Tetra-primer ARMS-PCR-based genotyping of molecular markers associated with mature fruit cuticular wax in Benincasa hispida

Abstract

In wax gourd breeding, mature fruit cuticular wax is an important trait that contributes to preservation ability and commercial value. A previous study has shown that this trait is determined by a dominant allele linked to SNP markers on the BhWAX gene. Notably, a critical SNP at position #902 (relative to the start codon) features a T allele in waxy lines and a C allele in non-waxy lines. This study focuses on establishing a tetra-primer ARMS-PCR system to genotype this trait in various Vietnamese wax gourd landraces (4 varieties × 3 individuals, n = 12). The assay successfully identified homozygous T/T and heterozygous T/C genotypes in all 12 samples, consistent with sequencing results; however, the C/C genotype was absent due to the unavailability of corresponding landraces. The study provides an effective, low-cost molecular screening tool, offering strong support for wax gourd breeding programs, especially in laboratories with limited equipment.

Keywords:
Cuticular wax; plant breeding; SNP marker; tetra-primer ARMS-PCR; wax gourd

INTRODUCTION

Benincasa hispida is a member of the Cucurbitaceae family and is commonly known as wax gourd, ash gourd, or winter melon (Swamy 2022). Regarding its origin, wax gourd is suggested to have originated from India or South and Southeast Asia (Swamy 2022, Sagar et al. 2025); however, to date, no direct or obvious evidence elucidates the true origin of this plant species. Nowadays, wax gourd is widely cultivated in Asia, Oceania, and some other tropical and subtropical regions, but the domestication site remains undetermined, although wild forms are found infrequently in Australia, Japan, and some areas of Malaysia (Marr et al. 2007, Chomicki et al. 2020). This crop species is characterized by several phenotypic features, such as a scandent branching stem with tendrils, heart-shaped leaves with lobed edges resembling a duck’s foot, and a trichome-covered surface. Wax gourd develops yellowish unisexual flowers on the same plant. Its fruits exhibit an elongated and cylindrical shape with a light green epicarp during the young stage). When the fruits mature, the color turns darker green, and a white powdery coating layer covers the entire fruit.

In Asian countries, wax gourd is widely consumed as a daily food and even a traditional medicine due to its highly nutritious and bioactive components. Wax gourd fruit is known for its low calories, high fiber content, and contains different vitamins (e.g., C, B1, and B12), minerals (e.g., potassium and magnesium), as well as antioxidants (such as phenolic compounds and flavonoids) (Islam et al. 2021). In traditional oriental medicine, wax gourd fruit is considered sweet, cooling, detoxifying, and promoting diuresis. Particularly, the wax gourd fruit and its peel have been suggested as effective traditional medicine for treating hyperlipidemia, hyperglycemia, obesity, and even cardiovascular disease when combined with other medicinal herbs (Huang et al. 2004, Gu et al. 2013).

In wax gourd, fruit cuticular wax formation is a common and easily observed characteristic, especially at the mature stage. This morphological trait plays a crucial role in fruit protection, particularly under unfavorable environmental conditions. Cuticular wax is mainly composed of very long-chain fatty acids and their derivatives, including alcohols, alkanes, esters, aldehydes, and ketones (Samuels et al. 2008, Yan et al. 2022, Huang et al. 2024, Trivedi et al. 2026). It is worth noting that the level of fruit cuticular wax varies depending on the species variety and environmental conditions. Abiotic stresses such as drought and low temperatures have been found to enhance fruit cuticular wax formation in plants (Wu et al. 2023). In addition to protecting the fruit and seeds, this trait is also significant for fruit preservation and the elongation of shelf-life. Cuticular wax effectively limits water loss, high temperatures, ultraviolet radiation, and the penetration of pathogens from water droplets adhering to the outer skin (Wu et al. 2023). Recently, genome-wide analysis has been extensively applied to reveal various trait-associated markers in different plants (Kawicha et al. 2023, Khound et al. 2024, Sidek et al. 2024). In a previous study, genome-wide mapping analysis using an F2 population generated by crossing two wax gourd lines [P131 (with cuticular wax) and W3 (without cuticular wax)] identified two critical single-nucleotide polymorphism (SNP) markers located on the BhWAX gene (Bhi09G001428 on Chromosome 9) (Yan et al. 2022). Specifically, the nucleotides at positions #902 and #931 (counting from the A of the start codon) are T and A, respectively, in the cuticular wax line, whereas they are C and G in the line without cuticular wax (Yan et al. 2022). Consequently, the BhWax protein sequence changes from Valine³⁰¹ and Isoleucine³¹¹ (cuticular wax line) to Alanine³⁰¹ and Valine³¹¹ (without cuticular wax line). The BhWax gene is predicted to encode an O-acyltransferase, a membrane-bound enzyme. Although biochemical and molecular experimental evidence remains limited for determining its actual functions in Benincasa hispida cuticular wax biosynthesis, phenotypic and genetic analyses suggest that these SNP markers are highly associated with the fruit cuticular wax trait (Yan et al. 2022). Conventional phenotypic selection for the mature fruit cuticular wax trait in wax gourd can be inefficient because the trait is typically expressed late in the developmental cycle, requiring significant time, labor, and field space to grow plants. In contrast, early-stage seedling screening using these SNP markers can assist in rapidly identifying targeted individuals after germination. This marker-assisted approach drastically reduces resource consumption and accelerates the breeding cycle. Taken together, these SNP markers hold significant potential for application in wax gourd breeding programs targeting this important trait.

In plant genetics and breeding, various molecular markers (e.g., InDel, ISSR, and SSR) have been extensively studied and successfully applied in numerous plant species, including wax gourd (Huang et al. 2022, Hu et al. 2022, Kıraç et al. 2022, Coşkun et al. 2024, Su et al. 2025). SNP markers have rapidly become the focus of molecular genetics studies across many crop and livestock species in recent years due to their abundance in the genome combined with their applicability in high-throughput detection platforms based on next-generation sequencing (NGS) technology (Mammadov et al. 2012, Jasielczuk et al. 2024). In plants, a wide range of SNP markers have been found to be linked to many different important traits, such as parthenocarpy fruit formation in cucumbers, fruit flesh color in watermelons, fruit shape, and mature fruit cuticular wax in wax gourd (Cheng et al. 2021, Yan et al. 2022, Song et al. 2023, Nie et al. 2025).

Various molecular biology techniques have been studied and developed for genotyping SNP markers. Generally, these can be divided into three distinct groups: 1) PCR-based methods, 2) microarray-based methods, and 3) NGS-based methods (Lawrie and Massey 2023). For the specific identification of a given SNP, group 1 methods appear to be the most suitable, while the others (groups 2 and 3) are often applied for large-scale SNP screening. In group 1, some common techniques, including cleaved amplified polymorphic sequence (CAPS) and Kompetitive Allele Specific PCR (KASP), have been widely utilized (Zhang et al. 2020, Lawrie and Massey 2023). Additionally, another technique called the Tetra-primer Amplification Refractory Mutation System PCR (tetra-primer ARMS-PCR) has been studied and applied to analyze different SNPs in various biological systems (Medrano and Oliveira 2014, Kou et al. 2017, Chen et al. 2022, Ke-xin et al. 2023, Yang et al. 2023, Nguyen et al. 2024). While KASP provides high-throughput capabilities, its reliance on specialized equipment and expensive fluorescent probes often exceeds the budget of smaller laboratories. In contrast, CAPS avoids high probe costs but demands more bench time and costly restriction enzymes. The tetra-primer ARMS-PCR system bridges this gap by offering a single-tube assay compatible with standard thermal cyclers. The primary challenge of this method lies in the precise design of internal mismatches to ensure allelic specificity and prevent false priming; however, once optimized, it provides a rapid and economical genotyping solution via gel electrophoresis, making it ideal for facilities lacking real-time PCR or NGS infrastructure. In Vietnam, a diverse range of wax gourd landraces, such as the Bac Kan fragrant, Son La fragrant, and Binh Dinh gigantic varieties, have been meticulously selected, conserved, and cultivated. While genetic diversity among some local accessions has been evaluated using molecular markers like SSRs and RAPDs (Xuan et al. 2019), research regarding SNP markers associated with fruit cuticular wax remains absent for the indigenous wax gourd varieties. In this study, these fruit cuticular wax-associated SNP markers, previously identified by Yan et al. (2022), were examined in Vietnamese wax gourd landraces (ACT, PVN, RD1, and RD2). These landraces were selected to represent the genetic diversity of wax gourds across different climatic regions of Vietnam. While ACT, RD1, and RD2 are high-yielding varieties adapted to the tropical conditions of Southern Vietnam, PVN serves as a distinct genetic resource from Northeast Vietnam. Subsequently, the tetra-primer ARMS-PCR method was further developed to genotype these landraces. Including these geographically distant landraces ensures the broad applicability and robustness of the developed tetra-primer ARMS-PCR system.

MATERIAL AND METHODS

Plant materials

In this study, various wax gourd varieties (ACT, PVN, RD1, and RD2) were collected from local gardens in Ho Chi Minh City, Vietnam. Among these, ACT, RD1, and RD2 are common varieties cultivated in the southern provinces of Vietnam, whereas PVN is a conventional variety from Northeast Vietnam. ACT and PVN seeds were obtained and grown in the university’s experimental garden (Phu Loi ward, Ho Chi Minh City), while RD1 and RD2 samples were directly collected from a local farm in Hoc Mon ward, Ho Chi Minh City. Seeds were sown, and the seedlings were grown in a mixture of burnt rice husk, fresh rice husk, cow manure, coconut coir, and soil (in a ratio of 40:10:10:30:10). The plants were grown in the experimental garden at Ho Chi Minh City Open University (Phu Loi campus). All collected varieties were characterized by the presence of the cuticular wax, observed as a white, powdery layer on the mature fruit surface (Figure 1). The cuticular wax phenotype was determined through binary visual scoring (presence/absence) at the mature fruit stage. Because the onset of wax formation varies among landraces, the final phenotypic recording was conducted when the fruits reached physiological maturity to ensure accurate characterization across all genotypes.

Figure 1
Collected wax gourd varieties exhibited the cuticular wax trait. (A) Different developmental stages of the wax gourd fruits (ACT variety). Cuticular wax started accumulating on the 15^th day after pollination (DAP) (the plants were grown in the university’s experimental garden, Phu Loi ward, Ho Chi Minh City). (B) Mature wax gourd fruits (PVN variety) collected from a local farm in Northeast Vietnam; the fruits are visibly covered in cuticular wax. (C) A representative wax gourd fruit (RD1 variety) on a local farm (Hoc Mon ward, Ho Chi Minh City). Cuticular wax began appearing from the fruit petiole. Scale bar = 5 cm.

DNA extraction

Young leaf samples were harvested and used for DNA extraction using the Top PURE® PLANT DNA EXTRACTION KIT manufactured by ABT (Vietnam). The extraction procedure was carried out following the manufacturer’s instructions. In brief, for each sample, approximately 50 mg of the young leaf sample was placed in a 1.5 mL microtube and used for DNA extraction by the silica column method. The extracted DNA samples were used immediately or stored at -20 °C.

PCR and DNA sequencing

The DNA samples were used for PCR amplification of the sequence region containing the interested SNP markers (Yan et al. 2022). Each PCR reaction included an extracted DNA sample, dNTPs (Takara Bio, Japan), Taq DNA polymerase (ThermoFisher Scientific, USA), enzyme buffer (ThermoFisher Scientific, USA), and primers (BhWax-F: 5'-TGCTCTGCCTTCCGATCAAG-3'; BhWax-R: 5'-ACCAATCGTCCGGTCAACAA-3'). The reaction conditions were established as follows: [95°C/5 min] × 1 cycle; [95 °C/30s → 61 °C/30s → 72 °C/60s] × 30 cycles; [72°C/5 min] × 1 cycle (Thermal Cycler: Bechmark TC 9639, USA). After PCR, the products were examined by electrophoresis on a 1% agarose gel and sequenced using the conventional sequencing method with the BhWax-F primer. In this study, four Vietnamese wax gourd landraces (three individuals per landrace, n = 12) were utilized for validation. Although this sample size is relatively small for population-level analysis, it is sufficient for the primary objective of this work, which focused on the technical optimization and validation of the developed tetra-primer ARMS-PCR assay.

Tetra-primer ARMS-PCR

Firstly, gradient tetra-primer ARMS-PCR was employed to determine the optimal annealing temperature. Typically, each PCR reaction also comprised the following components: DNA sample, Taq DNA polymerase (Meridian Bioscience, USA), enzyme buffer containing dNTPs (Meridian Bioscience, USA), and primers. Each PCR reaction was performed in a total volume of 10 µL, consisting of 2 µL of enzyme buffer containing dNTPs (5X), 0.5 µL of each outer primer (BhWAX-out1-F/BhWAX-out1-R, 10 µM), 1 µL of each inner primer (BhWAX-in1-F/BhWAX-in1-R, 10 µM), 0.2 µL of Taq DNA polymerase (5 U µL^-1), 1 µL of genomic DNA template (~30 ng), and 3.8 µL of nuclease-free water. The ratio of outer to inner primers was maintained at 1:2 in all tetra-primer ARMS-PCR reactions. This ratio was empirically optimized through preliminary experiments to enhance amplification specificity and minimize non-specific products.

The reaction conditions were established as follows: [95°C/5 min] × 1 cycle; [95 °C/30s → 58, 59, 60, 61, 62 °C/30s → 72 °C/30s] × 35 cycles; [72 °C/5 min] × 1 cycle (Thermal Cycler: Bechmark TC 9639, USA). Subsequently, the PCR reactions for all tested samples were performed using the optimal annealing temperature. The PCR products were examined by electrophoresis on a 2% agarose gel. Afterwards, the optimal annealing temperature was employed for examining all the collected samples with the same PCR reaction components.

RESULTS AND DISCUSSION

Genotyping of BhWAX-associated SNP markers relating to the mature fruit cuticular wax trait in Vietnamese wax gourd landraces based on PCR-sequencing

Identifying molecular markers related to fruit phenotypic traits, specifically the mature fruit cuticular wax trait, is a crucial step in modern wax gourd breeding. In this study, we verified the published SNP markers on several wax gourd varieties in Vietnam using PCR combined with Sanger sequencing. The BhWAX (focusing on the region containing target SNP sites) sequencing results showed a strong correlation between genotype and phenotype (Table 1), consistent with previously published results (Yan et al. 2022). Based on the obtained sequencing chromatograms, we observed the presence of both genotype states in determining the mature fruit cuticular wax trait. Specifically, the homozygous genotype (SNP1: T/T; and SNP2: A/A) was observed in the PVN variety individuals and some individuals of the RD1 and RD2 varieties (Figure 2). Sequencing results showed a single signal peak at the target SNP positions (SNP1: T/T; and SNP2: A/A) (Figure 2A). This proves that these individuals are homozygous for the trait of interest. The presence of homozygous dominant lines is highly significant in maintaining phenotypic stability for subsequent open-pollination generations without concern for trait segregation. Furthermore, across all individuals of the ACT variety and some individuals of the RD1 and RD2 varieties, sequencing results revealed the appearance of “double peaks”, reflecting the coexistence of both dominant and recessive alleles (SNP1: T/C; and SNP2: A/G) (Figure 2A). Although these individuals still exhibit a cuticular wax coating on the mature fruit peel, they are not homozygous for this trait. Among the examined varieties, the PVN variety can be considered the most conserved, as it is grown within a restricted geographical area in Northeast Vietnam. In contrast, other varieties (ACT, RD1, and RD2) are widely cultivated in Southern Vietnam, where intensive agricultural activities occur. It is plausible that cross-pollination between these local landraces and imported varieties may contribute to the observed heterozygosity; however, further studies are required to validate this hypothesis. In the present study, three representative individuals from each variety were examined. It is recommended to further validate these SNP markers in a larger population, accompanied by paired-end sequencing using both forward and reverse primers. In addition, all 12 examined samples exhibited a wax-present phenotype, regardless of whether their genotypes were homozygous or heterozygous. To obtain wax-absent genotypes for future studies, it is suggested that the collection be expanded or that heterozygous varieties (e.g., ACT or some genotyped RD1 and RD2 individuals) be self-pollinated.

Table 1
Phenotypic and genotypic data relevant to the cuticular wax trait in Vietnamese wax gourd landraces

Variety	Phenotype	Genotype	Phenotype vs Genotype
ACT #11	Cuticular wax: yes	Cuticular wax: heterozygous	Compatible
ACT #2	Cuticular wax: yes	Cuticular wax: heterozygous	Compatible
ACT #3	Cuticular wax: yes	Cuticular wax: heterozygous	Compatible
PVN #1	Cuticular wax: yes	Cuticular wax: homozygous	Compatible
PVN #2	Cuticular wax: yes	Cuticular wax: homozygous	Compatible
PVN #3	Cuticular wax: yes	Cuticular wax: homozygous	Compatible
RD1 #1	Cuticular wax: yes	Cuticular wax: heterozygous	Compatible
RD1 #2	Cuticular wax: yes	Cuticular wax: homozygous	Compatible
RD1 #3	Cuticular wax: yes	Cuticular wax: heterozygous	Compatible
RD2 #1	Cuticular wax: yes	Cuticular wax: homozygous	Compatible
RD2 #2	Cuticular wax: yes	Cuticular wax: homozygous	Compatible
RD2 #3	Cuticular wax: yes	Cuticular wax: heterozygous	Compatible

Figure 2
Genotyping of BhWAX-associated SNP markers relating to mature fruit cuticular wax trait in Vietnamese wax gourd landraces. (A) The sequencing chromatograms. Black arrows indicate the SNP1 (left) and SNP2 (right) positions. (B) Mature fruit cuticular wax trait genotypes of various Vietnamese wax gourd landraces.

In wax gourd, mature fruit cuticular wax plays a versatile biological role that not only shapes morphological characteristics but also determines the adaptability and commercial value of this plant product. The formation of this wax layer creates a barrier that prevents transpiration through stomata and protects the fruit from both biotic and abiotic agents. The crystalline structure of cuticular wax, mainly composed of very long-chain alkane compounds (VLCFAs) and aldehydes, creates a superhydrophobic surface that reflects UV radiation and prevents the adhesion of harmful fungal spores (Wang et al. 2020, Huang et al. 2024, Han et al. 2026). Identifying SNP markers linked to genes regulating wax biosynthesis not only supports breeding programs with good preservation capabilities but also opens up the potential for exploiting mature fruit cuticular wax as a valuable natural resource. Overall, the use of SNP markers has allowed us to accurately determine the molecular genetic nature of the phenotype of interest without observing the phenotype itself. The discovery and clear differentiation of heterozygous and homozygous genotypes is of great significance in work related to the breeding of new wax gourd varieties, such as screening, collecting starting lines/varieties, and monitoring the steps in the breeding process. In addition, it is of interest to further examine the differences in mature fruit cuticular wax levels between heterozygous and homozygous genotypes. This will determine whether heterozygous genotypes express lower wax levels compared to homozygous ones.

Gradient PCR-based annealing temperature optimization

Among the two SNP1 and SNP2 markers located on the BhWax (Bhi09G001428) gene, a previous study unraveled that the SNP1 marker exhibited more than 97% accuracy in explaining the cuticular wax trait in 82 individuals of the F2 population (generated from parental lines with and without cuticular wax) (Yan et al. 2022). Thus, the SNP1 marker was primarily selected for tetra-primer ARMS-PCR analysis. To genotype this SNP1, a tetra-primer set was developed and examined on the above Vietnamese wax gourd landraces (Table 2). The principle of the tetra-primer ARMS-PCR technique is based on the simultaneous use of four primers in a single reaction to differentiate SNP variants. The expected electrophoresis results of the PCR product will show specific band combinations, allowing for accurate determination of the genotype status of the sample through the size of the amplified DNA fragments. For this primer set, in all successful reactions, the outer primer pair is expected to amplify a common DNA fragment of 502 bp (Table 2). This band acts as an internal control to monitor the efficiency of the PCR reaction. For the homozygous T/T genotype, the combination of the outer primer and the internal primer specific for the T allele will produce a byproduct of 324 bp (Table 2). Therefore, two bands corresponding to sizes of 502 and 324 bp will appear on the electrophoresis gel. Conversely, for the homozygous C/C genotype, the primer specific for the C allele will bind to and produce a 218 bp product, resulting in two bands measuring 502 and 218 bp (Table 2). Additionally, if the genotype is heterozygous T/C, the result will show three distinct bands at 502, 324, and 218 bp (Table 2).

Table 2
Primer sequences for tetra-primer ARMS-PCR

Primer name	Sequence (5′ - 3′)	Tm (°C)	Allele	PCR product size
BhWAX-out1-F	CACCCGTTTCATAACCTCCCGTGT	66		Control fragment: 502 bp T allele: 324 bp C allele: 218 bp
BhWAX-out1-R	TCATGAAGAGGATGTTTGGTCACGA	63
BhWAX-in1-F	GAGGTGGCCGCCAAAGCGGT	67	(T)
BhWAX-in1-R	GTACCTTCCGGCTAGCCAACG	65	(C)

• Underlined letters denote deliberately introduced internal mismatches, incorporated to enhance allelic specificity.

To determine the optimal annealing conditions for the tetra-primer ARMS-PCR, a gradient PCR experiment was conducted with a temperature range from 58 to 62 °C using two genomic DNA samples (ACT #3: heterozygous SNP1 T/C; and RD2 #2: homozygous SNP1 T/T) (Figures 2 and 3). Overall, the PCR products from ACT #3 and RD2 #2 samples exhibited three and two major bands, respectively. These major products are correct as expected. However, the agarose gel electrophoresis results showed a significant effect of annealing temperature on the specificity and amplification efficiency of the target DNA fragments (Figure 3). At the lowest examined annealing temperature (58 °C), although the product bands appeared strongly, the presence of primer-dimers (non-specific bands under 100 bp) with high clarity was also observed, especially in the case of the ACT #3 sample (Figure 3). This phenomenon gradually decreased as the temperature increased to 59°C and almost completely disappeared at 60 °C (Figure 3). This indicates an increase in the specificity of the primer pairs in the multiplex reaction system according to the applied temperature. Notably, upon further increasing the temperature to 61 °C, a distinct upward shift of the product bands relative to the DNA ladder was observed. This suggests that secondary structures, heteroduplex formation, or non-specific primer binding may have affected the migration rate during electrophoresis (Figure 3). Further sequencing of these products is recommended to clarify the underlying cause of this phenomenon. On the other hand, at 62 °C, the intensity of the target product bands faded, indicating a sharp decrease in primer annealing efficiency due to the temperature exceeding the optimal thermodynamic threshold (Figure 3). Based on the balance between specificity and amplification efficiency, 60 °C was chosen as the optimal annealing temperature for all subsequent SNP identification reactions.

Figure 3
Gradient PCR-based annealing temperature optimization.

Tetra-primer ARMS-PCR based genotyping

Next, the developed tetra-primer ARMS-PCR system was deployed to genotype all Vietnamese wax gourd samples, as verified by the gold standard PCR-Sanger sequencing method (Figure 2). The electrophoresis of the PCR products showed clear, specific bands that were entirely consistent with the theoretical predictions of the size of the amplified fragments (Table 2 and Figure 4). Specifically, the analysis revealed a clear genotyping pattern within the studied population based on the band combinations. The homozygous T/T lines (all PVN and some RD1 and RD2 individuals) showed two bands, including an internal control at 502 bp and a T allele-specific band at 324 bp (Figure 4). Conversely, the T/C heterozygous lines (all ACT and some RD1 and RD2 individuals) were accurately identified through the simultaneous presence of all three bands (502, 324, and 218 bp), reflecting the coexistence of both alleles (T and C) in the genome (Figure 4). Theoretically, the C/C genotype is expected to yield two fragments of 502 and 218 bp; however, this specific banding pattern was not observed in the current study due to the absence of C/C individuals in our samples. Consequently, only the patterns for T/T and T/C genotypes are presented in Figure 4.

Figure 4
Tetra-primer ARMS-PCR-based genotyping of BhWAX-associated SNP marker relating to mature fruit cuticular wax trait in Vietnamese wax gourd landraces. The asterisks (*) indicate the specific product bands.

Notably, the data obtained from tetra-primer ARMS-PCR-based genotyping showed exact concordance with Sanger sequencing results from the same sample set (Figures 2 and 4, Table 3). However, it is recommended to further validate this genotyping approach in a larger population across all genotypes, including homozygous T/T, homozygous C/C, and heterozygous T/C. This will be crucial to confirming its potential application in subsequent wax gourd breeding programs. Furthermore, this is an optimal alternative, enabling rapid genotype screening from the seedling stage with low cost and a simple technical procedure. This method is particularly significant for research facilities with limited laboratory resources, allowing for efficient genetic identification without relying on expensive systems, such as qPCR or NGS systems. Additionally, expanding the collection, generating (by selfing the heterozygous varieties), and evaluating local wax gourd landraces carrying the non-waxy genotype are essential to confirm the stability of this trait under adverse environmental conditions. Further research into whether these varieties maintain the non-waxy phenotype even under environmental stress will be crucial in validating the reliability and practical applicability of the currently developed SNP marker-based genotyping method. Such findings will strengthen the foundation for the broader and more effective application of marker-assisted selection (MAS) in wax gourd breeding programs.

Table 3
Sequencing and tetra-primer ARMS-PCR based genotyping of cuticular wax trait in Vietnamese wax gourd landraces

Variety	Sequencing	Tetra-primer ARMS-PCR
ACT #11	T/C	T/C
ACT #2	T/C	T/C
ACT #3	T/C	T/C
PVN #1	T	T
PVN #2	T	T
PVN #3	T	T
RD1 #1	T/C	T/C
RD1 #2	T	T
RD1 #3	T/C	T/C
RD2 #1	T	T
RD2 #2	T	T
RD2 #3	T/C	T/C

CONCLUSION

In this study, a tetra-primer ARMS-PCR system was developed to genotype an SNP marker associated with the cuticular wax trait in Vietnamese wax gourd landraces. The results showed that the genotyping data were consistent with Sanger sequencing across 12 tested samples. This method not only allows for clear differentiation between homozygous (T/T) and heterozygous (T/C) states in a single reaction but also demonstrates its role as a cost-effective alternative suitable for laboratories with limited resources. Furthermore, this tool facilitates a transition from traditional field-based selection to marker-assisted selection (MAS) within local breeding programs. Specifically, it enables breeders to screen and discard non-waxy individuals as early as the cotyledon stage, significantly reducing land requirements and labor costs by ensuring that only desirable parental lines are maintained for long-term breeding. Moreover, securing waxy lines through this validated assay is crucial for enhancing the commercial profile of wax gourd. The resulting uniformity in cuticular wax not only extends shelf life by reducing post-harvest moisture loss but also strengthens the competitive edge of local produce for long-distance export.

ACKNOWLEDGEMENTS

We would like to express our gratitude to Ms. To Lang Phuong for supporting the wax gourd samples. This research is funded by Ho Chi Minh City Open University (under the Student Scientific Research Competition program, academic year 2025-2026, project code: 604).

Data Availability Statement

The datasets generated and/or analyzed during the current research are available from the corresponding author upon reasonable request.

REFERENCES

• Chen J, Xu X, Dalhaimer P, Zhao L2022 Tetra-Primer Amplification-Refractory Mutation System (ARMS)-PCR for genotyping mouse Leptin gene mutationAnimals 12:2680
• Cheng Z, Liu Z, Xu Y, Ma L, Chen J, Gou J, Su L, Wu W, Chen Y, Yu W, Wang P2021 Fine mapping and identification of the candidate gene BFS for fruit shape in wax gourd (Benincasa hispida)Theoretical and Applied Genetics 134:3983-3995
• Chomicki G, Schaefer H, Renner SS2020 Origin and domestication of Cucurbitaceae crops: insights from phylogenies, genomics, and archaeologyNew Phytologist 226:1240-1255
• Coşkun ÖF, Toprak S and Mavi K2024 Some seed properties and molecular analysis with inter-primary binding site (iPBS) retrotransposons markers of edible-seeded watermelon genotypesGenetic Resources and Crop Evolution 71:3151-3162
• Gu M, Fan S, Liu G, Guo L, Ding X, Lu Y, Zhang Y, Ji G, Huang C2013 Extract of wax gourd peel prevents high-fat diet-induced hyperlipidemia in C57BL/6 mice via the inhibition of the PPAR γ pathwayEvidence-Based Complementary and Alternative Medicine 2013:1-11
• Han D, Lu J, Zhao C, Ali S, Jiang Z2026 The role and regulatory mechanisms of cuticular wax in crop stress tolerance and yieldPlants 15:554
• Hu Q, Wang H, Jiang B, Zhu H, He X, Song P, Song J, Yang S, Shen J, Li Z, Hu J, Sun S, Yang L2022 Genome-wide simple sequence repeats development and their application in genetic diversity analysis in wax gourd (Benincasa hispida)Plant Breeding 141:108-118
• Huang H, Huang J, Tso TK, Tsai Y, Chang C2004 Antioxidant and angiotensin-converting enzyme inhibition capacities of various parts of Benincasa hispida (wax gourd)Food / Nahrung 48:230-233
• Huang H, Yan J, Yan H, Jiang B2024 Chemical compositions and cryo-adhesive probing of the epicuticular wax crystals on the fruit surface of wax gourd (Benincasa hispida)Food Chemistry 441:138277
• Huang X, Wu W, Su L, Lv H, Cheng Z, Yang W, Nong L, Liu T, Chen Y, Wang P, Liu Z2022 Development and application of InDel markers linked to fruit shape and peel-colour genes in wax gourdGenes 13:1567
• Islam MT, Quispe C, El-Kersh DM, Shill MC, Bhardwaj K, Bhardwaj P, Sharifi-Rad J, Martorell M, Hossain R, Al-Harrasi A, Al-Rawahi A, Butnariu M, Rotariu LS, Suleria HAR, Taheri Y, Docea AO, Calina D, Cho WC2021 A literature-based update on Benincasa hispida (Thunb.) Cogn.: Traditional uses, nutraceutical, and phytopharmacological profilesOxidative Medicine and Cellular Longevity 2021:6349041
• Jasielczuk I, Gurgul A, Szmatoła T, Radko A, Majewska A, Sosin E, Litwińczuk Z, Rubiś D, Ząbek T2024 The use of SNP markers for cattle breed identificationJournal of Applied Genetics 65:575-589
• Kawicha P, Tongyoo P, Wongpakdee S, Rattanapolsan L, Duangjit J, Chunwongse J, Suwor P, Sangdee A, Thanyasiriwat T2023 Genome-wide association study revealed genetic loci for resistance to fusarium wilt in tomato germplasmCrop Breeding and Applied Biotechnology 23:e43532311
• Ke-xin Y, Xiang C, Qing-qing H, Yi-an Y, Xiao-ming W, Ai-chun X, Jian G, Feng G2023 Development of a tetra-primer ARMS-PCR for identification of sika and red deer and their hybridsAnalytical Sciences 39:1947-1956
• Khound R, Rajput SG, Schnable JC, Vetriventhan M, Santra DK2024 Genome-wide association study reveals marker-trait associations for major agronomic traits in proso millet (Panicum miliaceum L.)Planta 260:44
• Kıraç H, Dalda Şekerci A, Coşkun ÖF, Gülşen O2022 Morphological and molecular characterization of garlic (Allium sativum L.) genotypes sampled from TurkeyGenetic Resources and Crop Evolution 69:1833-1841
• Kou M, Xu J, Li Q, Liu Y, Wang X, Tang W, Yan H, Zhang Y, Ma D2017 Development of SNP markers using RNA-seq technology and tetra-primer ARMS-PCR in sweet potatoJournal of Integrative Agriculture 16:464-470
• Lawrie RD, Massey SE2023 Agrigenomic diversity unleashed: Current single nucleotide polymorphism genotyping methods for the agricultural sciencesApplied Biosciences 2:565-585
• Mammadov J, Aggarwal R, Buyyarapu R, Kumpatla S2012 SNP markers and their impact on plant breedingInternational Journal of Plant Genomics 2012:1-11
• Marr KL, Xia Y-M, Bhattarai NK2007 Allozymic, morphological, phenological, linguistic, plant use and nutritional data of Benincasa hispida (Cucurbitaceae)Economic Botany 61:44-59
• Medrano RFV, Oliveira CA2014 Guidelines for the Tetra-Primer ARMS-PCR technique developmentMolecular Biotechnology 56:599-608
• Nguyen PDT, Le KT, Nguyen NH2024 Development of tetra-primer ARMS-PCR to genotype the G1178A SNP on the Cucumis sativus bitterness geneVegetos 38:2099-2104
• Nie J, Huang H, Wu S, Lin T, Zhang L, Lv L, Shi Y, Guo Y, Zhang Q, Li Y, Kong W, Li H, Yang Z, Li W, Xu L, Ma N, Zhang Z, Sun C, Sui X2025 Molecular regulation and domestication of parthenocarpy in cucumberNature Plants 11:176-190
• Sagar V, Devi J, Tiwari S, Kumar R, Behera TK2025 Ash gourd crop biodiversity: Conservation and use of genetic resources. In Kalia P (ed) Vegetable crops. Springer, Singapore, p. 609-622
• Samuels L, Kunst L, Jetter R2008 Sealing plant surfaces: Cuticular wax formation by epidermal cellsAnnual Review of Plant Biology 59:683-707
• Sidek N, Tan BC, Mebus K, Taheri S, Teo CH2024 De novo transcriptome assembly and development of EST-SSR derived functional domain markers for Pandanus amaryllifoliusCrop Breeding and Applied Biotechnology 24:e501424414
• Song H, Lee K, Subburaj S, McGregor C, Lee G-J2023 ClPSY1 gene-based SNP markers identified from whole-genome resequencing for the determination of orange flesh color and carotenoid content in watermelonScientia Horticulturae 318:112120
• Su L, Cheng Z, Wu Y, Deng Y, Bai W, Chen Z, Chen X, Li J, Wang P, Li Y, Liu Z2025 Development of InDel markers and construction of DNA fingerprints of wax gourd (Benincasa hispida) based on whole genome re-sequencingScientia Horticulturae 349:114227
• Swamy K2022 Origin, distribution, taxonomy, genetic diversity and genetic improvement of ash gourd [Benincasa hispida (Thunb.) Cogn.]Vegetable Science 49:1-14
• Trivedi P, Liu G-S, Klavins L, Bhattacharya R, Jokipii-Lukkari S, Mitra A, Klavins M, Fu D, Jaakola L, Szakiel A, Karppinen K2026 Scratching the surface: The diversity and roles of triterpenoids in plant cuticular waxesPhytochemistry Reviews 25:2149-2182
• Wang X, Kong L, Zhi P, Chang C2020 Update on cuticular wax biosynthesis and its roles in plant disease resistanceInternational Journal of Molecular Sciences 21:5514
• Wu W, Jiang B, Liu R, Han Y, Fang X, Mu H, Farag MA, Simal-Gandara J, Prieto MA, Chen H, Xiao J, Gao H2023 Structures and functions of cuticular wax in postharvest fruit and its regulation: A comprehensive review with future perspectivesEngineering 23:118-129
• Xuan CD, Dinh TN, Thi TD, Thi TN, Van HT, Thi DP2019 Study on agrobiological characteristics and genetic diversity of wax gourd varieties using DNA markersJournal of Vietnam Agricultural Science and Technology 12:149-155
• Yan J, Chen F, Sun P, Liu W, Xie D, Qian Y, Jiang B2022 Genome-wide association study and genetic mapping of BhWAX conferring mature fruit cuticular wax in wax gourdBMC Plant Biology 22:539
• Yang Z, Lo YT, Quan Z, He J, Chen Y, Faller A, Chua T, Wu HY, Zhang Y, Zou Q, Li F, Chang P, Swanson G, Shaw PC, Lu Z2023 Application of a modified tetra-primer ARMS-PCR assay for rapid Panax species identity authentication in ginseng productsScientific Reports 13:14396
• Zhang J, Yang J, Zhang L, Luo J, Zhao H, Zhang J, Wen C2020 A new SNP genotyping technology Target SNP-seq and its application in genetic analysis of cucumber varietiesScientific Reports 10:5623

Edited by

• SCIENTIFIC EDITOR:
  Luiz Antônio dos Santos Dias

Publication Dates

• Publication in this collection
  25 Sept 2026
• Date of issue
  2026

History

• Received
  26 Mar 2026
• Accepted
  14 May 2026
• Published
  21 May 2026