nifH presence (and thus the potential for expressing ACC deaminase and nitrogenase) were significantly more frequent for HDR than LDR, with the same pattern occurring for low and average IAA production but not for the remaining potential plant-growth-promoting mechanisms (Table 2). While 38 strains did not show any potentially plant-growth-promoting or stress-reducing mechanisms, four presented up to four (all in the HDR cultivar group 4), and most presented either one or two mechanisms (Table 3).

Table 2
Comparison of plant-growth-promoting and stress-reducing characteristics of endophytic bacteria from two forage cacti genotype groups.
Table 3
Number of plant-growth-promoting or stress-reducing mechanisms found in endophytic bacteria strains from two groups of forage cacti cultivars.

All strains selected for the 16S sequencing presented similarity levels from 95 % to 100 % with strains already in NCBI, and 12 genera were identified (Table 4). Both Acinetobacter and Bacillus had five strains each. In comparison, three strains were identified as Stenotrophomonas, two each as Pseudomonas, Ralstonia, and Staphilococcus, and single strains of Burkholderia, Citrobacter, Desertihabitans, Enterobacter, Leclercia, and Priestia.

Table 4
Representative strains of endophytic bacteria from forage cactus, their corresponding genus, similarity level and GenBank access number and identified plant-growth-promoting and stress-reducing characteristics.

A large proportion of the 185 strains isolated from forage cactus have shown at least a putative plant growth-promoting mechanism, with a significantly higher frequency of strains with mechanisms commonly linked to drought resistance, such as ACC deaminase, nitrogen fixation, and IAA production in the HDR cultivar group. This might indicate these bacteria are a partial cause of higher resistance, but this can be verified by comparing similar pairings in other crops, preferably from different environments. If repeated, this might indicate an ecological or environmental pattern.

The absence of significant differences in endophytic bacteria population or isolate number between the genotype groups is consistent with results from sugarcane and Eucalyptus (Dasgupta et al., 2020; Singh et al., 2022). However, since each forage cactus group had only three cultivars, this could also be explained by relatively low statistical power. This might be remedied in future research by the evaluation of larger groups of cultivars from a single species, or by evaluation of paired groups from different crops.

Although we did not measure ACC deaminase activity, the 13 % of strains positive for its gene is a much higher proportion than that usually observed and concurs with the high proportion found in previous research with this genus (Govindasamy et al., 2022). Strains isolated from the HDR group were more likely to present this gene (Table 3), as was also observed in the comparison of E. tereticornis and E. camaldulensis, in which the more resistant E. tereticornis had a higher proportion of bacteria with this kind of mechanism (Dasgupta et al., 2020). Since ACC deaminase is an immediate precursor to ethylene (Maheshwari et al., 2020) its production might reduce excessive ethylene synthesis under stressful environments such as drought (Orozco-Mosqueda et al., 2020).

As IAA production generally leads to higher root lengths and thus better soil exploration, it is worthwhile noting that strains from the HDR cultivar group also had a significantly higher proportion of strains with some level of IAA production (Table 3), as had already been found in this genus (Costa and Melo, 2012). Since IAA leads to increased specific root surface, which is known to increase water absorption under water-limited environments (Mohammadi Alagoz et al., 2023), strains with this characteristic tend to be in demand for their plant growth potential. An evaluation of Opuntia microbiomes over an aridity gradient in Tunisia also found a significant effect of the gradient on IAA production (Karray et al., 2020). Although correlation is not causation, this may indicate that endophytic bacteria with these mechanisms may indeed contribute to a higher drought tolerance.

The relatively high occurrence of nifH, with 22 % of the strains presenting this gene, was also found previously in this genus (Costa and Melo, 2012; Lyra et al., 2013). At the same time, a significant difference between the cultivar groups was also found between sugarcane genotypes (Singh et al., 2022). The most commonly found mechanisms were siderophore production, osmotic adaptation, and nifH presence, as had also been seen in rice-isolated bacterial endophytes (Walitang et al., 2017).

The identified bacterial genera Acinetobacter, Bacillus, and Stenotrophomonas (12 %), Staphylococcus, Ralstonia, and Pseudomonas (8 %), and Leclercia, Desertihabitans, Citrobacter, Burkholderia, Priestia, and Enterobacter (4 %) are commonly found in endophytic communities of semiarid and arid regions (Eke et al., 2019; Liu et al., 2021; Alves et al., 2023). Interestingly, strains from several of these genera are well-known as plant growth promoters (Escobar Rodríguez et al., 2018; Mashiane et al., 2018; Eke et al., 2019; Liu et al., 2021; Alves et al., 2022).

Thus, the higher proportion of endophytic bacteria with stress-reducing characteristics in higher-drought-resistant cultivars may indicate that these play a role in higher resistance. The endophytic bacteria genera found in Opuntia cultivars are commonly found in several semiarid and arid environments and include strains with known plant-promoting potential, which indicate these strains merit further investigation for this purpose.

  • Declaration of use of AI Technologies
    The authors declare that they did not use AI Technologies.

Data availability statement

The authors confirm that the data supporting this study's findings are available with the article. Raw data supporting this study's findings are available from the corresponding author. The complete list of the bacterial strains, including their plant-growth-potential characterization, is available from the corresponding author.

Acknowledgments

This work was funded by Conselho Nacional de Pesquisa e Desenvolvimento Científico e Tecnológico (CNPq), grant numbers 304107/2020-4, 306252/2021-0, and 309787/2023-8 and 141411/2023-6; Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), finance code 001, and Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco (FACEPE), grant numbers BCT-0406-5.03/21, APQ-0453-5.01/15, IBPG-0818-5.01/21 and BPV-0008-5.01/19.

References

  • Alves MJG, Oliveira CS, Vitalino GM, Carvalho EX, Oliveira JP, Fracetto GGM, et al. 2022. Associative bacterial diversity of pangolão, a stress-resilient tropical grass. Bragantia 81: e20220071. https://doi.org/10.1590/1678-4499.20220071
    » https://doi.org/10.1590/1678-4499.20220071
  • Alves MJG, Mendonça JJ, Vitalino GM, Oliveira JP, Carvalho EX, Fracetto FJC, et al. 2023. Screening Digitaria eriantha cv. suvernola endophytic bacteria for maize growth promotion. Plants 12: 2589. https://doi.org/10.3390/plants12142589
    » https://doi.org/10.3390/plants12142589
  • Antunes GR, Santana SRA, Escobar IEC, Brasil MS, Araújo GGLD, Voltolini TV, et al. 2019. Associative diazotrophic bacteria from forage grasses in the Brazilian semi-arid region are effective plant growth promoters. Crop and Pasture Science 70: 899-907. https://doi.org/10.1071/CP19076
    » https://doi.org/10.1071/CP19076
  • Arora NK, Verma M. 2017. Modified microplate method for rapid and efficient estimation of siderophore produced by bacteria. Biotech 7: 381. https://doi.org/10.1007/s13205-017-1008-y
    » https://doi.org/10.1007/s13205-017-1008-y
  • Brigido C, Glick BR, Oliveira S. 2017. Survey of plant growth-promoting mechanisms in native Portuguese chickpea mesorhizobium isolates. Microbial Ecology 73: 900-915. https://doi.org/10.1007/s00248-016-0891-9
    » https://doi.org/10.1007/s00248-016-0891-9
  • Cerqueira VS, Hollenbach EB, Maboni F, Camargo FAO, Peralba MCR, Bento FM. 2012. Bioprospection and selection of bacteria isolated from environments contaminated with petrochemical residues for application in bioremediation. World Journal of Microbiology and Biotechnology 28: 1203-1222. https://doi.org/10.1007/s11274-011-0923-z
    » https://doi.org/10.1007/s11274-011-0923-z
  • Cherif-Silini H, Thissera B, Bouket AC, Saadaoui N, Silini A, Eshelli M, et al. 2019. Durum wheat stress tolerance induced by endophyte pantoea agglomerans with genes contributing to plant functions and secondary metabolite arsenal. International Journal of Molecular Sciences 20: 3989. https://doi.org/10.3390/ijms20163989
    » https://doi.org/10.3390/ijms20163989
  • Clima-Date. 2022. Clima e condições meteorológicas em Arcoverde no ano todo. Weather Spark. Available at: https://pt.weatherspark.com/y/31187/Clima-caracter%C3%ADstico-em-Arcoverde-Brasil-durante-o-ano [Accessed Feb 20, 2022] (in Portuguese).
    » https://pt.weatherspark.com/y/31187/Clima-caracter%C3%ADstico-em-Arcoverde-Brasil-durante-o-ano
  • Costa FEC, Melo IS. 2012. Endophytic and rhizospheric bacteria from Opuntia ficus-indica mill and their ability to promote plant growth in cowpea, Vigna unguiculata (L.) Walp. African Journal of Microbiology Research 6: 1345-1353. https://doi.org/10.5897/AJMR11.1503
    » https://doi.org/10.5897/AJMR11.1503
  • Cullen DW, Hirsch PR. 1998. Simple and rapid method for direct extraction of microbial DNA from soil for PCR. Soil Biology and Biochemistry 30: 983-993. https://doi.org/10.1016/S0038-0717(98)00001-7
    » https://doi.org/10.1016/S0038-0717(98)00001-7
  • Dasgupta MG, Burragoni S, Amrutha S, Muthupandi M, Parveen ABM, Sivakumar V, et al. 2020. Diversity of bacterial endophyte in Eucalyptus clones and their implications in water stress tolerance. Microbiological Research 241: 126579. https://doi.org/10.1016/j.micres.2020.126579
    » https://doi.org/10.1016/j.micres.2020.126579
  • Delamuta JRM, Menna P, Ribeiro RA, Hungria M. 2017. Phylogenies of symbiotic genes of Bradyrhizobium symbionts of legumes of economic and environmental importance in Brazil support the definition of the new symbiovars pachyrhizi and sojae. Systematic and Applied Microbiology 40: 254-265. https://doi.org/10.1016/j.syapm.2017.04.005
    » https://doi.org/10.1016/j.syapm.2017.04.005
  • Eke P, Kumar A, Sahu KP, Wakam LN, Sheoran N, Ashajyothi M, et al. 2019. Endophytic bacteria of desert cactus (Euphorbia trigonas Mill) confer drought tolerance and induce growth promotion in tomato (Solanum lycopersicum L.). Microbiological Research 228: 126302. https://doi.org/10.1016/j.micres.2019.126302
    » https://doi.org/10.1016/j.micres.2019.126302
  • Escobar Rodríguez C, Mitter B, Antonielli L, Trognitz F, Compant S, Sessitsch A. 2018. Roots and Panicles of the C4 Model grasses Setaria viridis (L). and S. pumila host distinct bacterial assemblages with core taxa conserved across host genotypes and sampling sites. Frontiers in Microbiology 9: 2708. https://doi.org/10.3389/fmicb.2018.02708
    » https://doi.org/10.3389/fmicb.2018.02708
  • Fouda A, Eid AM, Elsaied A, El-Belely EF, Barghoth MG, Azab E, et al. 2021. Plant growth-promoting endophytic bacterial community inhabiting the leaves of Pulicaria incisa (Lam.) DC inherent to arid regions. Plants 10: 76. https://doi.org/10.3390/plants10010076
    » https://doi.org/10.3390/plants10010076
  • Govindasamy V, George P, Ramesh SV, Sureshkumar P, Rane J, Minhas PS. 2022. Characterization of root-endophytic actinobacteria from cactus (Opuntia ficus-indica for plant growth promoting traits. Archives of Microbiology 204: 150. https://doi.org/10.1007/s00203-021-02671-2
    » https://doi.org/10.1007/s00203-021-02671-2
  • Hardoim PR, van Overbeek LS, Berg G, Pirttilä AM, Compant S, Campisano A, et al. 2015. The hidden world within plants: Ecological and evolutionary considerations for defining functioning of microbial endophytes. Microbiology and Molecular Biology Reviews 79: 293-320. https://doi.org/10.1128/MMBR.00050-14
    » https://doi.org/10.1128/MMBR.00050-14
  • Intergovernmental Panel on Climate Change [IPCC]. 2022. Summary for policymakers. p. 1-51. In: Shukla PR, Skea J, et al. eds. Climate change 2022: mitigation of climate change. Cambridge University Press, Cambridge, UK.
  • Jain R, Bhardwaj P, Panday SS, Kumar S. 2021. Arnebia euchroma, a plant species of cold desert in the Himalayas, harbors beneficial cultivable endophytes in roots and leaves. Frontiers in Microbiology 12: 696667. https://doi.org/10.3389/fmicb.2021.696667
    » https://doi.org/10.3389/fmicb.2021.696667
  • Jochum MD, McWilliams KL, Borrego EJ, Kolomiets MV, Niu G, Pierson EA, et al. 2019. Bioprospecting plant growth-promoting rhizobacteria that mitigate drought stress in grasses. Frontiers in Microbiology 10: 2106. https://doi.org/10.3389/fmicb.2019.02106
    » https://doi.org/10.3389/fmicb.2019.02106
  • Karray F, Gargouri M, Chebaane A, Mhiri N, Mliki A, Sayadi S. 2020. Climatic aridity gradient modulates the diversity of the rhizosphere and endosphere bacterial microbiomes of Opuntia ficus-indica Frontiers in Microbiology 11: 1622. https://doi.org/10.3389/fmicb.2020.01622
    » https://doi.org/10.3389/fmicb.2020.01622
  • Kavamura VN, Santos SN, Silva JL, Parma MM, Avila LA, Visconti A, et al. 2013. Screening of Brazilian cacti rhizobacteria for plant growth promotion under drought. Microbiological Research 168: 183-191. https://doi.org/10.1016/j.micres.2012.12.002
    » https://doi.org/10.1016/j.micres.2012.12.002
  • Lima JVL, Weber OB, Correia D, Soares MA, Senabio JA. 2015. Endophytic bacteria in cacti native to a Brazilian semi-arid region. Plant and Soil 389: 25-33. https://doi.org/10.1007/s11104-014-2344-x
    » https://doi.org/10.1007/s11104-014-2344-x
  • Liu S, Wang T, Lu Q, Li F, Wu G, Jiang Z, et al. 2021. Bioprospecting of soil-derived actinobacteria along the alar-hotan desert highway in the Taklamakan desert. Frontiers in Microbiology 12: 604999. https://doi.org/10.3389/fmicb.2021.604999
    » https://doi.org/10.3389/fmicb.2021.604999
  • Lyra MCCP, Santos DC, Mondragon-Jacobo C, Silva MLRB, Mergulhão ACES, Martínez-Romero E. 2013. Isolation and molecular characterization of endophytic bacteria associated with the culture of forage cactus (Opuntia spp.). Journal of Applied Biology & Biotechnology 1: 11-16.
  • Maheshwari R, Bhutani N, Suneja P. 2020. Isolation and characterization of ACC deaminase producing endophytic Bacillus mojavensis PRN2 from Pisum sativum Iranian Journal of Biotechnology 18: 11-20. https://doi.org/10.30498/IJB.2020.137279.2308
    » https://doi.org/10.30498/IJB.2020.137279.2308
  • Mashiane AR, Adeleke RA, Bezuidenhout CC, Chirima GJ. 2018. Community composition and functions of endophytic bacteria of Bt maize. South African Journal of Science 114: 88-97. https://doi.org/10.17159/sajs.2018/20170018
    » https://doi.org/10.17159/sajs.2018/20170018
  • Mendonça JJ, Alves MJG, Vitalino GM, Barreto MCS, Carvalho EX, Oliveira JP, et al. 2024. Effect of Digitaria eriantha endophytic bacteria on maize growth in a hydroponic system. Agronomy 14: 2769. https://doi.org/10.3390/agronomy14122769
    » https://doi.org/10.3390/agronomy14122769
  • Mergeay M, Nies D, Schlegel HG, Gerits J, Charles P, Van Gijseghem F. 1985. Alcaligenes eutrophus CH34 is a facultative chemolithotroph with plasmid-bound resistance to heavy metals. Journal of Bacteriology 162: 328-334. https://doi.org/10.1128/jb.162.1.328-334.1985
    » https://doi.org/10.1128/jb.162.1.328-334.1985
  • Mohammadi Alagoz S, Zahra N, Hajiaghaee Kamrani M, Asgari Lajayer B, Nobaharan K, Astatkie T, et al. 2023. Role of root hydraulics in plant drought tolerance. Journal of Plant Growth Regulation 42: 6228-6243. https://doi.org/10.1007/s00344-022-10807-x
    » https://doi.org/10.1007/s00344-022-10807-x
  • Naderi K, Etesami H, Alikhani HA, Mosleh Arani A. 2022. Potential use of endophytic and rhizosheath bacteria from the desert plant Stipagrostis pennata as biostimulant against drought in wheat cultivars. Rhizosphere 24: 100617. https://doi.org/10.1016/j.rhisph.2022.100617
    » https://doi.org/10.1016/j.rhisph.2022.100617
  • Nautiyal CS. 1999. An efficient microbiological growth medium for screening phosphate solubilizing microorganisms. FEMS Microbiology Letters 170: 265-270. https://doi.org/10.1111/j.1574-6968.1999.tb13383.x
    » https://doi.org/10.1111/j.1574-6968.1999.tb13383.x
  • Neilan BA, Jacobs D, Therese DD, Blackall LL, Hawkins PR, Cox PT, et al. 1997. rRNA sequences and evolutionary relationships among toxic and nontoxic cyanobacteria of the genus Microcystis International Journal of Systematic Bacteriology 47: 693-697. https://doi.org/10.1099/00207713-47-3-693
    » https://doi.org/10.1099/00207713-47-3-693
  • Nikolic B, Schwab H, Sessitsch A. 2011. Metagenomic analysis of the 1-aminocyclopropane-1-carboxylate deaminase gene (acdS operon of an uncultured bacterial endophyte colonizing Solanum tuberosum L. Archives of Microbiology 193: 665-676. https://doi.org/10.1007/s00203-011-0703-z
    » https://doi.org/10.1007/s00203-011-0703-z
  • NOOA Brasil. 2021. Auras: redutor dos efeitos de estresse. NOOA Ciência e Tecnologia Agrícola. Available at: https://www.nooabrasil.com.br/auras [Accessed Feb 20, 2022] (in Portuguese).
    » https://www.nooabrasil.com.br/auras
  • Nordstedt NP, Jones ML. 2020. Isolation of rhizosphere bacteria that improve quality and water stress tolerance in greenhouse ornamentals. Frontiers in Plant Science 11: 826. https://doi.org/10.3389/fpls.2020.00826
    » https://doi.org/10.3389/fpls.2020.00826
  • Orozco-Mosqueda MDC, Glick BR, Santoyo G. 2020. ACC deaminase in plant growth-promoting bacteria (PGPB): an efficient mechanism to counter salt stress in crops. Microbiological Research 235: 126439. https://doi.org/10.1016/j.micres.2020.126439
    » https://doi.org/10.1016/j.micres.2020.126439
  • Pacifico D, Squartini A, Crucitti D, Barizza E, Lo Schiavo F, Muresu R, et al. 2019. The role of the endophytic microbiome in the grapevine response to environmental triggers. Frontiers in Plant Science 10: 1256. https://doi.org/10.3389/fpls.2019.01256
    » https://doi.org/10.3389/fpls.2019.01256
  • Payne SM. 1994. Detection, isolation, and characterization of siderophores. Methods in Enzymology 235: 329-344. https://doi.org/10.1016/0076-6879(94)35151-1
    » https://doi.org/10.1016/0076-6879(94)35151-1
  • Poly F, Monrozier LJ, Bally R. 2001. Improvement in the RFLP procedure for studying the diversity of nifH genes in communities of nitrogen fixers in soil. Research in Microbiology 152: 95-103. https://doi.org/10.1016/S0923-2508(00)01172-4
    » https://doi.org/10.1016/S0923-2508(00)01172-4
  • Rodrigues CID, Brito LM, Nunes LJR. 2023. Soil carbon sequestration in the context of climate change mitigation: a review. Soil Systems 7: 64.https://doi.org/10.3390/soilsystems7030064
    » https://doi.org/10.3390/soilsystems7030064
  • Santos MS, Nogueira MA, Hungria M. 2021. Outstanding impact of Azospirillum brasilense strains Ab-V5 and Ab-V6 on the Brazilian agriculture: lessons that farmers are receptive to adopt new microbial inoculants. Revista Brasileira de Ciência do Solo 45: e00128. https://doi.org/10.36783/18069657RBCS20200128
    » https://doi.org/10.36783/18069657RBCS20200128
  • Schwyn B, Neilands JB. 1987. Universal chemical assay for the detection and determination of siderophores. Analytical Biochemistry 160: 47-56. https://doi.org/10.1016/0003-2697(87)90612-9
    » https://doi.org/10.1016/0003-2697(87)90612-9
  • Seleiman MF, Al-Suhaibani N, Ali N, Akmal M, Alotaibi M, Refay Y, et al. 2021. Drought stress impacts on plants and different approaches to alleviate its adverse effects. Plants 10: 259. https://doi.org/10.3390/plants10020259
    » https://doi.org/10.3390/plants10020259
  • Sergeeva M, Strokin M, Wang H, Ubl JJ, Reiser G. 2002. Arachidonic acid and docosahexaenoic acid suppress thrombin-evoked Ca2+ response in rat astrocytes by endogenous arachidonic acid liberation. Journal of Neurochemistry 82: 1252-1261. https://doi.org/10.1046/j.1471-4159.2002.01052.x
    » https://doi.org/10.1046/j.1471-4159.2002.01052.x
  • Silva MLRB, Figueirôa CS, Mergulhão ACES, Lyra MCCP. 2015. Identification of diazotrophs isolated from palm cultivars (Opuntia and Nopalea using the recA gene. Bioscience Journal 31: 577-583 (in Portuguese, with abstract in English). https://doi.org/10.14393/BJ-v31n2a2015-18244
    » https://doi.org/10.14393/BJ-v31n2a2015-18244
  • Silva RR, Sampaio EVSB. 2015. Palmas forrageiras Opuntia ficus-indica e Nopalea cochenillifera: sistemas de produção e usos. Revista Geama 1: 151-161 (in Portuguese, with abstract in English).
  • Simonet P, Grosjean MC, Misra AK, Nazaret S, Cournoyer B, Normand P. 1991. Frankia genus-specific characterization by polymerase chain reaction. Applied and Environmental Microbiology 57: 3278-3286. https://doi.org/10.1128/aem.57.11.3278-3286.1991
    » https://doi.org/10.1128/aem.57.11.3278-3286.1991
  • Singh RK, Singh P, Sharma A, Guo DJ, Upadhyay SK, Song QQ, et al. 2022. Unraveling nitrogen fixing potential of endophytic diazotrophs of different Saccharum species for sustainable sugarcane growth. International Journal of Molecular Sciences 23: 6242. https://doi.org/10.3390/ijms23116242
    » https://doi.org/10.3390/ijms23116242
  • Versalovic J, Schneider M, de Bruijn FJ, Lupski JR. 1994. Genomic fingerprinting of bacteria using repetitive sequence-based polymerase chain reaction. Methods in Molecular and Cellular Biology 5: 25-40.
  • Walitang DI, Kim K, Madhaiyan M, Kim YK, Kang Y, Sa T. 2017. Characterizing endophytic competence and plant growth promotion of bacterial endophytes inhabiting the seed endosphere of rice. BMC Microbiology 17: 209. https://doi.org/10.1186/s12866-017-1117-0
    » https://doi.org/10.1186/s12866-017-1117-0
  • Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 1991. 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology 173: 697-703. https://doi.org/10.1128/jb.173.2.697-703.1991
    » https://doi.org/10.1128/jb.173.2.697-703.1991

Edited by

Publication Dates

  • Publication in this collection
    17 Apr 2026
  • Date of issue
    2026

History

  • Received
    13 Aug 2024
  • Accepted
    24 May 2025
location_on
Escola Superior de Agricultura "Luiz de Queiroz" USP/ESALQ - Scientia Agricola, Av. Pádua Dias, 11, 13418-900 Piracicaba SP Brazil, Phone: +55 19 3429-4401 / 3429-4486 - Piracicaba - SP - Brazil
E-mail: scientia@usp.br
rss_feed Acompanhe os números deste periódico no seu leitor de RSS
Ir para o topo Reportar erro