Logomarca do periódico: Genetics and Molecular Biology

Open-access Genetics and Molecular Biology

Publicación de: Sociedade Brasileira de Genética
Área: Ciências Biológicas
Versión impresa ISSN: 1415-4757
Versión on-line ISSN: 1678-4685
Titulo anterior Brazilian Journal of Genetics
Creative Common - by 4.0

Tabla de contenido

Genetics and Molecular Biology, Volumen: 27, Numero: 2, Publicado: 2004

Genetics and Molecular Biology, Volumen: 27, Numero: 2, Publicado: 2004

Document list
Documents
Human and Medical Genetics
CYP1A1, CYP2E1, GSTM1, GSTT1, GSTP1, and TP53 polymorphisms: do they indicate susceptibility to chronic obstructive pulmonary disease and non-small-cell lung cancer? Gaspar, Pedro Moreira, José Kvitko, Katia Torres, Martiela Moreira, Ana Weimer, Tania

Resumen en Inglés:

Gene polymorphisms of phase I (CYP1A1 and CYP2E of cytochrome P,) and phase II (GSTM1, GSTT1 and GSTP1 of glutathione-S-transferase,) enzymes and the TP53 tumor suppressor gene were studied as markers in a sample of 262 Brazilians of European descent, the sample consisting of 97 patients with non-small-cell lung cancer (NSCLC), 75 patients with chronic obstructive pulmonary disease (COPD) and 90 control individuals. For NSCLC, we found no significant relationship between any of the markers studied and susceptibility to this disease. With respect to COPD, although the distribution of the CYP1A1, GSTM1, GSTP1, GSTT1 and TP53 genotypes was similar to that of the controls the frequency of the CYP2E1*1A/*5B heterozygote was about 6 times higher in COPD patients than in controls (OR= 6.3; CI = 1.1-35.5 for p = 0.04). Individuals who presented the GSTT1 null phenotype and GSTP1 Ile/Val genotype had a risk about four times higher (OR= 4.0; CI = 1.2-14.6 for p = 0.02) of having COPD than individuals without these genotypes, the same being true for individuals having the GSTT1 null phenotype and CYP1A1*1A/*2A genotype (OR= 3.7; 1.1-14.6 for p = 0.04).These results suggest that the CYP2E1 and GSTT1 + GSTP or GSTT1 + CYP1A1 polymorphisms may be predictive of susceptibility to COPD, at least in this population of European ancestry.
Human and Medical Genetics
Population variability in some genes involving the haemostatic system: data on the general population of Corsica (France), Sardinia and Sicily (Italy) Falchi, Alessandra Vacca, Lucia Lopez Alomar, Antonio Esteban, Esther Memmi, Marc Varesi, Laurent Moral, Pedro Vona, Giuseppe

Resumen en Inglés:

Three different population samples from Corsica (France), Sardinia and Sicily (Italy) were studied using nine genetic markers. For the first time, allele distributions of FGA TaqI, FGB Bcl I, FGB Hind III, PAI-1 Hind III, PLAT TPA-25, GPIIIa Taq I, GPIIb I/D 9bp, FVII HVR4 and FVII -323 10 bp markers, which are thought to be associated with cardiovascular disease risk, were studied in the general population of the three islands. The frequencies of the markers analysed in the present work show some peculiarities: the locus FVII HVR4 is characterized by the presence of a rare allele (H5), found in Corsicans and in Sardinians; the locus FBG BcII shows a low frequency of the B1 allele and the absence of the B1B1 genotype. The frequencies of some alleles have a distribution that is in agreement with the low risk for cardiovascular diseases in south European countries. The results highlight a genetic differentiation between the three Mediterranean islands and the other European populations.
Human and Medical Genetics
The beliefs of mothers in southern Brazil regarding risk-factors associated with congenital abnormalities Garcias, Gilberto de Lima Schüler-Faccini, Lavínia

Resumen en Inglés:

We describes a study in which conventional wisdom about congenital malformations was investigated, the two main objectives being to list mothers' ideas by comparing six well-known causes of congenital abnormalities (ingestion of alcoholic beverages, smoking tobacco, drug use, marriage between relatives (consanguinity), rubella infection, maternal age) with explanations current in the general population and to discover the most common fallacies held by the general population concerning such abnormalities. The data were collected from 1 January to 31 December 1995 during a population study in which mothers were interviewed in hospitals in the city of Pelotas (population 400,000), Rio Grande do Sul state, Brazil. On each day of the study, the first three mothers to give birth were interviewed, resulting in 3,219 interviewed mothers out of 6,048 births. Our conclusion is that even though conventional wisdom is non-scientific it cannot be ignored because it is the source of a lot of suffering for the mother and can interfere with how she cares for her health . Although erroneous ideas about the causes of congenital abnormalities were more common among mothers from families receiving less than one minimum wage such ideas were found in all socioeconomic groups. In our discussion we emphasize that both mothers and the general public should be made aware of those risk-factors, especially maternal age and consanguinity, that really can cause congenital abnormalities.
Human and Medical Genetics
Recurrence risks for isolated cases of nonsyndromic deafness Braga, Maria Cristina C. Otto, Paulo A.

Resumen en Inglés:

We present, in this paper, general formulae developed so as to permit the calculation of the recurrence risks for isolated cases of nonsyndromic deafness in the offspring of nonconsanguineous and consanguineous couples. We included, in all analyzed situations, the following factors: (a) a generic degree of parental consanguinity; (b) a variable proportion of environmental (non-genetic) cases of the defect, so that the formulae can be easily applied to populations with any epidemiological profile; (c) a variable number of normal sibs of the propositus. Besides presenting the logic and the detailed derivation of all original formulae, we present tables for immediate use, with the numerical values of the recurrence risks as a function of the variables mentioned above.
Human and Medical Genetics
Distribution of N-acetyltransferase Type 1 (NAT1) genotypes and alleles in a Turkish population Arslan, Serdal Degerli, Naci Bardakci, Fevzi

Resumen en Inglés:

NAT1 is an intronless gene on chromosome 8p21.3 encoding a 290-amino-acid-long protein showing acetyltransferase activity. Some 26 alleles of NAT1 gene have been identified in human populations. In the present study we determined the distributions of NAT1 genotypes and alleles in a sample of 201 individuals from the Turkish population in Central Anatolia. The most frequent genotypes were NAT1*4/NAT1*4 (51.74%), NAT1*10/NAT1*4 (22.39%), NAT1*11/NAT1*4 (7.46), NAT1*10/NAT1*10 (3.98%). Frequencies of NAT1*3, *4 (wild-type), *10 and *11 alleles were 3.73%, 69.6%, 17.66% and 7.2%, respectively. The frequency of NAT1*11 was the highest amongst the populations studied so far, the other allele frequencies being close to those described in Caucasian populations.
Human and Medical Genetics
Insulin-like growth factor II gene Apa I polymorphism is not associated with endometriosis susceptibility Hsieh, Yao-Yuan Chang, Chi-Chen Tsai, Fuu-Jen Peng, Ching-Tien Yeh, Lian-Shun Lin, Cheng-Chieh

Resumen en Inglés:

Insulin-like growth factor II (IGF2) has been shown to play a role in abnormal cell growth and carcinogenesis. We investigated if the IGF2 gene Apa I polymorphism at exon 9 was associated with the susceptibility to endometriosis, analyzing 120 women with moderate/severe endometriosis and 103 controls. The genotype frequencies did not differ statistically between the endometriosis (aa = 25.4, ab = 57.4, bb = 17.2%) and control (aa = 20.8 ab = 52.8, bb = 26.4%) groups. The allele frequencies did not differ either: a = 54.1, b = 45.9% among women with endometriosis and a = 47.2, b = 52.8% in the control group. Therefore, no indication was found for an association of this polymorphism with endometriosis susceptibility.
Animal Genetics
Biochemical and molecular investigations on qualitative and quantitative Hb polymorphism in the river buffalo (Bubalus bubalis L.) population reared in Southern Italy Iorio, Mario Vincenti, Donatella Annunziata, Mario Rullo, Rosario Bonamassa, Raffaele Di Luccia, Aldo Pieragostini, Elisa

Resumen en Inglés:

On 398 river buffalo samples, randomly collected in distinct breeding areas of the Campania region, high-resolution analytical systems were used to identify both qualitative and quantitative variations of the Hb phenotype. Polyacrylamide gel isoelectric focusing and HPLC were used to determine the ratio between HBA1 and HBA2 globin chains; restriction endonuclease analysis was performed to assess whether quantitative variations in Hb bands were related to an unusual number of a-globin genes. In the two buffalo subpopulations, allele frequencies of the alpha and beta globin systems were calculated, and F statistics (FIS, FIT and FST) were estimated as parameters of genetic diversity. The results suggest that: i) as shown by RFLP analysis, only a couple of associated a globin genes account for the quantitative variations recorded at the phenotypic level; ii) as expected, in the a globin gene system (HBA), the frequency of haplotype B (HBA-B) largely exceeded that of haplotype A (HBA-A) (95.1% vs 4.9%); iii) the frequency of the usual allele at the beta locus is 0.6, as opposed to 0.4 of the slow variant; iiii) the most significant component of variation of the genetic system of hemoglobin is between individuals within the same location.
Animal Genetics
Sciaenidae fish of the Caeté River estuary, Northern Brazil: mitochondrial DNA suggests explosive radiation for the Western Atlantic assemblage Vinson, Christina Gomes, Grazielle Schneider, Horacio Sampaio, Iracilda

Resumen en Inglés:

Sciaenids are fish which are normally abundant in tropical estuaries of the western Atlantic. Studies on the Caeté river estuary in the northern Brazilian state of Pará have revealed that in this area Sciaenidae is the dominant family, comprising almost 50% of all teleosts sampled. In this paper we present the results of the first phylogenetic study on South American estuarine sciaenids, during which we obtained mitochondrial gene 16S sequences from 15 species belonging to eight genera occurring in the Caeté estuary. Intergeneric nucleotide divergences varied from 5 to 15%, Lonchurus and Menticirrhus being the most divergent lineages. Nucleotide divergences were quite variable amongst species of the same genus, ranging from 1.2% (Stellifer microps x Stellifer naso) to 8.4% (Menticirrhus americanus x Menticirrhus littoralis). Cladograms based on maximum parsimony, minimum evolution and maximum likelihood depicted an explosive diversification pattern for the western Atlantic sciaenid assemblage. Our analysis further reveals a very close relationship between Bairdiella and Stellifer, a monophyletic clade which emerged during the more recent diversification events of the Sciaenidae family. The phylogenetic reconstruction suggests the need for a revision of the taxonomy and nomenclature of the Bairdiella/Stellifer group.
Animal Genetics
Genetic divergence in Tetragonisca angustula Latreille, 1811 (Hymenoptera, Meliponinae, Trigonini) based on rapd markers Oliveira, Rosana de Cássia Nunes, Francis de Morais Franco Campos, Ana Paula Soraggi Vasconcelos, Soraya Matos de Roubik, David Goulart, Luiz Ricardo Kerr, Warwick Estevam

Resumen en Inglés:

One of the commonest neotropical stingless bees is Tetragonisca angustula (Latreille, 1811), popularly known in Portuguese as jataí, which occurs in variable nesting sites from Mexico to Argentina. We used 18 primers to generate 218 RAPD markers which we used to determined the genetic distance between T. angustula populations from 25 localities in three different Latin America countries, using Tetragonisca weyrauchi from the Brazilian state of Acre and the common honey bee (Apis mellifera) as outgroups. Genetic distance, calculated as the Percentage of Dissimilarity (14%), based on all markers divided the T. angustula population into eastern (group 1) and western (group 2) groups. However, we were able to separate the two groups by using only two primers that have generated five specific molecular markers. The eastern group consists of T. angustula angustula which occurs from Panama to the Brazilian states of Maranhão and northern Minas Gerais and has spread through the Brazilian Atlantic Forest as far as the southern Brazilian state of Santa Catarina. Group 2 is made up of T. angustula fiebrigi which has a more southerly and western distribution, occurring only in the western Brazilian states of Mato Grosso and Mato Grosso do Sul as well as the west of some other Brazilian states (Goiás, Minas Gerais, São Paulo, Paraná and Santa Catarina) and northeastern Argentina.
Animal Genetics
Karyotypic description of four species of Trigona (Jurine, 1807) (Hymenoptera, Apidae, Meliponini) from the State of Mato Grosso, Brazil Costa, Kleber França Brito, Rute Magalhães Miyazawa, Carlos Suetoshi

Resumen en Inglés:

The genus Trigona contains at least 31 species, but there have been few cytogenetic studies of this group. In this work, four species of Trigona (T. branneri, T. chanchamayoensis, T. hyalinata, and T. recursa) from the municipality of Cuiabá, in the State of Mato Grosso, Brazil, were studied. In all of the species, the females had 2n = 34 chromosomes and the males had n = 17. The C-banding patterns showed that the karyotypes of these species consisted mainly of acrocentric and pseudoacrocentric chromosomes. These cytogenetic findings should useful in future phylogenetic studies of this group.
Animal Genetics
C-banding and fluorescent in situ hybridization with rDNA sequences in chromosomes of Cycloneda sanguinea Linnaeus (Coleoptera, Coccinellidae) Maffei, Eliane Mariza Dortas Pompolo, Silvia das Graças Petitpierre, Eduard

Resumen en Inglés:

The aim of this study was to describe mitotic and meiotic chromosomes of Cycloneda sanguinea using C-banding, fluorescent in situ hybridization (FISH) rDNA probes, and sequential FISH/Ag-NOR staining. The chromosome number was 2n = 18 + XX for females and 2n = 18 + Xy for males. The X chromosome was metacentric and the Y chromosome was very small. During meiosis, the karyotypic meioformula was n = 9 + Xy p, and sex chromosomes configured a parachute at metaphase I. At the beginning of pachytene, bivalents were still individualized, and sex chromosomes were associated end-to-end through the heteropycnotic region of the X chromosome. Later in pachytene, further condensation led to the formation of a pseudo-ring by the sex bivalent. All chromosomes showed pericentromeric heterochromatin. FISH and sequential FISH/Ag-NOR staining evidenced the location of the nucleolar organizer region in one pair of autosomes (at spermatogonial metaphase). During meiosis, these genes were mapped to a region outside the sex vesicle by FISH, although Xy p was deeply stained with silver at metaphase I. These results suggest that these argyrophilic substances are of a nucleolar protein nature, and seem to be synthesized by a pair of autosomes and imported during meiosis (prophase I) to the sex pair, during the association of the sex chromosomes.
Animal Genetics
A rapid alternative technique for obtaining silver-positive patterns in chromosomes Kavalco, Karine Frehner Pazza, Rubens

Resumen en Inglés:

Silver nitrate chromosome staining to evidence nucleolar organizer regions (NORs) is a widely adopted methodology. The aim of the present work was to improve this technique, reducing the preparation time without decreasing the quality of the results. Microwave irradiation proved to be quite efficient and reliable for this purpose, as it allowed to identify Ag-NORs equivalent to those obtained by the conventional procedure and also to reduce the concentration of the employed reagents, as well as the precipitation of debris on the preparation.
Plant Genetics
The genetics of tolerance to tristeza disease in citrus rootstocks Bordignon, Rita Medina-Filho, Herculano Penna Siqueira, Walter José Teófilo Sobrinho, Joaquim

Resumen en Inglés:

Controlled pollinations between four elite citrus rootstocks, Citrus limonia - 'Limeira' rangpur lime (Cravo), C. sunki - 'Sunki' mandarin (Sunki), C. aurantium - 'São Paulo' sour orange (Azeda) and Poncirus trifoliata - 'Davis A' trifoliate orange (Trifoliata), resulted in 1614 nucelar and 1938 hybrid plants identified by the isozyme loci Pgi-1, Pgm-1, Got-1, Got-2, Aps-1, Me-1, Prxa-1 and or by the morphological markers broadness of leaf petiole wing or trifoliolate leaves. Tolerance to the citrus tristeza virus (CTV) was evaluated under nursery and field conditions for several years by the reaction of Valencia orange infected with a severe strain of CTV and grafted onto the hybrids and nucellar clones. Genetic analyses indicated that tolerance was controlled by at least two loci designated here as Az and t interacting in dominant-recessive epistasis. Genotypes Az__ __ __ and __ __ tt were tolerant while azaz T__ was intolerant. The intolerant Azeda was azaz TT, the tolerant rootstocks Sunki and Cravo were Azaz tt and the Trifoliata was Azaz TT. The different degrees of intolerance seen in some hybrids may reflect the inability of segregating modifiers from parental clones to overcome the epistatic interaction that controls the major tolerance reaction.
Plant Genetics
Selection and genetic gains for juvenile traits in progenies of Hevea in São Paulo State, Brazil Gonçalves, Paulo de Souza Martins, Antonio Lúcio Mello Bortoletto, Nelson Saes, Luis Alberto

Resumen en Inglés:

Five yield traits were investigated in three-year-old progenies from open-pollinated rubber trees [Hevea brasiliensis (Willd. ex Adr. de Juss) Muell.-Arg.]. Twenty progenies were evaluated in a randomized, complete block design replicated three times using 10 plants per linear plot at the North Central Experimental Station in Pindorama, São Paulo State, Brazil. The characters evaluated included the average yield of rubber, growth vigor, bark thickness, total number of latex vessel rings and latex vessel size. Highly significant (p < 0.01) genetic differences were observed among progenies for most traits. The genotypic variance components accounted for 13.2%, 12.3%, 9.4%, 3.4% and 0.23% of the phenotypic variance for yield, growth vigor, bark thickness, total number of latex vessel rings and latex vessel size, respectively. Heritabilities, as well as genotypic and phenotypic correlations among traits, were estimated. Heritabilities for the above traits at the individual plant level (<img border=0 id="_x0000_i1026" src="../../../../img/revistas/gmb/v27n2/a14img01.gif" align=absmiddle>) were 37%, 35%, 69%, 10% and 16%, respectively. Significant positive genotypic and phenotypic correlations were found between the yield of rubber and growth vigor (r g = 0.73, r p = 0.70), bark thickness (r g = 0.70**, r p = 0.75**) and the total number of latex vessel rings (r g = 0.64, r p = 0.80). There was no relationship between yield and latex vessel size, growth vigor or total number of latex vessel rings. Based on these data, selecting the best two out of 20 progenies would result in a genetic gain of 12.3% and 6.8% for yield of rubber and growth vigor, respectively. The two best individual ortets within each progeny would result in a genetic gain of 27.7% and 9.1%, with a total gain of 40% and 16% for these two traits, respectively.
Plant Genetics
Chromosomal and morphological studies of diploid and polyploid cytotypes of Stevia rebaudiana (Bertoni) Bertoni (Eupatorieae, Asteraceae) Oliveira, Vanessa M. de Forni-Martins, Eliana R. Magalhães, Pedro M. Alves, Marcos N.

Resumen en Inglés:

In this study, we examined the chromosome number and some morphological features of strains of Stevia rebaudiana. The chromosomes were analyzed during mitosis and diakinesis, and the tetrad normality and pollen viability were also assessed. In addition, stomata and pollen were measured and some plant features were studied morphometrically. All of the strains had 2n = 22, except for two, which had 2n = 33 and 2n = 44. Pairing at diakinesis was n = 11II for all of the diploid strains, whereas the triploid and tetraploid strains had n = 11III and n = 11IV, respectively. Triploid and tetraploid plants had a lower tetrad normality rate than the diploids. All of the strains had inviable pollen. Thus, the higher the ploidy number, the greater the size of the pollen and the stomata, and the lower their number per unit area. The triploid strain produced the shortest plants and the lowest number of inflorescences, whereas the tetraploid strain had the largest leaves. Analysis of variance revealed highly significant differences among the strains, with a positive correlation between the level of ploidy and all of the morphological features examined.
Plant Genetics
A karyotypic study of three southern Brazilian Asteraceae species using fluorescence in situ hybridization with a 45S rDNA probe and C-CMA3 banding Fregonezi, Jéferson N. Torezan, José M.D. Vanzela, André L.L.

Resumen en Inglés:

The Asteraceae, one of the largest families of flowering plants, contains about 1,100 genera and 20,000 species, and is well known for its extensive karyotypic variation. In this study, conventional Feulgen staining, C-CMA3 banding, and fluorescence in situ hybridization with a 45S rDNA probe were used to determine the chromosome number and the number and physical position of GC-rich heterochromatin and 45S rDNA sites in three Asteraceae weed species (Crepis japonica, Galinsoga parviflora and Chaptalia nutans). The three species exhibited karyotype differences in the chromosome number and shape, as a commom feature of Asteraceae. However, the 45S rDNA sites always occurred on the short chromosomal arms, associated with GC-heterochromatin. Althought of these differences, it suggests that commom features of plant karyotype are maintained.
Plant Genetics
Genetic diversity among maize (Zea mays L.) landraces assessed by RAPD markers Carvalho, Valdemar P. Ruas, Claudete F. Ferreira, Josué M. Moreira, Rosângela M.P. Ruas, Paulo M.

Resumen en Inglés:

The genetic relationships among 81 maize accessions consisting 79 landraces and two improved varieties, maintained by farmers in southern Brazil were investigated using Random Amplified Polymorphic DNA (RAPD). Thirty-two highly informative primers amplified 255 markers of which 184 (72.2%) were polymorphics. Based on the RAPD markers, a dendrogram was constructed using the UPGMA method. The range of genetic similarity was from 0.78 to 0.91. The molecular data grouped the accessions into two main clusters, which were correlated according to kernel colors. Small clusters were seen associated to characteristics, such as kernel morphology. The analysis of the molecular data revealed that maize management adopted by small-scale farmers has contributed to the maintenance of genetic variability and since field isolation is a regular practice, variety identities have been preserved. These results will be useful to establish and maintain a germplasm collection of landrace maize and may guide us in designing strategies that maximize the utility of maize genetic resources.
Plant Genetics
Molecular characterization of a cryptic wheat-Thinopyrum intermedium translocation line: evidence for genomic instability in nascent allopolyploid and aneuploid lines Yingshan, Dong Xiuling, Bu Yushi, Luan Mengyuan, He Bao, Liu

Resumen en Inglés:

A putative translocation line (#32), together with a disomic addition line (TAI27) and an octo-amphiploid line (Zhong3) of common wheat and Thinopyrum intermedium were characterized by restriction fragment length polymorphism (RFLP) analysis, using probes covering all seven homoeologous groups of Triticeae. Line 32 was confirmed to be a cryptic translocation line, based on the detection of multiple introgressed hybridization fragments specific to Th. intermedium in the RFLP patterns, and the absence of a hybridization signal in GISH analysis. In addition, extensive genomic changes, as compared to the wheat parent, were detected on all three lines studied, with a great majority of changes showing concordance among the lines. Our data is consistent with the emerging view that nascent allopolyploid and aneuploid plant genomes are highly dynamic, which may generate novel introgressed materials for breeding.
Plant Genetics
Clonal stability of tree dryness in Hevea brasiliensis Muell. Arg. Omokhafe, K.O.

Resumen en Inglés:

Clonal stability of tree dryness was evaluated in eleven clones of Hevea brasiliensis at the Rubber Research Institute of Nigeria. The experimental design was the randomized complete block with three replicates and ten trees per replicate. The clones were evaluated in three locations. Four stability parameters were applied. The stability parameters were: environmental variance, regression index, variance due to regression, and Shukla's stability variance. Clone C 202 was outstanding for clonal stability and could be useful for further studies and genetic improvement of tree dryness. Other four clones (C 76, C 150, C 159 and RRIM 600) were also stable.
Genetics of Microorganisms
Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers Destéfano, Ricardo Henri Rodrigues Destéfano, Suzete A. Lanza Messias, Claudio Luiz

Resumen en Inglés:

In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S- ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E9, B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E9, B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae.
Genetics of Microorganisms
Co-transformation of a tropical maize endophytic isolate of Fusarium verticillioides (synonym F. moniliforme) with gusA and nia genes Pamphile, João A. Rocha, Carmen Lúcia M.S.C. da Azevedo, João L.

Resumen en Inglés:

A tropical endophytic isolate of the fungus Fusarium verticillioides (synonym Fusarium moniliforme) obtained from Zea mays was co-transformed with plasmid pNH24 containing the Fusarium oxysporum nitrate reductase nia gene and plasmid pNOM 102 carrying the Escherichia coli b-glucuronidase gusA gene. Transformation frequency for the nia marker was 75 transformants mg-1 vector DNA and introduction of the gusA gene by co-transformation was 57.2% as indicated by the presence of the GUS+ phenotype on plates. Southern analyses confirmed the integration of both plasmids into the genome of ten GUS+ transformants. All co-transformants showed mitotic stability in respect of the GUS+ phenotype. To assess the potential of transformed endophytic fungi as vectors for introducing desirable characteristics into host tropical plants of biotechnological and agricultural importance we successfully infected maize roots and detected GUS+ phenotype”.
Genetics of Microorganisms
Agrobacterium-mediated transformation of sorghum: factors that affect transformation efficiency Carvalho, Carlos Henrique S. Zehr, Usha B. Gunaratna, Nilupa Anderson, Joseph Kononowicz, Halina H. Hodges, Thomas K. Axtell, John D.

Resumen en Inglés:

The results presented in this work support the hypothesis that Agrobacterium-mediated transformation of sorghum is feasible, analogous to what has been demonstrated for other cereals such as rice, maize, barley and wheat. The four factors that we found most influenced transformation were: the sensitivity of immature sorghum embryos to Agrobacterium infection, the growth conditions of the donor plant, type of explant and co-cultivation medium. A major problem during the development of our protocol was a necrotic response which developed in explants after co-cultivation. Immature sorghum embryos proved to be very sensitive to Agrobacterium infection and we found that the level of embryo death after co-cultivation was the limiting step in improving transformation efficiency. The addition of coconut water to the co-cultivation medium, the use of vigorous and actively growing immature embryos and the removal of excess bacteria significantly improved the survival rate of sorghum embryos and was critical for successful transformation. Hygromycin phosphotransferase (hpt) proved to be a good selectable marker for sorghum. We also found that b-glucuronidase (GUS) activity was low in most of the transgenic plant tissues tested, although it was very high in immature inflorescences. Although promising, the overall transformation efficiency of the protocol is still low and further optimization will require particular attention to be given to the number of Agrobacterium in the inoculum and the selection of sorghum genotypes and explants less sensitive to Agrobacterium infection.
Mutagenesis
Genetic damage induced by trophic doses of lead in the neotropical fish Hoplias malabaricus (Characiformes, Erythrinidae) as revealed by the comet assay and chromosomal aberrations Cestari, Marta Margarete Lemos, Priscilla Maria M. Ribeiro, Ciro Alberto de Oliveira Costa, João Ricardo M. Alves Pelletier, Emilien Ferraro, Marcos V.M. Mantovani, Mário Sérgio Fenocchio, Alberto Sergio

Resumen en Inglés:

The effects of clastogenic or mutagenic agents have rarely been studied in neotropical fish species exposed to contaminated water. In this study, the genetic damage caused by lead in the widely distributed South American fish, Hoplias malabaricus, was assessed using the comet (SCGE) assay and by testing for chromosomal aberrations. Eighteen specimens were acclimatized to laboratory conditions and then chronically exposed to contaminated food by feeding prey (Cyprinus sp.) injected intraperitoneally with doses of inorganic lead adjusted to give a contamination level of 21 mg of Pb2+.g-1 net weight of H. malabaricus. Three fish were sampled for chromosomal analysis after four doses (18 days) and another three after eight doses (41 days) of lead and the results then compared with three untreated controls kept under lead-free conditions. An additional six treated fish and three controls were sampled for the comet assay after 13 doses (64 days). Exposure to lead significantly increased the frequency of chromosomal aberrations and the frequency of tailed cell nuclei, the latter indicating DNA damage. These results show that H. malabaricus is a useful biological model for screening the clastogenic effects of lead and possibly other xenobiotics. The genetic damage seen here illustrates the need to investigate the potential effects of heavy metals on fish species in South America.
Mutagenesis
Effect of phenobarbital on inducing insecticide tolerance and esterase changes in Aedes aegypti (Diptera: Culicidae) Sousa-Polezzi, Rita de Cássia Bicudo, Hermione Elly Melara de Campos

Resumen en Inglés:

The effect of phenobarbital (PB) on the induction of tolerance to the organophosphorous insecticide temephos (TE) was investigated in Aedes aegypti L4 larvae submitted to two different PB-treatments:(1) continuous treatment from the egg to the larval L4 stage and (2) discontinuous treatment in which L4 larvae were exposed for 30 h. Mosquitoes from two Brazilian cities were studied: São José do Rio Preto (SJ) in São Paulo State and Goiânia (GO) in Goiás State. According to criterions established by World Health Organization (WHO) mosquitoes from SJ are organophosphate-susceptible while mosquitoes from GO are organophosphate-resistant. For both SJ and GO larvae the two different PB-treatments resulted in significantly increased tolerance (measured by reduced mortality) to 0.01mg/L TE while for larvae exposed to 0.02 mg/L TE only continuous PB-treatment resulted in significantly increased TE-tolerance. The reduction of mortality rate was greater in SJ larvae than in GO larvae, confirming data from other organisms indicating that the effect of PB is more pronounced in susceptible strains. To test if oxidase enzymes were involved in PB-induced tolerance we treated PB-pretreated SJ and GO larvae with the oxidase inhibitor piperonyl butoxide (PBO) before exposure to TE and observed increased (rather than decreased) tolerance, suggesting that oxidases are not involved in the tolerance process and that PB and PBO can act in concert or synergistically. Esterase patterns of PB-pretreated larvae indicated that the cholinesterases EST-13 and EST-14 are involved in the PB-induced TE- tolerance, reinforcing a previous study carried out in our laboratory which suggested that increased esterase synthesis is the mechanism responsible for the development of insecticide resistance in Aedes aegypti.
Mutagenesis
Comparison of base substitutions in response to nitrogen ion implantation and 60Co-gamma ray irradiation in Escherichia coli Chuan-Xiao, Xie An, Xu Li-Jun, Wu Jian-Min, Yao Jian-Bo, Yang Zeng-Liang, Yu

Resumen en Inglés:

To identify the specificity of base substitutions, a novel experimental system was established based on rifampicin-resistant (Rif r) mutant screening and sequencing of the defined region of the rpoB gene in E. coli. We focused on comparing mutational spectra of base substitutions induced by either low energy nitrogen ion beam implantation or 60Co-gamma rays. The most significant difference in the frequency of specific kinds of mutations induced by low energy nitrogen ion beam was that CG <FONT FACE=Symbol>®</font>TA transitions were significantly increased from 32 to 46, AT <FONT FACE=Symbol>®</font>TA transversions were doubled from 7 to 15 in 50 mutants, respectively. The preferential base substitutions induced by nitrogen ion beam implantation were CG <FONT FACE=Symbol>®</font>TA transitions, AT <FONT FACE=Symbol>®</font>GC transitions, AT <FONT FACE=Symbol>®</font>TA transversions, which account for 92.13% (82/89) of the total. The mutations induced by 60Co-gamma rays were preferentially GC <FONT FACE=Symbol>®</font>AT and AT <FONT FACE=Symbol>®</font>GC transitions, which totaled 84.31% (43/51).
Mutagenesis
Several pathways of hydrogen peroxide action that damage the E. coli genome Asad, Nasser Ribeiro Asad, Lidia Maria Buarque Oliveira Almeida, Carlos Eduardo Bonacossa de Felzenszwalb, Israel Cabral-Neto, Januário Bispo Leitão, Alvaro Costa

Resumen en Inglés:

Hydrogen peroxide is an important reactive oxygen species (ROS) that arises either during the aerobic respiration process or as a by-product of water radiolysis after exposure to ionizing radiation. The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress condition that can result in damage to cell components such as proteins, lipids and principally to DNA, leading to mutagenesis and cell death. Escherichia coli cells are able to deal with these adverse events via DNA repair mechanisms, which enable them to recover their genome integrity. These include base excision repair (BER), nucleotide excision repair (NER) and recombinational repair. Other important defense mechanisms present in Escherichia coli are OxyR and SosRS anti-oxidant inducible pathways, which are elicited by cells to avoid the introduction of oxidative lesions by hydrogen peroxide. This review summarizes the phenomena of lethal synergism between UV irradiation (254 nm) and H2O2, the cross-adaptive response between different classes of genotoxic agents and hydrogen peroxide, and the role of copper ions in the lethal response to H2O2 under low-iron conditions.
location_on
Sociedade Brasileira de Genética Rua Cap. Adelmio Norberto da Silva, 736, 14025-670 Ribeirão Preto SP Brazil, Tel.: (55 16) 3911-4130 / Fax.: (55 16) 3621-3552 - Ribeirão Preto - SP - Brazil
E-mail: editor@gmb.org.br
rss_feed Acompañe los números de esta revista en su lector de RSS
Ir para arriba Notificar error