Open-access PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

Fluorescent PCR associated with capillary electrophoresis as a diagnostic tool of bacteria in semen

Resumo

Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10³ bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial.

Brucella abortus; diagnóstico; eletroforese capilar; PCR fluorescente; sêmen bovino


Abstract

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

bovine semen; Brucella abortus; capillary electrophoresis; diagnostic fluorescent PCR


Referências bibliográficas

  • AMIN, A.S.; HAMDY, M. E. R.; IBRAHIM, A. K. Detection of Brucella Militensis in semen using the polymerase chain reaction assay. Veterinary Microbiology, v.85, p.37-44, 2001.
  • BRICKER, B. J.  PCR as a diagnostic tool for brucelosis. Veterinary Microbiology, v.90, p.435-446, 2002.
  • CAMARGOS, M. F.; OLIVEIRA, A. M.; JUNIOR, A. A. F.; RIVETTI, A. V.; MOTTA, P. M. C.; ASSIS, R. A.; LEITE, R.C. Aplicação da reação em cadeia pela polimerase para detecção de Mycoplasma spp na rotina de cultivos celulares. Ciência Animal Brasileira, v.9, n.3, p.786-790, 2008.
  • CHECA, M. L.; DUNNER, S.; CANÓN.  Prediction of X and Y chromosome content in bovine sperm by using DNA pools through capillary electrophoresis. Theriogenology, v.58, n.8, p.1579-1586, 2002.
  • CICERONI, L.; CIARROCCHI, S.; CIERVO, A.; PETRUCCA, A.; PINTO, A.; CALDERARO, A.; VIANI, I.; GALATI, L.; DETTORI, G.; CHEZZI, C. Differentiation of leptospires of the serogroup pomona by monoclonal antibodies, pulsed-field gel eletrophoresis and arbritrarily primed polymerase chain reaction. Research in Microbiology, v.153, p.37-44, 2002.
  • DIAS F. E. F.; AOKI, S.  M.;  MESQUITA,  L.G.;  NUNES, C. M.; GARCIA, J. F.  Detecção de Leptospira pomona em sêmen bovino por eletroforese capilar fluorescente. Brazilian Research Journal of Veterinary Animal Science, v.43, n.3, p.394-399, 2006.
  • ENGLUND, S.; BOLSKE, G.; BALLAGI-PORDÁNY, A.; JOHANSSON, K. E. Detection of Mycobacterium avian subsp. paratuberculosis in tissue samples by single, fluorescent and nested PCR based on the IS900 gene. Veterinary Microbiology, v.81, n.3, p.257-271, 2001.
  • FIGUEIREDO, E. E. S.; SILVA, M. G.; FONCECA, E. S.; SILVA, J. T.; PASCHOALIN, V. M. F. Detecção do complexo Mycobacterium tuberculosis no leite pela reação em cadeia da polimerase seguida de análise de restrição do fragmento amplificado (PRA). Ciência Animal Brasileira, v.9, n.4, p. 1023-1033, 2008.
  • HEINEMANN, M. B.; GARCIA, J. F.; NUNES, C. M.; GREGORI, F.; HIGA, Z. M. M.; VASCONCELLOS, S. A.; RICHTZENHAIN, L. J. Detection and differentiation of Leptospira spp serovars in bovine semen by polimerase chain reaction and restriction fragment length polymorphism. Veterinary Microbiology, v.73, p.261-267, 2000.
  • HEINEMANN, M. B.; GARCIA, J. F.; NUNES, C. M.; MORAIS. Z. M.; GREGORI, F.; CORTEZ, A.; VASCONCELLOS, S. A.; VISINTIN, J. A.; RICHTZENHAIN, L. J. Detection of leptospires in bovine semen by polymerase chain reaction. Australian Veterinary Journal, v.77, n.1, p.32-34, 1999.
  • LEAL-KLEVEZAS, D. S.; MARTÍNEZ-VÁZQUEZ, I. O.; LÓPEZ-MERINO, A.; MARTÍNEZ-SORIANO, J. P. Single-step PCR for detection of Brucella spp. from blood and milk of infected animals. Journal of Clinical Microbiology, v.33, p.3087-3090, 1995.
  • MANTEROLA, L.; TEJERO-GARCÉS, A; FICAPAL, A.;  SHOPAYEVA, G.; BLASCO, J. M.; MARIN, C. M.; LOPEZ-GONI, I. Evaluation of a PCR test for the diagnosis of Brucella ovis infection in semen samples from rams. Veterinary Microbiology, v.92, p.65-72, 2003.
  • MASRI, S. A; NGUYEN, P. T.; GALE, S. P.; HOWARD, C. J.; JUNG, S. A.A polymerase chain reaction assay for the detection of Leptospira spp in bovine semen. Canadian Journal Veterinary Research, v.61, 15-20, 1997.
  • MOORE, S.; GUNN, M.; WALLS, D.  A rapid and sensitive PCR-based diagnostic assay to detect bovine herpesvirus 1 in routine diagnostic submissions. Veterinary Microbiology, v.75, p.145-153, 2000.
  • MUKHUFHI, N.; IRONS, P. C.; MICHEL, A. PETA, F.  Evaluation of a PCR test for the diagnosis of Tritrichomonas  foetus infection in bulls: effects of sample collection methods, storage and transport medium on the test. Theriogenology,  v.60,  n.7, p.1269-1278, 2003.
  • ORTEGA-MORA, L. M.; FERRE, I.; DEL-POZO, I.;  CAETANO-DA-SILVA, A.; COLLANTES-FERNANDEZ, E.; REGIDOR-CERRILLO, J.; UGARTE-GARAGALZA, C.; ADURIZ, G. Detection of Neospora caninum in semen of bulls. Veterinary Parasitology, v.117, n.4, p. 301-308, 2003.
  • POESTER, F.P; GONÇALVES, V.S.; LAGE, A.P. Brucellosis in Brazil. Veterinary Microbiology, v.90, n.1-4, p. 55-62, 2002.
  • ROCHA, M. A.; BARBOSA, E. F.; GUIMARAES, S. E. F.; DIAS NETO, E.; GOUVEIA, A. M. G. A high sensitivity-nested PCR assay for BHV-1 detection in semen of naturally infected bulls. Veterinary Microbiology, v.63, n.1, p.1-11, 1998.
  • DUS SANTOS, M. J.; TRONO, K; LAGER, I.  WIGDOROVITZ, A. Development of a PCR to diagnose BLV genome in frozen semen samples. Veterinary Microbiology, v.119,n.1, p.10–18, 2007.
  • SANTURDE, G.; DA SILVA, N.; VILLARES, R.; TABARÉS, E.; SOLANA, A.; BAUTISTA, J. M.; CASTRO, J.M. Rapid and high sensitivity test for direct detection of bovine herpes virus – 1 genome in clinical samples Veterinary Microbiology, v. 49, n.1-2, p.81-92, 1996.
  • SMITS, C. B.; VAN MAANEN, C.; GLAS, R. D.;  DE GEE, A. L. W.; DIJKSTRAB, T.; VAN OIRSCHOT, J. T.; RIJSEWIJK, F. A. M. Comparison of three polymerase chain reaction methods for routine detection of bovine herpesvirus 1 DNA in fresh bull semen. Journal of Virological Methods, v.85, p.65-73, 2000.
  • SONG, J. M.; MOBLEY, J.; VO-DINH, T.  Detection of bacterial pathogen DNA usinganintegrated complementary metal oxide semiconductor microchip system with capilary array eletroforesis. Journal of Chromatography B, v.783, p.501-508, 2003.
  • THIBIER, M.; GUERIN, B.  Hygienic aspects of storage and use of semen for artificial insemination. Animal Reproduction Science, v.62, n.1-3, p.233-251, 2000.
  • VARGAS, A. C.; COSTA, M. M.; VAINSTEIN, M. H.; KREUTZ, L. C.; KREUTZ, L. C.; NEVES, J. P. Phenotypic and molecular characterization of bovine Campylobacter fetus strains isolated in Brazil. Veterinary Microbiollgy, v.93, n.2, p.121-132, 2003.
  • VELOSO, I. F.; LOPES, M. T. P.; SALAS, C. E.; MOREIRA, E. C. A comparison of three DNA extractive procedures with Leptospira for polymerase chain reaction analysis. Memoriais do Instituto Osvaldo Cruz, v.95, n.3, p.339-343, 2000.
  • VICENTE, I. I. G.; AMARAL, L. A.; MELO, P. C.; FERREIRA, L. M. Isolamento de cepas de Escherichia coli shigatoxigênicas sorogrupos O157 e O111 por separação imunomagnética após detecção por PCR (nota de pesquisa). Ciência Animal Brasileira, v. 9, n. 3, p. 753-758, 2008.

Datas de Publicação

  • Publicação nesta coleção
    29 Out 2013
  • Data do Fascículo
    Set 2013

Histórico

  • Recebido
    05 Out 2009
  • Aceito
    07 Maio 2013
location_on
Universidade Federal de Goiás Universidade Federal de Goiás, Escola de Veterinária e Zootecnia, Campus II, Caixa Postal 131, CEP: 74001-970, Tel.: (55 62) 3521-1568, Fax: (55 62) 3521-1566 - Goiânia - GO - Brazil
E-mail: revistacab@gmail.com
rss_feed Acompañe los números de esta revista en su lector de RSS
Ir para arriba Notificar error