Antimicrobial resistance in bacteria isolated from environmental surfaces in a municipal dog shelter: a One Health approachAbstract
Shared environments can act as reservoirs of resistant bacteria, facilitating their dissemination between species and posing a risk to public health. Dog shelters, often characterized by high animal density and limited sanitary infrastructure, may favor the persistence and circulation of these microorganisms. This study aimed to evaluate the antimicrobial resistance profile of bacteria present on environmental surfaces in a municipal dog shelter located in northwestern Paraná, Brazil. Sixty samples were collected from frequently handled surfaces using sterile swabs. The samples were cultured in Brain Heart Infusion broth and subsequently plated on blood agar for the isolation of Staphylococcus spp. and Enterobacteriaceae. Identification was performed based on morphological characteristics and biochemical tests, while antimicrobial resistance was determined using the disk diffusion method. Isolates resistant to oxacillin and cefoxitin were subjected to PCR for the detection of the mecA gene. Among the samples analyzed, 45 % were identified as Staphylococcus spp. and 11 % as enterobacteria. Most staphylococcal isolates showed high resistance to several antimicrobials, with 88.9 % classified as multidrug-resistant. None of the isolates carried the mecA gene. These results demonstrate the presence of multidrug-resistant bacteria on shelter surfaces, indicating a potential risk of dissemination among animals, humans, and the environment.
Keywords:
Dog shelters; Enterobacteriaceae; multidrug resistance; public health; staphylococci.
Resumo
Ambientes compartilhados podem atuar como reservatórios de bactérias resistentes, favorecendo sua disseminação entre espécies e representando risco à saúde pública. Abrigos de cães, frequentemente com alta densidade populacional e infraestrutura sanitária limitada, podem favorecer a persistência e circulação desses microrganismos. O objetivo deste estudo foi avaliar o perfil de resistência antimicrobiana de bactérias presentes em superfícies ambientais de um abrigo municipal de cães no noroeste do Paraná, Brasil. Foram coletadas 60 amostras de superfícies frequentemente manipuladas, utilizando swabs estéreis. As amostras foram cultivadas em caldo Brain Heart Infusion e posteriormente semeadas em ágar sangue para isolamento de Staphylococcus spp. e enterobactérias. A identificação foi realizada por características morfológicas e testes bioquímicos, enquanto a resistência antimicrobiana foi determinada pelo teste de discodifusão. Isolados resistentes à oxacilina e cefoxitina foram submetidos à PCR para detecção do gene mecA. Das amostras analisadas, 45 % foram identificadas como Staphylococcus spp. e 11 % como enterobactérias. A maioria dos estafilococos apresentou elevada resistência a diversos antimicrobianos, com 88,9 % classificados como multirresistentes. Nenhum isolado apresentou o gene mecA. Os resultados evidenciam a presença de bactérias multirresistentes em superfícies do abrigo, indicando potencial risco de disseminação entre animais, humanos e ambiente.
Palavras-chave:
Abrigo de cães; enterobactérias; estafilococos; multirresistência; Saúde Pública.
1. Introduction
One Health is an integrated approach that recognizes the interconnection among human, animal, plant, and environmental health, as defined by the World Health Organization and the One Health Commission (1, 2). This approach promotes collaboration among multiple sectors to develop and implement policies, programs, legislation, and research aimed at improving health outcomes and addressing complex challenges such as food security, zoonotic diseases, and antimicrobial resistance (1-4). Although the term has been used for more than two decades (5), its scope has progressively evolved toward a more comprehensive framework encompassing these four interconnected dimensions.
The presence of bacteria in the environment dates back a long time (6), and it should be remembered that antimicrobial resistance has an ecological nature resulting from the interconnectedness and diversity of living systems on the planet. For this reason, it is known that some pathogenic bacteria and the genes responsible for resistance originate in the environment(3,6-8).
Antimicrobial resistance (AMR) has emerged as a major One Health challenge due to the interconnectedness of human, animal, plant, and environmental health (6-12). Environmental compartments may act as reservoirs and hotspots for antibiotic resistance genes, facilitating the persistence and dissemination of resistant microorganisms across different ecological niches (6, 8, 11). In veterinary settings, including hospitals, clinics, and animal shelters, the close interaction among animals, humans, and contaminated surfaces may favor the circulation of multidrug-resistant bacteria and contribute to their maintenance in the environment (9, 10). Environmental surfaces frequently touched by animals and staff can serve as potential sources of microbial contamination, emphasizing the importance of biosafety and hygiene measures in these facilities. Furthermore, the exchange of resistant microorganisms between interconnected ecosystems highlights the need for continuous surveillance of antimicrobial resistance in veterinary environments under the One Health framework (6, 9, 10, 12).
Species such as Escherichia coli, Salmonella spp., Campylobacter spp., Clostridium chauvoei, Bacillus anthracis, Leptospira spp., Burkholderia pseudomallei, and Staphylococcus spp. are examples of bacteria that can be transmitted to humans and animals through direct contact with soil, ingestion of contaminated water or food, or by biological vectors. This transfer can occur directly or indirectly, facilitated by human activities such as intensive agriculture, the indiscriminate use of antibiotics, and the improper disposal of waste. Exposure to these bacteria poses a risk to public and animal health (7, 10-12). One of the hypotheses of this study was that frequently handled environmental surfaces in a municipal dog shelter may serve as reservoirs of multidrug-resistant bacteria. Therefore, this study aimed to investigate the occurrence and antimicrobial resistance profiles of Staphylococcus spp. and Enterobacteriaceae isolated from environmental surfaces in a municipal dog shelter located in northwestern Paraná, Brazil, and to evaluate whether phenotypic resistance to β-lactam antibiotics in Staphylococcus spp. is associated with the presence of the mecA gene.
2. Material and methods
2.1 Sample, sampling and location of the sample
This descriptive cross-sectional study was conducted in a municipal dog shelter located in a city in the northwestern region of Paraná State, Brazil. A total of 60 environmental samples were collected from frequently handled surfaces and equipment. Sampling was performed by convenience, and collection sites were selected based on their frequent contact with animals and staff, as well as their potential role as reservoirs of environmental contamination and antimicrobialresistant microorganisms.
2.2 Collection of environmental swabs
Sixty sterile swabs were used for sample collection. The selected sampling points included alcohol bottles, cabinets, scales, counters and worktops, water fountains, sprayers, yokes, cell phones, feeders, stethoscopes, muzzles, cages, refrigerators, light switches, laryngoscopes, doorknobs, hoses, surgical materials, tables, shovels, sinks, autoclave doors, gates, respirators, supports, faucets, brooms, and medication cabinets. These sites were chosen because they represent high-contact surfaces frequently handled by animals and personnel and may act as reservoirs for microbial contamination.
Before sampling, the swabs were pre-moistened with sterile 0.85 % saline solution and applied to the entire surface of each selected object using light pressure and rotating movements. Since the sampled objects differed in size and shape, no fixed sampling area was established. After collection, the swabs were immediately placed in Amies transport medium and transported to the laboratory for microbiological processing.
2.3 Laboratory techniques
2.3.1 Isolation of samples and identification of isolates
Each sample was initially cultured in Brain Heart Infusion (BHI) broth (Laborclin, Pinhais, Paraná, Brazil) for 24 hours at 37 °C and then seeded onto blood agar (8 % Blood Agar Base) (Laborclin, Pinhais, Paraná, Brazil) and incubated at 37 °C for 24 to 48 hours for the isolation of Staphylococcus spp. and enterobacteria. After the incubation period, the macroscopic and microscopic characteristics of the colonies were observed, and biochemical tests (catalase and coagulase) were performed to differentiate between coagulase-positive (CoPS) and coagulasenegative (CoNS) Staphylococcus spp., according to Quinn et al. (13). Thus, Staphylococcus isolates were classified only according to their coagulase production profile, without specieslevel identification. Although this approach is suitable for phenotypic characterization, it limits the epidemiological interpretation of the findings and does not allow extrapolation regarding the occurrence or distribution of specific Staphylococcus species.
The biochemical identification of bacteria belonging to the Enterobacteriaceae family was performed using a set of biochemical tests included in the Enterobacteriaceae Kit (Laborclin, Pinhais, Paraná, Brazil), according to the manufacturer's instructions.
2.3.2 Bacterial resistance profile
CoPS and CoNS isolates were subjected to the disk diffusion test, performed according to the Clinical and Laboratory Standards Institute guidelines (14). The antibiotics tested were selected based on the agents and concentrations indicated by CLSI (14, 15) and Br-CAST (16) and by criteria of clinical and epidemiological relevance for Staphylococcus spp.: amikacin (30 µg), amoxicillin (10 µg), amoxicillin + clavulanic acid (20/10 µg), azithromycin (15 µg), cefoxitin (30 µg), ceftiofur (30 µg), clindamycin (2 µg), chloramphenicol (30 µg), doxycycline (30 µg), erythromycin (15 µg), meropenem (10 µg), norfloxacin (10 µg), oxacillin (1 µg), and rifampicin (5 µg) (Laborclin, Pinhais, Paraná, Brazil).
And the enterobacteria isolates were subjected to the disk-diffusion test (14). The antibiotics were selected according to recommendations, agents, and concentrations of CLSI (14, 15) and BrCAST (16), and by criteria of clinical and epidemiological relevance for enterobacteria: amikacin (30 µg), amoxicillin + clavulanate (20/10 µg), cefoxitin (30 µg), chloramphenicol (30 µg), ceftiofur (30 µg), doxycycline (30 µg), meropenem (10 µg), norfloxacin (10 µg) (Laborclin, Pinhais, Paraná, Brazil). All isolates resistant to three or more classes of antibiotics were classified as multidrugresistant (MDR) (14-16).
2.3.3 mecA gene research
DNA from Staphylococcus spp. isolates classified as resistant to oxacillin and cefoxitin were extracted using the Purelink Genomic DNA Kit according to the manufacturer's instructions, and PCR reactions were performed using the mecA1 (AAAATCGATGGTAAAGGTTGG) and mecA2 (AGTTCTGCAGTACCGGATTTG) primers following Murakami et al (17) methodology. The amplification of the products was visualized by electrophoresis on a 2 % agarose gel stained with Gel Red using a 100 bp molecular marker, and the products were visualized as a single 533 bp band. As a positive control, a previously confirmed mecA gene-positive sample was used, while Milli-Q water was employed as the negative control.
The exclusive investigation of the mecA gene is justified by its pivotal role as the principal molecular determinant of methicillin resistance in Staphylococcus spp., its detection represents the most specific and widely accepted marker for methicillin-resistant phenotypes, enabling accurate identification of clinically relevant resistant isolates. Furthermore, targeted mecA screening is epidemiologically valuable for monitoring the dissemination of resistant strains in both hospital and community settings, supporting antimicrobial resistance surveillance and control strategies.
3. Results
Of 60 environmental samples collected at the shelter, 11 % (7/60) were identified as enterobacteria, and 45 % (27/60) of the isolates were phenotypically identified as Staphylococcus spp. Of these, 18.5 % (5/27) were coagulase-negative Staphylococcus, while 81.5 % (22/27) of the isolates were identified as coagulase-positive Staphylococcus (Table 1).
Distribution and presumptive identification of bacterial isolates recovered from environmental surfaces and fomites in a municipal dog shelter located in a city in the northwestern region of Paraná State, Brazil, 2023.
Staphylococcus spp. isolates showed a higher percentage of resistance to the following antibiotics; clindamycin with 96. 3 % (26/27), followed by Rifampicin 88.9 % (24/27), oxacillin 1.5 % (22/27), erythromycin 77.8 % (21/27), and azithromycin with 74.1 % (20/27) (Figure 1).
Relationship between the percentage of Staphylococcus spp. isolates collected from the environment resistant to each antibiotic, environmental samples collected in a municipal shelter. Legend: AMI - amikacin, AMO - amoxicillin, AMC - amoxicillin + clavulanate, AZI - azithromycin, CFO - cefoxitin, CLI - clindamycin, CLO - chloramphenicol, CTF - ceftiofur, DOX - doxycycline, ERI - erythromycin, MER - meropenem, NOR - norfloxacin, OXA - oxacillin, RIF - rifampicin.
The percentage of antibiotic resistance among the types of bacterial isolates was balanced; in seven of the 14 antibiotics, CoPS showed a higher percentage of resistance than CoNS, with amoxicillin + clavulanate, amoxicillin, azithromycin, doxycycline, erythromycin, norfloxacin, and oxacillin being the most prominent. Similarly, in seven of the 14 antibiotics, CoNS show a higher percentage of resistance than CoPS (chloromycin-positive anti-inflammatory drugs), notably: amikacin, cefoxitin, clindamycin, chloramphenicol, ceftiofur, meropenem, and rifampicin (Figure 2).
Relationship between the percentage of antibiotic resistance and the type of bacterial isolate in environmental samples collected at a municipal shelter. Legend: AMI - amikacin, AMO - amoxicillin, AMC - amoxicillin + clavulanate, AZI - azithromycin, CFO - cefoxitin, CLI - clindamycin, CLO - chloramphenicol, CTF - ceftiofur, DOX - doxycycline, ERI - erythromycin, MER - meropenem, NOR - norfloxacin, OXA - oxacillin, RIF - rifampicin, CoNS - Coagulase-Negative Staphylococcus, CoPS - Coagulase-Positive Staphylococcus non-aureus.
Relationship between the percentage of resistant samples for each antibiotic, environmental samples collected in a municipal shelter. Legend: AMI - amikacin, AMO - amoxicillin, AMC - amoxicillin + clavulanate, CFO - cefoxitin, CLO - chloramphenicol, CTF - ceftiofur, DOX - doxycycline, MER - meropenem, NOR - norfloxacin.
Approximately 88.9 % (24/27) of Staphylococcus spp. isolates collected from the environment were multidrug-resistant. Regarding the collection site, was demonstrate that the samples collected from the sink, cabinet/cart, scale in the treatment room, and cage were the samples that showed resistance to the highest number of antibiotics tested, 92.8 % (13/14). Interestingly, samples from commercial cell phones also showed resistance to different antibiotics in 85.7 % (12/14). No isolate expressed the mecA gene.
Isolates from environmental samples characterized as enterobacteria were phenotypically identified as Hafnia alvei, Morganella morganii, and Escherichia coli. Furthermore, 85.7 % (6/7) of these isolates were multidrug-resistant, meaning they were resistant to at least one antibiotic from three different classes (15) (Table 2).
Antimicrobial resistance profile of Enterobacteriaceae isolates obtained from samples collected at a municipal dog shelter located in a city in the northwestern region of Paraná State, Brazil, 2023.
The bacterial isolates identified as enterobacteria from environmental samples with the highest percentage of resistance (Figure 4) were amikacin, amoxicillin, chloramphenicol, cefoxitin, and ceftiofur, with 85.7 % (6/7) of resistant isolates, followed by amoxicillin + clavulanate with 71.4 % (5/7) and meropenem with 57.1 % (4/7) of resistant isolates.
4. Discussion
The One Health approach to the environment in which animals live is extremely important, given that 75 % of diseases that exist today are of zoonotic origin, and the environment in which they are found may be contaminated with different microorganisms, resistant or not to antimicrobials. This makes studies on this environment highly relevant to society (7, 8, 18, 19).
The present study showed a prevalence of 45 % (27/60) Staphylococcus spp., of which 18.5 % (5/27) were Coagulase Negative Staphylococcus, while 81.5 % (22/27) of the isolates were identified as Coagulase Positive Staphylococcus, and 11 % (7/60) as enterobacteria, a different result. The results obtained in the present study regarding the types of bacteria were different from those found by Horsman et al. (20) in their work carried out in Australia, where of the 50 samples collected from an animal shelter, 60 % (30/50) were identified as enterobacteria, while 4 % (2/50) were identified as Staphylococcus spp, as well as the work of Adams et al. (21), carried out in an animal shelter in the United States of America, where enterobacteria were isolated in 100 % (17/17) of the samples collected from the environment of these places.
The observed variations in bacterial prevalence among the countries mentioned may reflect a combination of multifactorial influences, including differences in environmental conditions, healthcare and veterinary practices, antimicrobial usage patterns, and hygiene and sanitation standards. These factors likely interact in complex ways, making direct comparisons between regions challenging. This scenario reinforces the importance of the One Health approach, which recognizes the interconnectedness of humans, animals, and the environment in the development of strategies to monitor, prevent, and control the dissemination of antimicrobial-resistant microorganisms (22).
In this study, Staphylococcus spp. were isolated from a cabinet/cart, the scale in the treatment room, the counter, water fountains, a pre-operative spray bottle, a cell phone, a stethoscope, an alcohol bottle, a cage, a refrigerator, a laryngoscope, doorknobs, tables, a feces collection scoop, a sink, the autoclave door, the kennel gate, a respirator, PPE support, fluid therapy support, a faucet, and a broom. Staphylococcus spp. are bacteria widely distributed in the environment and recognized as part of the commensal microbiota of the skin and mucous membranes of humans and animals, including dogs, and can be transferred between hosts and the environment through direct or indirect contact with contaminated surfaces. Commonly used objects can act as reservoirs and vehicles for the spread of these bacteria, favoring the occurrence of opportunistic infections (23). The presence of Staphylococcus spp. in these locations reinforces the importance of proper hygiene and environmental microbiological monitoring as essential strategies within the One Health approach, aimed at preventing the spread of resistant strains.
The occurrence of Staphylococcus spp. on environmental surfaces observed in the present study is consistent with findings reported in veterinary hospitals and clinics, where these microorganisms are frequently recovered from high-touch surfaces, medical equipment, consultation rooms, surgical areas, and intensive care units. Veterinary healthcare environments are recognized as important reservoirs of potentially pathogenic and antimicrobial-resistant bacteria due to the constant movement of animals, staff, and visitors, as well as the frequent use of antimicrobials. Studies conducted in veterinary teaching hospitals and referral centers have demonstrated widespread environmental contamination by staphylococci, including multidrug-resistant strains, highlighting the role of environmental surfaces in the maintenance and dissemination of these microorganisms (23).
Animal shelters represent unique ecological niches that may facilitate the persistence of resistant bacteria. Unlike hospitals, shelters often accommodate large numbers of animals with unknown clinical histories, previous antimicrobial exposure, and diverse origins. High animal density, frequent animal turnover, and challenges related to infrastructure and sanitation may contribute to environmental contamination and bacterial circulation. Previous studies conducted in companion animal shelters have reported the recovery of multidrug-resistant staphylococci and enterobacteria from both animals and environmental surfaces, supporting the findings observed in the present investigation and emphasizing the importance of continuous microbiological surveillance in these facilities (20, 21).
Environmental contamination by antimicrobial-resistant bacteria is not restricted to veterinary facilities. Several studies evaluating environmental surfaces in public spaces, households, rehabilitation centers, veterinary clinics, and animal-associated environments have demonstrated that frequently touched objects can serve as reservoirs of resistant microorganisms. Surfaces such as door handles, sinks, workbenches, cages, mobile phones, and medical devices have been identified as important points of bacterial persistence and transmission (10, 23). In the present study, resistant isolates were recovered from many of these same surfaces, reinforcing the concept that environmental reservoirs may contribute to the maintenance of antimicrobial resistance within interconnected human-animal-environment interfaces (6, 8, 10, 11).
The similarities observed among animal shelters, veterinary hospitals, clinics, and other animal-associated environments suggest that antimicrobial resistance should be addressed through integrated infection prevention and control strategies. Environmental hygiene, routine disinfection protocols, antimicrobial stewardship programs, and continuous surveillance of resistant microorganisms are essential measures to reduce the persistence and spread of multidrug-resistant bacteria (3, 9, 10, 22). From a One Health perspective, monitoring environmental contamination in animal shelters may provide valuable information regarding potential reservoirs of resistance and contribute to broader efforts aimed at mitigating antimicrobial resistance across interconnected ecosystems (1-3, 9).
Staphylococcus spp. isolates were resistant to clindamycin (96.3 %), followed by rifampicin (88.9 %), oxacillin (81.5 %), erythromycin (77.8 %), and azithromycin (74.1 %), and this result is similar to the work of Horsman et al..(20), where the same antibiotics had a prevalence of 100 % of tested isolates resistant to them.
These antibiotics are commonly used in veterinary medicine for cases of pyoderma, abscesses, osteomyelitis, dental infections, skin infections, respiratory infections, gastrointestinal infections, and urinary tract infections (24). Because these are environments that house dogs of diverse origins - whether abandoned, rescued from stray animals, or born within the shelter itself - the health of these animals may be compromised, making the use of antibiotics unavoidable in these settings (20).
The high resistance of Staphylococcus spp. to these antibiotics can be explained by multiple genetic and adaptive mechanisms that may reflect selective pressure caused by the frequent and often inappropriate use of these drugs, mutations, and cross-resistance. Furthermore, the ability to form biofilms further increases bacterial tolerance, creating physical barriers and favoring the survival of less sensitive subpopulations (22, 25).
The absence of the mecA gene is a critical finding, as it indicates that methicillin resistance in the investigated Staphylococcus spp. isolates is not mediated by the canonical PBP2a-encoding mechanism. This suggests that alternative resistance pathways, such as the overexpression or modification of other penicillin-binding proteins or the presence of mecA homologs (e.g., mecC), may be involved. Therefore, mecA-negative isolates should not be immediately classified as susceptible without further phenotypic and molecular characterization, highlighting the importance of complementary diagnostic approaches to accurately define the resistance profile.
The detection of oxacillin resistance in Staphylococcus spp. isolates from dogs in the absence of the mecA gene highlights the complexity of β-lactam resistance mechanisms and the limitations of phenotypic testing as a standalone diagnostic tool. Although mecA remains the principal determinant of methicillin resistance, studies involving canine isolates have reported mecA-negative oxacillin-resistant strains, suggesting the involvement of alternative mechanisms. These may include the presence of mecC, a mecA homolog that can be overlooked by conventional molecular assays, as well as hyperproduction of β-lactamases, which is particularly associated with borderline oxacillin-resistant Staphylococcus aureus (BORSA) phenotypes. Additionally, modifications in native penicillin-binding proteins (PBPs) and regulatory changes affecting cell wall synthesis can reduce β-lactam affinity and contribute to reduced susceptibility. The coexistence of these mechanisms underscores the heterogeneity of methicillin/oxacillin resistance in staphylococci from dogs and reinforces that mecA-negative phenotypes should not be interpreted as fully susceptible without further molecular investigation (26-29).
Enterobacteria phenotypically identified as Hafnia alvei, Morganella morganii, and Escherichia coli were isolated from scales, water fountaings, feeders, cages, doorknobs, hoses, and surgical sterilization equipment. These objects are frequently found in hospital and community settings. These microorganisms, which are part of the intestinal microbiota of dogs and other animals, can contaminate areas of the environment due to contact with feces and secretions, increasing the risk of transmission and infection, especially in places with a high concentration of animals and human circulation (30) as occurs in dog shelters, such as the shelter in the study.
The presence of enterobacteria on surfaces such as cages, drinking fountains, and feeding utensils highlights the importance of rigorous cleaning and disinfection protocols to prevent the spread of pathogenic and antimicrobial-resistant strains, aligning with the principles of One Health for infection control in veterinary settings.
In this study, enterobacteria demonstrated the highest resistance rate (85.7 %) to amikacin, amoxicillin, chloramphenicol, cefoxitin, and ceftiofur, followed by amoxicillin + clavulanate with 71.4 % and meropenem with 57.1 % of resistant isolates. This result differs from that found by Horsman et al. (20) in their work carried out in Brisbane, Australia, where they found higher percentages of antimicrobial resistance to ticarcillin (93.10 %, 81/87), sulfamethoxazole + trimethoprim (60.91 %, 53/87), tetracycline (57.47 %, 50/87), and chloramphenicol (56.32 %, 49/87).
Some methodological limitations should be considered when interpreting the results of this study. First, bacterial identification was based exclusively on phenotypic methods. In the case of Staphylococcus spp., isolates were classified only as coagulase-positive (CoPS) or coagulasenegative (CoNS), which, although suitable for routine microbiological characterization, limits the epidemiological interpretation of the findings and does not allow extrapolation regarding the occurrence of specific species. Furthermore, no molecular methods were employed for specieslevel identification, preventing a more detailed assessment of the diversity and distribution of bacterial species present in the shelter environment. Another limitation is the small number of enterobacterial isolates obtained (n = 7), which restricts broader inferences regarding the antimicrobial resistance profile of these microorganisms in the studied setting. Therefore, future studies using larger sample sizes and molecular techniques for bacterial identification are warranted to provide a more comprehensive understanding of antimicrobial resistance dynamics in animal shelters.
Some limitations of this study should be considered when interpreting the findings. The identification of Staphylococcus spp. was based exclusively on phenotypic methods, with isolates being classified only as coagulase-positive (CoPS) or coagulase-negative (CoNS). Although this approach is widely used in routine microbiology and allows the assessment of antimicrobial resistance profiles, it limits the epidemiological interpretation of the results and precludes extrapolation regarding the occurrence and distribution of specific Staphylococcus species. In addition, the small number of enterobacterial isolates obtained restricts broader inferences about the resistance profile of these microorganisms in the shelter environment. Furthermore, only the mecA gene was investigated in oxacillinand cefoxitin-resistant isolates, and other mechanisms potentially involved in β-lactam resistance, were not evaluated. Therefore, future studies employing species-level identification and broader molecular characterization techniques are warranted to provide a more comprehensive understanding of antimicrobial resistance dynamics in animal shelters.
5. Conclusion
The results of this study demonstrate the presence of multidrug-resistant (MDR) bacteria in the canine shelter environment, including coagulase-positive Staphylococcus spp. (CoPS) and enterobacteria such as Escherichia coli and Morganella morganii, isolated from highcontact surfaces. These findings indicate environmental contamination by antimicrobial-resistant microorganisms under the conditions evaluated. The resistance profiles observed, including reduced susceptibility to several clinically relevant antimicrobials in both staphylococci and enterobacteria, highlight the presence of complex resistance patterns among environmental isolates. In oxacillin-resistant staphylococci, the absence of the mecA gene suggests that alternative resistance mechanisms may be involved, although these were not further investigated in this study.
However, this study did not assess transmission dynamics, colonization in animals or humans, or potential exposure pathways, and therefore no conclusions can be drawn regarding interspecies transmission or epidemiological impact. The findings are limited to environmental microbiological characterization and should not be extrapolated beyond the studied setting. Nonetheless, they support the importance of maintaining hygiene and biosafety practices in animal shelter environments and underscore the relevance of continued monitoring of antimicrobial resistance in such settings.
Generative AI use statement
The authors did not use generative artificial intelligence tools or technologies in creating or editing any part of this manuscript.
Data availability statement
The complete dataset supporting the results of this study is available upon request from the corresponding author.
References
-
1 WHO. World Health Organization. One Health. 2017. Available from: https://www.who.int/features/qa/one-health/en/
» https://www.who.int/features/qa/one-health/en/ -
2 One Health Commission. What is One Health? 2018. Available from: https://www.onehealthcommission.org/en/why_one_health/what_is_one_health/
» https://www.onehealthcommission.org/en/why_one_health/what_is_one_health/ -
3 Collignon PJ, McEwen SA. One health-its importance in helping to better control antimicrobial resistance. Trop Med Infect Dis. 2019;4:22. doi: https://doi.org/10.3390/tropicalmed4010022
» https://doi.org/10.3390/tropicalmed4010022 - 4 Deem SL. Veterinary Medicine and One Health. In: Diversity, Equity, and Inclusion in Veterinary Medicine. 2025. p.163-169.
-
5 Zinsstag J, Meisser A, Schelling E, Bonfoh B, Tanner M. From ‘Two Medicines’ to ‘One Health’ and Beyond. Onderstepoort J Vet Res. 2012;79:a492. doi: https://doi.org/10.4102/ojvr.v79i1.492
» https://doi.org/10.4102/ojvr.v79i1.492 -
6 Gaze WH, Krone SM, Larsson DGJ, Li XZ, Robinson JA, Simonet P, et al. Influence of humans on evolution and mobilization of environmental antibiotic resistome. Emerg Infect Dis. 2013;19:e120871. doi: https://doi.org/10.3201/eid1907.120871
» https://doi.org/10.3201/eid1907.120871 -
7 Banerjee S, Van der Heijden MG. Soil microbiomes and One Health. Nat Rev Microbiol. 2023;21:6-20. doi: https://doi.org/10.1038/s41579-022-00779-w
» https://doi.org/10.1038/s41579-022-00779-w -
8 Wang F, Fu YH, Sheng HJ, Topp E, Jiang X, Zhu YG, et al. Antibiotic resistance in the soil ecosystem: a One Health perspective. Curr Opin Environ Sci Health. 2021;20:100230. doi: https://doi.org/10.1016/j.coesh.2021.100230
» https://doi.org/10.1016/j.coesh.2021.100230 -
9 Velazquez-Meza ME, Galarde-López M, Carrillo-Quiróz B, Alpuche-Aranda CM. Antimicrobial resistance: One Health approach. Vet World. 2022;15:743. doi: https://doi.org/10.14202/vetworld.2022.743-749
» https://doi.org/10.14202/vetworld.2022.743-749 -
10 Costa PM, Loureiro L, Matos AJ. Transfer of multidrug-resistant bacteria between intermingled ecological niches: the interface between humans, animals and the environment. Int J Environ Res Public Health. 2013;10:278-294. doi: https://doi.org/10.3390/ijerph10010278
» https://doi.org/10.3390/ijerph10010278 -
11 Kunhikannan S, Thomas CJ, Franks AE, Mahadevaiah S, Kumar S, Petrovski S. Environmental hotspots for antibiotic resistance genes. MicrobiologyOpen. 2021;10:e1197. doi: https://doi.org/10.1002/mbo3.1197
» https://doi.org/10.1002/mbo3.1197 -
12 Ma LC, Zhao HQ, Wu LB, Cheng ZL, Liu C. Impact of the microbiome on human, animal, and environmental health from a One Health perspective. Sci One Health. 2023;2:100037. doi: https://doi.org/10.1016/j.soh.2023.100037
» https://doi.org/10.1016/j.soh.2023.100037 - 13 Quinn PJ, Markey BK, Leonard FC, Fitzpatrick ES, Fanning S, Hartigan PJ. Veterinary microbiology and microbial disease. Maryland Heights: Mosby; 1999. p.118-126.
- 14 Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. 5th ed. CLSI supplement VET01S. Wayne (PA): CLSI; 2020.
- 15 Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testing. 33rd ed. CLSI supplement M100. Wayne (PA): CLSI; 2023.
-
16 Brazilian Committee on Antimicrobial Susceptibility Testing (BRCAST). Clinical breakpoints table. Version 15.0 [Internet]. 2025. Available from: https://brcast.org.br
» https://brcast.org.br -
17 Murakami K, Minamide W, Wada K, Nakamura E, Teraoka H, Watanabe S. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. J Clin Microbiol. 1991;29:2240-2244. doi: https://doi.org/10.1128/jcm.29.10.2240-2244.1991
» https://doi.org/10.1128/jcm.29.10.2240-2244.1991 -
18 Erkyihun GA, Alemayehu MB. One Health approach for the control of zoonotic diseases. Zoonoses. 2022;2:963. doi: https://doi.org/10.15212/ZOONOSES-2022-0015
» https://doi.org/10.15212/ZOONOSES-2022-0015 -
19 Sari DAS. Antimicrobial resistance in companion animals: a growing One Health concern. Vet Life Sci Innov. 2025;2:1-19. https://velsi.id/index.php/velsi/article/view/10
» https://velsi.id/index.php/velsi/article/view/10 -
20 Horsman S, Rynhoud H, Zhou X, Soares Magalhães RJ, Gibson JS, Meler E. Environmental recovery of nosocomial bacteria in a companion animal shelter before and after infection control procedures. Front Vet Sci. 2021;7:608901. doi: https://doi.org/10.3389/fvets.2020.608901
» https://doi.org/10.3389/fvets.2020.608901 -
21 Adams RJ, Kim SS, Mollenkopf DF, Mathys DA, Schuenemann GM, Daniels JB, et al. Antimicrobial-resistant Enterobacteriaceae recovered from companion animal and livestock environments. Zoonoses Public Health. 2018;65:519-527. doi: https://doi.org/10.1111/zph.12462
» https://doi.org/10.1111/zph.12462 -
22 Mestrovic T, Aguilar GR, Swetschinski LR, Ikuta KS, Gray AP, Weaver ND, et al. The burden of bacterial antimicrobial resistance in the WHO European region in 2019: a cross-country systematic analysis. Lancet Public Health. 2022;7:e897-e913. doi: https://doi.org/10.1016/S2468-2667(22)00257-2
» https://doi.org/10.1016/S2468-2667(22)00257-2 -
23 Spratt HG, Millis N, Levine D, Brackett J, Millis D. Bacterial contamination of environmental surfaces of veterinary rehabilitation clinics. Animals. 2024;14:1896. doi: https://doi.org/10.3390/ani14131896
» https://doi.org/10.3390/ani14131896 - 24 Guardabassi L, Larsen J, Skaarup T. Guide to antimicrobial use in animals. Oxford: Blackwell Publishing; 2008.
-
25 János D, Viorel H, Ionica I, Corina P, Tiana F, Roxana D. Carriage of multidrug-resistant staphylococci in shelter dogs in Timisoara, Romania. Antibiotics. 2021;10:801. doi: https://doi.org/10.3390/antibiotics10070801
» https://doi.org/10.3390/antibiotics10070801 -
26 Hisirová S, Koščová J, Király J, Hajdučková V, Hudecová P, Lauko S, et al. Resistance genes and virulence factor genes in coagulase-negative and positive staphylococci of the Staphylococcus intermedius group (SIG) isolated from the dog skin. Microorganisms. 2025;13(4):735. doi: https://doi.org/10.3390/microorganisms13040735
» https://doi.org/10.3390/microorganisms13040735 -
27 Possa de Menezes M, Vedovelli Cardozo M, Pereira N, Bugov M, Verbisck NV, Castro V, et al. Genotypic profile of Staphylococcus spp., Enterococcus spp., and Escherichia coli colonizing dogs, surgeons, and environment during the intraoperative period: a cross-sectional study in a veterinary teaching hospital in Brazil. BMC Vet Res. 2025;21:147. doi: https://doi.org/10.1186/s12917-025-04611-4
» https://doi.org/10.1186/s12917-025-04611-4 -
28 Putriningsih PAS, Kampa J, Jittimanee S, Phuektes P. Characterization of oxacillin-resistant and oxacillin-susceptible mecA-positive Staphylococcus pseudintermedius from skin lesions and nasal cavities of dogs with clinical pyoderma. Animals (Basel). 2024;14(17):2613. doi: https://doi.org/10.3390/ani14172613
» https://doi.org/10.3390/ani14172613 -
29 Lai CH, Ma YC, Shia WY, Hsieh YL, Wang CM. Risk factors for antimicrobial resistance of Staphylococcus species isolated from dogs with superficial pyoderma and their owners. Vet Sci (Basel). 2022;9(7):306. doi: https://doi.org/10.3390/vetsci9070306
» https://doi.org/10.3390/vetsci9070306 -
30 Schmitt K, Kuster SP, Zurfluh K, Jud RS, Sykes JE, Stephan R, et al. Transmission chains of extended-spectrum betalactamase-producing Enterobacteriaceae at the companion animal veterinary clinic-household interface. Antibiotics. 2021;10:171. doi: https://doi.org/10.3390/antibiotics10020171
» https://doi.org/10.3390/antibiotics10020171
