Open-access 16S rRNA region based PCR protocol for identification and subtyping of Parvimonas micra

PCR baseada na região 16S rRNA para identificação e genotipagem de Parvimonas micra

Abstract

The present study established a PCR protocol in order to identify Parvimonas micra and to evaluate the intra-species diversity by PCR-RFLP of 16S rRNA partial sequence. The data indicated that the protocol was able to identify this species which could be clustered in five genotypes.

PCR-RFLP; 16S rRNA; anaerobic cocci


Resumo

O presente estudo estabeleceu um protocolo de PCR com a finalidade de identificar a espécie Parvimonas micra e avaliar a diversidade intra-espécie utilizando a técnica PCR-RFLP do gene que codifica o rRNA 16S. Os dados indicaram que o protocolo possibilitou a identificação da espécie e a distinção de 5 grupos genotípicos.

PCR; 16S rRNA; PCR-RFLP; anaeróbio


MEDICAL MICROBIOLOGY

SHORT COMMUNICATION

16S rRNA region based PCR protocol for identification and subtyping of Parvimonas micra

PCR baseada na região 16S rRNA para identificação e genotipagem de Parvimonas micra

C. Ota-Tsuzuki; A.T.P. Brunheira; M.P.A. Mayer*

Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, SP, Brasil

ABSTRACT

The present study established a PCR protocol in order to identify Parvimonas micra and to evaluate the intra-species diversity by PCR-RFLP of 16S rRNA partial sequence. The data indicated that the protocol was able to identify this species which could be clustered in five genotypes.

Key-words:Parvimonas micra, PCR-RFLP, 16S rRNA, anaerobic cocci.

RESUMO

O presente estudo estabeleceu um protocolo de PCR com a finalidade de identificar a espécie Parvimonas micra e avaliar a diversidade intra-espécie utilizando a técnica PCR-RFLP do gene que codifica o rRNA 16S. Os dados indicaram que o protocolo possibilitou a identificação da espécie e a distinção de 5 grupos genotípicos.

Palavras-chave:Parvimonas micra, PCR, 16S rRNA, PCR-RFLP, anaeróbio.

Parvimonas micra (formerly Peptostreptococcus micros) are gram positive anaerobic cocci (GPAC) originally classified in the genus Peptostreptococcus. These organisms are part of the indigenous microbiota of the oral cavity and gut of humans and animals and are frequently associated with polymicrobial infections (5). The species is present in high proportion in subgingival dental plaque from most periodontitis patients, mainly in those with diseased active sites (3,6) and smokers (14).

Three morphotypes of P. micra were described (smooth, rough and a smooth variant of rough type) (2-13), each one differing from the others on colonial morphology, hemolytic activity, hydrophobicity, surface structures and efficiency of adhesion to epithelial cells (3-13).

The identification of P. micra is usually performed by phenotypic methods based on colonial morphology in blood agar plates and biochemical tests which are time consuming, laborious and sometimes inconclusive (4). Polymerase chain reaction (PCR) protocols based on 16S rRNA gene sequences were developed for identification of P. micra by using species-specific primers (7-9) and for genotyping by employing RFLP analysis of amplicons obtained with universal primers for the 16S rRNA gene (8).

In order to facilitate the identification and subtyping of these organisms, the present study describes the identification of P. micra by PCR using a specific primer pair directed to 16S rRNA followed by RFLP analysis of the amplicons.

Seventy seven subgingival clinical isolates were obtained and comprised 22 isolates from chronic periodontitis patients, 10 from agressive periodontitis patients, 30 from gingivitis patients and 15 from healthy subjects. The primary identification was done on the basis of colonial morphology on PMM agar medium (12) and was further confirmed by using Rapid Id 32A kit (bioMérieux Òsa, Marcy l'Etoile, France).

P. micra strains HG 1467 (smooth), HG1259 (rough) (gently given by Dr. T.J. M. van Steenbergen) and ATCC 33270 were used as reference strains. Bacteria from other species as Porphyromonas gingivalis (ATCC 33277), Streptococcus pyogenes (ATCC10096), Streptococcus mutans (GS5) and Finegoldia magna (CCUG12461) were used to test the specificity of the PCR.

This project was approved by the Ethical Commitee on Human Research of the Institute of Biomedical Sciences, University of São Paulo, Brazil.

In order to design species-specific primers and to determine the restriction sites to be used in the RFLP analysis of amplicons, 16S rRNA partial sequences of the reference strains HG1467 and HG1259 were cloned and sequenced.

The 16S rRNA partial sequences were obtained by PCR performed using Triple Master Kit (Eppendorff, Hamburg, Germany) according to manufacturer's instructions, 1pM of each universal primers fD1 (5' AGAGTTTGATCCTGGCTCAG 3') and rP2 (5' ACGGCTACCTTGTTACGACTT 3')(Invitrogen, São Paulo, Brazil) (15) and template DNA from reference strains HG1467 and HG1259. The PCR amplicons were cloned into the pCR2.1-TOPO vector using TOPO TA Cloning kit - version P (Invitrogen, Carlsbad, CA, USA) and sequenced (ESPECIFICAR COMO. POR EX EM QUE APARELHO).

The cloned HG1467 and HG1259 partial sequences of the 16S rRNA gene were analyzed using DNA Star software (DNASTAR Inc., Madison, WI, USA) which compared them to sequences available in data base, including: Parvimonas micra strain (ATCC 33270 GenBank accession number), Finegoldia magna (GenBank accession number), the closest species related to P. micra, and Peptostreptococcus anaerobius (GenBank accession number). Based on multiple alignment analysis, two primers (PM2-upper and PM2-lower), which were conserved among P. micra and unique enough to differentiate it from other species, were designed. The amplicon positions are based on corresponding sequence data: ATCC 33270 (position 445 to 1220; GenBank accession number); HG1467 (position 49 to 816, GenBank accession number) and HG 1259 (position 384 to 1166, GenBank accession number).

Reactions with the selected primers PM2 Upper (5' GTA TCA TAG GAG GAA GCC 3') and PM2 Lower (5'TCT AGC TTC TCG TTG TAC C 3') were performed with P. micra reference strains (ATCC 33270, HG1467 and HG 1259) and also with template DNA of other bacterial species reported above. Amplification reaction was performed in 100 µl reactions comprising 20 µl template DNA obtained by a boiling method (1), 5U Taq DNA polymerase (Invitrogen), 1X Taq Buffer, 100 µM of each dNTP(Invitrogen), 1.5 mM MgCl2 and 2 pmol of each primer (PM2 Upper and PM2 Lower). Restriction analysis were performed by digesting the resulting amplicon with Hae III and Hinf I (Invitrogen, Carlsbad, USA), according to the manufacturer´s instructions. The products were resolved by electrophoresis in 1.5% agarose gels in Tris-acetate-EDTA buffer (TAE) and stained with ethidium bromide. Then, the same PCR protocol using template DNA from the 77 clinical P. micra isolates were done and the amplicons were digested with the restriction enzymes mentioned above.

Amplification reactions using the primers pair PM2-upper and PM2-lower established in this study resulted in amplicons, as expected, ranging from 776bp (ATCC 33270) to 786 (HG1467). None of the PCR using DNA template of other species including the most related species Finegoldia magna yielded amplicons, confirming the reaction specificity.

Amplicon identities were confirmed by restriction analysis with Hinf I and Hae III, resulting in three patterns as expected (Fig. 1 and Table 1). Alignment analysis revealed that the region of the primer (Pmic 2) also based on 16S rRNA partial sequence and described by Riggio et al. (2001) for P. micra identification (7) differed in four of twenty bases in the sequences of strains HG1467 and HG1259. These data were corroborated by the finding that primers reported by Riggio et al. (2001) (7) was able to identify only a subset of P. micra strains, since no amplicon could be obtained by using DNA isolated from 41 out 77 clinical isolates tested in the present study (data not shown) by employing the reaction reported by the authors.


PCRRFLP analysis using DNA from the 77 clinical isolates confirmed the intra-species polymorphism of the 16S rRNA region. Two additional unexpected PCR-RFLP profiles (isolates 36 and 583) were observed, indicating that at least 5 distinct genotypes among P. micra isolates (Fig. 1) can occur. As shown in Fig. 1, the profile obtained by Hae III digestion of amplicons obtained from isolates number 36 and number 583 revealed a band corresponding to an undigested amplicon (~780 bp). The species P. micra possess four copies of this rRNA operon (10). Finegoldia magna, the phylogenetic species most related to P. micra, also possess 4 different copies of this operon (11). The presence of digested and undigested amplicons in the same reaction suggests that P. micra strains may harbor 16S rRNA gene copies differing in region of Hae III restriction site.

16S rRNA gene polymorphism among P. micra isolates has already been reported by Riggio and Lennon (2003) (8), who had proposed a PCR-RFLP for the identification of Peptostreptococcus species. These authors reported that from 22 P. micra isolates, 7 exhibited PCR-RFLP divergent from what was expected for this species, suggesting the existence of variants of P. micra or even another possibly unidentified bacterial species, very closed related to P. micra. The present data confirmed this variability in 16S rRNA gene among isolates phenotypically identified as P. micra and suggest that this variability can be wider than previously reported (8), since 5 genotypes of P. micra could be observed.

In the present study, PCR protocol using species-specific primers pairs PM2 lower and PM2 upper was able to identify all tested P. micra isolates. In addition, polymorphism of 16S rRNA gene could be observed by PCR-RFLP using HaeIII and HinfI restriction analysis. Further studies should be done in order to confirm the copy number of rRNA operons in P. micra species and to correlate the different genotypes with phenotypic traits and virulence.

ACKNOWLEDGEMENTS

Thanks are due to Dr. T.J.M. van Steenbergen (Academic Centre for Dentistry Amsterdam, Amsterdam, The Netherlands) for providing P. micra reference strains HG 1467 and HG 1259, and to Maude Wikströn (School of Dentistry, University of Gotebörg, Gotebörg, Sweden) for providing the Finegoldia magna reference strain CCUG 12461. We also thank E.E. Oshiro for help us with the sequencing procedures.

This study was supported by FAPESP (Fundação de Amparo à Pesquisa do Estado de São Paulo); grant: 00/10112-00 and doctoral fellowship: 00/10047-4.

Submitted: September 15, 2006; Returned to authors for corrections: May 19, 2007; Approved: November 02, 2008

References

  • 1. Alam, S.; Brailsford, S.R.; Whiley, R.A.; Beighton, D. (1999). PCR-based methods for genotyping viridans group streptococci. J. Clin. Microbiol., 37, 2772-2776.
  • 2. Kremer, B.H.A.; Magee, J.T.; van Dalen, P.J.; van Steenbergen, M.T.J. (1997). Characterization of smooth and rough morphotypes of Peptostreptococcus micros.Int. J. Syst. Bacteriol., 47, 363-368.
  • 3. Moore, W.E.C.; Moore, L.H.; Ranney, R.R.; Smibert, R.M.; Burmeister, J.A.; Schenkein, H.A. (1991). The microflora of periodontal sites showing active destructive progression. J. Clin. Periodontol., 18, 729-739.
  • 4. Murdoch, D.A.; Mitchelmore, I.J. (1991). The laboratory identification of gram-positive anaerobic cocci. J. Med. Microbiol., 34, 295-308.
  • 5. Tindall, B.J.; Euzéby, J.P. (2006). Proposal of Parvimonas gen. nov. and Quatrionicoccus gen. nov. as replacement for the illegitimate, prokaryotic, generic names Micromonas Murdoch and Shah 2000 and Quadricoccus Maszenam et al 2002, respectively. Int. J. Syst. Evol. Microbiol, 56, 2711-2713.
  • 6. Rams, T.E.; Feik, D.; Listgarten, M.A.; Slots, J. (1992). Peptostreptococcus micros in human periodontits. Oral Microbiol. Immunol., 7, 1-6.
  • 7. Riggio, M.P.; Lennon, A.; Smith, A. (2001). Detection of Peptostreptococcus micros DNA in clinical samples by PCR. J. Med. Microbiol., 50, 249-254.
  • 8. Riggio, M.P.; Lennon, A. (2003). Identification of oral Peptostreptococcuss isolates by PCR-restriction fragment length polymorphysm analysis of 16S rRNA genes. J. Clin. Microbiol., 41, 4475-4479.
  • 9. Song, Y.; Liu, C.; McTeague, M.; Vu, A.; Liu, J.Y.; Finegold, S.M. (2003). Rapid identification of gram-positive anaerobic coccal species originally classified in the genus Peptostreptococcus by multiplex PCR assays using genus- and species-specific primers. Microbiology, 19, 1719-1727.
  • 10. Todo, K.; Goto, T.; Miyamoto, K.; Akimoto, S. (2002). Physical and genetic map of Finegoldia magna (formerly Peptostreptococcus magnus) ATCC 29328 genome. FEMS Microbiol. Lett., 210, 33-37.
  • 11. Todo, K.; Goto, T.; Honda, A.; Tamura, M.; Miyamoto, K.; Fujita, S.; Akimoto, S. (2004). Comparative analysis of the four rRNA operons in Finegoldia magna ATCC 29328. System. Appl. Microbiol., 27, 18-26.
  • 12. Turng, B.F.; Guthmiller, J.M.; Minah, G.E.; Falkler, W.A. Jr. (1996). Development and evaluation of selective medium for primary isolation of Peptostreptococcus micros Oral Microbiol. Immunol., 5, 356-361.
  • 13. van Dalen, P.J.; van Steenbergen, T.J.M.; Cowan, M.M.; Busscher, H.J.; Graaf, J. (1993). Description of two morphotypes of Peptostreptococcus micros Int. J. Syst. Bacteriol., 43, 787-793.
  • 14. van Winkelhoff, A.J.; Bosch-Tihojof, C.J.; Winkel, E.G.; van der Reijden, W.A. (2001) Smoking affects the subgingival microflora in periodontitis. J. Periodontol., 72, 666-671.
  • 15. Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. (1991). 16S ribossomal DNA amplification for phylogenetic study. J. Bacteriol., 173, 697-703.
  • *
    Corresponding Author. Mailing address: Av. Professor Lineu Prestes, 1374 - Edifício Biomédicas II, lab 110 CEP: 05508-900. São Paulo, SP. Brazil. Tel.: ++ 55 11 30917348; Fax: ++ 55 11 30917354. E-mail:
  • Publication Dates

    • Publication in this collection
      06 Apr 2009
    • Date of issue
      Dec 2008

    History

    • Received
      15 Sept 2006
    • Accepted
      19 May 2007
    location_on
    Sociedade Brasileira de Microbiologia USP - ICB III - Dep. de Microbiologia, Sociedade Brasileira de Microbiologia, Av. Prof. Lineu Prestes, 2415, Cidade Universitária, 05508-900 São Paulo, SP - Brasil, Ramal USP 7979, Tel. / Fax: (55 11) 3813-9647 ou 3037-7095 - São Paulo - SP - Brazil
    E-mail: bjm@sbmicrobiologia.org.br
    rss_feed Acompañe los números de esta revista en su lector de RSS
    Ir para arriba Notificar error