A new Echimyidae (Mammalia, Rodentia) host of <i>Amblyomma ovale</i> Koch, 1844 in the eastern Brazilian Amazon, and a pathogen survey

Chagas-de-Souza, Darlison; Silva, Cláudia Regina; Alves-Coêlho, Tássio; Bassini-Silva, Ricardo; Jacinavicius, Fernando de Castro; Labruna, Marcelo Bahia; Viana, Lúcio André

doi:10.1590/S1984-29612025044

Tabla de contenido Anterior Actual Siguiente

Tabla de contenido

Short Communication • Rev. Bras. Parasitol. Vet. 34 (3) • 2025 • https://doi.org/10.1590/S1984-29612025044 linkcopy

A new Echimyidae (Mammalia, Rodentia) host of Amblyomma ovale Koch, 1844 in the eastern Brazilian Amazon, and a pathogen survey

Um novo hospedeiro Echimyidae (Mammalia, Rodentia) para Amblyomma ovale Koch, 1844 na Amazônia oriental brasileira, e uma pesquisa de patógenos

Authorship SCIMAGO INSTITUTIONS RANKINGS

The genus Amblyomma has the largest number of tick species in the Neotropical region. Amblyomma ovale displays high ecological plasticity and can be found in different habitats and a variety of vertebrate hosts. Small mammals of the family Echimyidae have been identified as hosts for this species. However, studies investigating their role as hosts of these ticks in the Amazon region are lacking. The present study aims to record the parasitic association between A. ovale and a Echimyidae species (Proechimys cuvieri) in the extreme north of the Brazilian Amazon, providing information about the research of potentially pathogenic organisms. Eight nymphs were collected and subjected to taxonomic and molecular identification, and pathogen screening was performed on the family Anaplasmataceae agents and the genera Bartonella, Coxiella, Hepatozoon, Mycoplasma, and Rickettsia. All the ticks were identified morphologically and molecularly as A. ovale, but PCR assays for pathogen detection showed no positive results for the target genes. This is the first time that A. ovale has been associated with P. cuvieri.

Keywords:
Amblyomma; Brazilian Amazon; host-parasite interactions; Rodentia; Ixodidae

Microorganisms	Primers Sequences	PCR conditions	References
Anaplasmataceae	5’-GGTACCYACAGAAGAAGTCC-3’	95 °C for 5’; 95 °C for 30”; 55 °C for 30”; 72 °C for 1,30’ (34x); 72 °C for 5’; 4 °C for ∞	Inokuma et al. (2000)
Anaplasmataceae	5’-TAGCACTCATCGTTTACAG-3’		Inokuma et al. (2000)
Bartonella spp.	5’- GGCGTGATTGTTCTCGTTA-3’	94 °C for 5’; 94 °C for 30”; 53 °C for 30”; 72 °C for 1’ (35x); 72 °C for 5’; 4 °C for ∞	Colborn et al. (2010)
Bartonella spp.	5’- CACGACCACGGCTATCAAT-3’		Colborn et al. (2010)
Coxiella spp.	5’- TATGTATCCACCGTAGCCAGTC -3’	95 °C for 5’; 95 °C for 30”; 60 °C for 30”; 72 °C for 1’ (40x); 72 °C for 7’; 4 °C for ∞	Hoover et al. (1992)
Coxiella spp.	5’- CCCAACAACACCTCCTTATTC -3’		Hoover et al. (1992)
Hepatozoon spp.	5’- CGCGAAATTACCCAATTCTA-3’	95 °C for 3’; 95 °C for 15”; 53 °C for 40”; 72 °C for 40’ (40x); 72 °C for 5’; 4 °C for ∞	Spolidorio et al. (2009)
Hepatozoon spp.	5’- TAAGGTGCTGAAGGAGTCGTTTAT-3’		Spolidorio et al. (2009)
Mycoplasma spp.	5′ - AGAGTTTGATCCTGGCTCAG - 3'	95 °C for 5’; 95 °C for 30”; 57 °C for 30”; 72 °C for 1’ (35X); 72 °C for 10’; 4 °C for ∞	Di Cataldo et al. (2020)
	5′ - TACCTTGTTACGACTTAACT - 3′
	5′- GYATGCMTAAYACATGCAAGTCGARCG -3′
	5′ - CTCCACCACTTGTTCAGGTCCCCGTC - 3′
Rickettsia spp.	5′ - GCAAGTATCGGTGAGGATGTAAT- 3′	95 °C for 3’; 95 °C for 15”; 48 °C for 30”; 72 °C for 30” (40x); 72 °C for 7’; 4 °C for ∞	Labruna et al. (2004)
Rickettsia spp.	5′ - GCTTCCTTAAAATTCAATAAATCAGGAT- 3′		Labruna et al. (2004)

location_on

Colégio Brasileiro de Parasitologia Veterinária FCAV/UNESP - Departamento de Patologia Veterinária, Via de acesso Prof. Paulo Donato Castellane s/n, Zona Rural, , 14884-900 Jaboticabal - SP, Brasil, Fone: (16) 3209-7100 RAMAL 7934 - Jaboticabal - SP - Brazil
E-mail: cbpv_rbpv.fcav@unesp.br

rss_feed Acompañe los números de esta revista en su lector de RSS