Abstract
The purpose of this study is to investigate the feasibility and efficiency of using a suspension of Acidithiobacillus ferrooxidans Ach 1 bacterium as a natural bio-coagulant for the treatment of model wastewater containing milk, which simulates effluent from dairy processing plants. Laboratory experiments were conducted using a model solution prepared from cow’s milk and distilled water. The bacterial suspension was introduced into the model solution at various volumetric ratios (1-40%). Lactose concentration, turbidity and elemental composition of the sludge were determined according to GOST standards and instrumental analysis. A comprehensive literature review of dairy wastewater characteristics and treatment methods was performed to contextualize the study. The degree of purification of the model solution was assessed by measuring the lactose content after treatment with the biocoagulant. In the control solution without the biocoagulant, the lactose concentration was found to be 0.46 g/mL. Introduction of the biocoagulant at 6% volume reduced the lactose content by 39.1 ± 3.0%, while at 40% volume it decreased by 92.5 ± 7.1%. The results suggest that A. ferrooxidans Ach 1 suspension can serve as an effective bio-coagulant for the pre-treatment of milk-containing industrial wastewater.
Keywords:
wastewater; biological treatment; thionic bacteria; biocoagulation; microorganisms
Resumo
O presente estudo investiga a viabilidade do uso da suspensão bacteriana de Acidithiobacillus ferrooxidans Ach1 como biocoagulante natural no tratamento de águas residuais simuladas da indústria de laticínios. Ensaios laboratoriais foram realizados utilizando uma solução modelo contendo leite. A suspensão bacteriana foi aplicada em diferentes proporções volumétricas (1-40%). A eficiência do tratamento foi avaliada com base na remoção de lactose, turbidez e composição elementar do lodo formado. Os resultados mostraram uma eficiência máxima de remoção de lactose de 92,5%, demonstrando o potencial do método proposto como alternativa sustentável aos coagulantes químicos convencionais.
Palavras-chave:
águas residuais; tratamento biológico; bactérias tiônicas; biocoagulação; microorganismos
1. Introduction
The volume of wastewater generated by industrial enterprises accounts for approximately 80-85% of the initial consumption of fresh water (Ma et al., 2025). As a result of dairy processing operations, technological wastewater is formed that is heavily contaminated with biodegradable organic substances exceeding 1000 mg/L, primarily fats, proteins, and carbohydrates. If an enterprise does not address the issue of recycling production waste, especially whey, the degree of pollution increases severalfold. The total pollution load of wastewater generated by dairy plants is estimated at about 400,000 tons per year (Chen et al., 2025).
In dairy manufacturing, wastewater is mainly composed of industrial effluents (approximately 70%) and domestic wastewater (about 30%). Wastewater is generated during milk processing operations and during the cleaning of technological equipment, pipelines, containers, and production facilities. In hard cheese production, two principal wastewater streams are formed: whey and spent brine. Consequently, highly concentrated wastewater containing insoluble protein residues, fat particles, soluble lactose, protein solutions, as well as detergents and disinfectants is produced (Al-Ani et al., 2019). Mechanical, physicochemical, and biotechnological methods are commonly applied to treat dairy wastewater. Fat removal is typically performed using vertical and horizontal grease traps, which are often installed at facilities producing high-fat products such as butter, cream, and sour cream, where wastewater fat content exceeds 100-150 mg/L. Long-term operational experience indicates that horizontal grease traps are inefficient, reducing fat content by only 30-35%. Limitations include the labor intensity required for fat and sludge collection and their large spatial footprint. Alternative approaches, such as sedimentation, flotation, and coagulation, allow for more efficient removal of fats. During sedimentation, fat particles and other suspended solids are separated, while flotation enables the elimination of finely dispersed hydrophobic impurities, including colloidal fats (Alturki, et al., 2023).
However, the above-mentioned treatment methods have several significant disadvantages, including relatively long processing times, substantial operational costs, high reagent expenses, and the potential for secondary environmental pollution. Sedimentation for the removal of poorly soluble contaminants remains one of the main treatment methods used in industry. As an alternative, biotechnological treatment methods can be effectively applied. Thus, suspensions of Acidithiobacillus ferrooxidans (Kilmer and Hinkle) can be used as coagulants for the removal of metal ions and certain organic pollutants from industrial wastewater. Compared with conventional methods, the process using A. ferrooxidans thiobacteria proceeds much faster.
In addition to physicochemical treatments, biological methods using iron-oxidizing and sulfur-oxidizing bacteria have demonstrated high efficiency. Early studies by Katzenovich (1972) employed T. ferrooxidans thionic bacteria to remove sulfides from wastewater. Similarly, Chetverikova (2009) investigated sulfur-oxidizing bacteria, including species of the genus Thiobacillus, focusing on their ability to oxidize sulfur, sulfides, and thiosulfates. The following scientists (Issayeva et al., 2022) in the process of coagulation treatment of industrial wastewater, considered the effectiveness of various coagulants. Usually this process is carried out using aluminum or iron salts. Gu et al. (2013) who conducted some research work to evaluate the effectiveness of the method, combining chemical coagulation with an oxidation process for the treatment of wastewater from milk processing production. The efficiency of eliminating the chemical oxygen needing in water was 94.2 ± 8.7% when using FeCl3 and lime during purification, and the indicator of COD was 70 ± 6.5% when using FeCl3 and polyacrylamide, as a result of the study. In addition, was studied the influence of temperature, the ratio of various parameters, exposure time and other factors on the coagulation and flocculation processes (Wang et al., 2007).
Biotechnological applications offer a sustainable alternative for the treatment of industrial effluents. For example, the culture fluid of A. ferrooxidans can act as a bio-coagulant, removing metal ions and certain organic pollutants from wastewater (Di Berardino, 2019). Under acidic conditions, A. ferrooxidans oxidizes divalent iron (Fe2+) to trivalent iron (Fe3+). Under optimal conditions, bacterial iron oxidation occurs 200,000-500,000 times faster than under chemical control, demonstrating its high efficacy for industrial wastewater treatment (Falconi et al., 2023).
The purpose of this study was to investigate the possibility of using biochemically obtained ferric iron for the treatment of a model solution.
2. Materials and Methods of Research
The strain A. ferrooxidans Ach1, isolated from polymetallic slags in the Ashysai settlement, was used in this study. These thiobacteria are typically single, occasionally paired, short rodshaped cells measuring 0.4 × (0.8-1.0) µm. They are gram-negative, non-spore-forming possess a single polar flagellum, and are capable of oxidizing fer-rous iron to ferric iron in acidic media. They reproduce by binary fission.
For the experimental investigations, a model solution containing milk with a fat mass fraction of 2.5% was used. The milk consisted of cow’s milk and skim milk. The nutritional composition per 100 g of product was as follows: fat – 2.5%, proteins – 3.0 g, carbohydrates – 4.5 g. The volumetric proportion of milk in the model solution was 1.0%. A total of 10 solutions were prepared, each consisting of 1 mL of milk and 99 mL of distilled water, including one control solution.
Isolation and cultivation of thiobacteria were carried out by the limit dilution method in accordance with GOST 26670-91 (Russia, 1991). The strains of thiobacteria Acidithiobacillus ferrooxidans Ach1 were grown on Silverman-Lundgren 9K nutrient medium with the following composition (g/L): (NH4)2SO4 – 2.0; K2HPO4 – 1.0; MgSO4 – 0.5; NaCl – 0.2; FeSO4·7H2O – 44.2; H2O – 1 L; the pH was adjusted to 1.0 with H2SO4. The suspension of the strains was inoculated into the nutrient medium at a medium-to-suspension ratio of 5:1. Cultivation was performed at (25-32) °C with continuous aeration. The bacteria required for the study were inoculated onto selective nutrient medium using a TC-1/80 SPU TU 9452-002-00141798-97 model thermostat (Smolensk SKTB SPU, Russia). In studies on the use of A. ferrooxidans bacteria for purifying a model solution, the Fe2+ and Fe3+ content was determined using a complexometric method. «Tauda» and «Mikmed-5» microscopes were used for microscopic studies.
The efficiency of model solution purification with the use of a biocoagulant was evaluated based on the determination of lactose concentration in the milk sample. The study was conducted according to GOST 54667-2011 “Methods for the determination of the mass fraction of sugars” (Russia, 2011) using an ADS220 polarimeter. pH measurements were performed with a WTW Multiparameter 340i instrument (Wissenschaft-lich-Technische Werkstätten GmbH, Germany). Determination of the transparency and purification degree of the model solution containing a dairy product using a bio-coagulant was carried out with a JENWAY 6305 spectrophotometer (Bib-by Scientific Ltd, UK). The total number of samples was 10, including 1 control solution. The milk concentration in the solution was 1% vol. The study was conducted in the Republic of Poland at Adam Mickiewicz University in Poznań. A detailed study of the sample’s surface structure and elemental distribution was carried out with a high-resolution scanning electron microscope (JSM-6400LV, Japan) coupled with energy-dispersive spectroscopy (EDS).
All experiments were performed in triplicate, and standard deviations were calculated within the confidence interval of 0.85 < P < 0.91. The arithmetic mean values were determined according to the method proposed by Volkova and Shipunov (2012) taking into account the number of measurements and the general diagnostic group.
3. Results of the Studies and Their Discussion
In biochemical treatment methods, are usually employed heterotrophic and autotrophic microorganisms (Kurniawan et al., 2025). It has been demonstrated that the culture liquid of A. ferrooxidans can serve as an effective coagulant for the treatment of industrial effluents containing metal ions and organic pollutants (Issayeva et al., 2023).
Since A. ferrooxidans utilizes Fe2+ as an energy source, the concentration of Fe2+ in the medium may influence the growth of the bacteria (Syzdykova et al., 2022). During the oxidation of divalent iron to trivalent iron, the bacteria obtain the energy necessary for their metabolism. The trivalent iron produced during oxidation can be used as a biocoagulant for wastewater treatment (Yahya et al., 2008).
The degree of ferrous iron oxidation by the A. ferrooxidans Ach1 strain was analyzed using a CARY50 UV/Visible scanning spectrophotometer, which revealed a decrease in the concentration of ferrous iron in the samples. The biochemical oxidation of iron was carried out at +30 °C, under continuous aeration, and at pH 2 ± 0.5. The initial concentration of ferrous iron in the samples was 44.2 g/L. According to the obtained results, as a consequence of the vital activity of A. ferrooxidans Ach1 bacteria, the average concentration of ferrous iron decreased to 0.2 ± 0.1 mg/L due to biochemical oxidation.
Laboratory studies demonstrated that ferric iron or aluminum, commonly used in industry for the coagulation treatment of wastewater, can be replaced with an A. ferrooxidans Ach 1 bacterial suspension containing Fe2(SO4)3. These microorganisms occupy a special position among thiobacteria because, in addition to their ability to grow autotrophically by oxidizing sulfur compounds, they can also utilize the energy of iron oxidation. In this case, the oxidized iron does not form any structural deposits within the cells (Rahimi et al., 2025).
Model solutions were treated with a biocoagulant in amounts equivalent to 1.0-40.0% of the total solution volume. The treatment resulted in noticeable decreases in lactose content and turbidity levels, as illustrated in Figure 1.
The study showed that the lactose content in the control solution without the bio-coagulant was 0.46 g/mL. Introduction of the biocoagulant at 6% of the volume reduced the lactose content by 39.1 ± 3.0%, whereas at 40% of the volume it decreased by 92.5 ± 7.1%. Correspondingly, the water clarity increased from 45.5 ± 4.2% to 80.0 ± 3.5% in the experimental samples.
The result obtained indicate that when A. ferrooxidans Ach 1 is used as a biocoagulant for treating milk-containing model solutions, the highest efficiency is achieved at a bacterial suspension volume of 40.0%. Under these conditions, the degree of lactose removal reaches 92.5%, and the water clarity is 80%. The biocoagulation process was completed within 6 min. The obtained results confirm the feasibility of employing an A. ferrooxidans Ach 1 bacterial suspension as a biocoagulant for treating wastewater from dairy production.
An extended examination of the elemental composition of the sludge that was generated as a result of introducing the biocoagulant into the model solution was conducted in order to better understand the nature of the formed precipitate and its role in the purification process (Zulqurnain et al., 2024). This analysis made it possible to determine not only the presence but also the relative proportion of individual elements that contribute to the coagulation and subsequent sedimentation processes (Tundisi et al., 2020).
The elemental characterization of the sample was performed using a high-precision microelement microscope, which allowed for detailed identification of both major and trace components present in the sludge structure. Such an approach provided valuable information on the efficiency of the biocoagulant in binding pollutants and transforming dissolved substances into an insoluble form. The obtained spectral results, which illustrate the elemental distribution within the sample, are summarized and visually represented in Figure 2, offering a clear demonstration of the sludge composition after the treatment process.
Microscopic examination confirmed that the obtained strain belongs to the group of thiobacteria. Cells of the genus Acidithiobacillus are Gram-negative, rod-shaped, measuring 0.3-0.4 × 0.7-1.7 μm, and motile by means of polar flagella (Figure 3). They are non-spore-forming and aerobic. The optimal growth temperature ranges from +30 to +35 °C. Cell division occurs by transverse binary fission. During oxidation processes, ferrous iron (Fe2+) is converted to ferric iron (Fe3+). The strain is capable of oxidizing elemental sulfur, its compounds, and heavy metal sulfides. Cultivation was carried out on 9K nutrient medium for 4 days.
The G+C content in the DNA ranges from 48 to 68 mol%. The bacterial titer reached 107-108 cells/mL. The growth of thiobacteria was visually observed by changes in the color of the liquid medium. Initially, the nutrient medium was transparent, but as ferric iron formed, it turned reddish-brown. In the liquid medium containing sulfur, uniform turbidity was observed, and the acidity level of the medium increased to pH 4.0-4.5 (Figure 4).
PCR analysis confirmed that the obtained strains belong to the species A. ferrooxidans. The nucleotide sequence was as follows:
AGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAGCGGCAGCGACATAATAGAAGCTTCGGTGGAAATTATGGGCGGCGAGCGGCGGACGGGTGAGTAATGCCTGGGAATATGCCCTGATGTGGGGGATAACTATTGGAAACGATAGCTAATACCGCATAATCTCTTCGGAGCAAAGAGGGGGACCTTCGGGCCTCTCGCGTCAGGATTAGCCCAGGTGGGATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCAGTGAGGAAGGGGTGTACGTTAATAGCGTGCATCTTTGACGTTAGCTGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGCGGTCTGTTAAGCAAGATGTGAAAGCCCGGAGCTTAACCTCGGAACAGCATTTTGAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTTCAGGTGTAGCGGTGAAATGCGTAGAGATCTGAAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGATGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCTACTTGGAGGTTG
According to the PCR sequencing results, the strain showed a 99.1% homology with Thiobacillus ferrooxidans strain A1 (GenBank accession number NR_115487:59-778).
4. Conclusion
According to the analysis results, the high content of carbon and oxygen in the sample indicates the predominance of organic substances or carbon-based compounds originating from the biocoagulant. The elevated iron content reflects the presence of iron oxides or other iron compounds in the sludge formed during treatment. These compositional data are crucial for evaluating not only the effectiveness of the proposed biocoagulant but also the nature of the resulting sludge and its potential for safe disposal or further utilization.
The experimental findings showed that, during the biocoagulation treatment of the milk-containing model solution, the degree of lactose removal reached 92.5 ± 7.1%, and water clarity increased up to 80.0 ± 3.5% within only six minutes of treatment. Such high efficiency achieved in a relatively short contact time demonstrates the potential of A. ferrooxidans Ach 1 suspension as a rapid and environmentally friendly alternative to conventional chemical coagulants.
Compared with ferric iron or aluminum salts commonly applied in industrial wastewater treatment, the use of a bacterial suspension containing Fe2(SO4)3 provides a dual mechanism of action biological and chemical which can reduce the required doses of synthetic chemicals and lower sludge toxicity. This approach may therefore contribute to improving the sustainability of dairy wastewater treatment processes, minimizing secondary pollution and operational costs. Overall, the results of this study demonstrate that A. ferrooxidans Ach 1 suspension is a promising bio-coagulant for the pre-treatment of milk-containing industrial wastewater, offering a sustainable alternative to traditional chemical coagulants.
Acknowledgments
This study was funded by the Ministry of Science and Higher Education of the Republic of Kazakhstan, under the grant nº AP22685211 “Technology of biological purification of organic wastewater using chemotrophic microorganisms”.
Data Availability Statement
The data used to support the findings of this study are available from the corresponding author upon reasonable request.
References
-
AL-ANI, R.R., AL OBAIDY, A.M.J. and HASSAN, F.M., 2019 [viewed 28 January 2026]. Multivariate analysis for evaluation of the water quality of Tigris River within Baghdad City in Iraq. Iraqi Journal of Agricultural Sciences [online], vol. 50, pp. 332-341. Available from: https://jcoagri.uobaghdad.edu.iq/index.php/intro/article/view/299
» https://jcoagri.uobaghdad.edu.iq/index.php/intro/article/view/299 -
ALTURKI, S.F., SWADI, S.H.A., AL-RUBAYE, A.H., SUWAED, M.S. and AL-MASHHADANI, S.A., 2023. Design of the mechanical-chemical reactor for oily wastewater treatment. Results in Engineering, vol. 20, pp. 101494. https://doi.org/10.1016/j.rineng.2023.101494
» https://doi.org/10.1016/j.rineng.2023.101494 -
CHEN, S., WANG, J., FENG, X. and ZHAO, F., 2025. Algal-bacterial symbiotic granular sludge technology in wastewater treatment: a review on advances and future prospects. Water, vol. 17, no. 11, pp. 1647. https://doi.org/10.3390/w17111647
» https://doi.org/10.3390/w17111647 - CHETVERIKOVA, D.V., 2009. Bioleaching of non-ferrous metals from technogenic mineral formations using cultures of Acidithiobacillus ferrooxidans and Ferroplasma sp. Saint Petersburg: Saint Petersburg State Marine Technical University, 23 p.
-
DI BERARDINO, S.E., 2019. Production of biogas/bioSNG from anaerobic pretreatment of milk-processing wastewater. In: M. MATERAZZI and P.U. FOSCOLO, eds. Substitute natural gas from waste. London: Academic Press, pp. 397-424. https://doi.org/10.1016/B978-0-12-815554-7.00015-5
» https://doi.org/10.1016/B978-0-12-815554-7.00015-5 -
FALCONI, I.B.A., BOTELHO, A.B., BALTAZAR, M.D.P.G., ESPINOSA, D.C.R. and TENÓRIO, J.A.S., 2023. An overview of treatment techniques to remove ore flotation reagents from mining wastewater. Journal of Environmental Chemical Engineering, vol. 11, no. 6, pp. 111270. https://doi.org/10.1016/j.jece.2023.111270
» https://doi.org/10.1016/j.jece.2023.111270 -
GU, L., WANG, Y., ZHU, N., ZHANG, D., HUANG, S., YUAN, H., LOU, Z. and WANG, M., 2013. Preparation of sewage sludge based activated carbon by using Fenton’s reagent and their use in 2-naphthol adsorption. Bioresource Technology, vol. 146, pp. 779-784. https://doi.org/10.1016/j.biortech.2013.07.147 PMid:23985565.
» https://doi.org/10.1016/j.biortech.2013.07.147 -
ISSAYEVA, A.U., ABUBAKIROVA, A., SYZDYKOVA, M.N., ARYSTANOVA, S.D. and ANLAMASOVA, G.A., 2022. Fe2(SO4)3 and bentonite use to reduce COD indicators in wastewater containing detergents. Journal of Ecological Engineering, vol. 23, no. 3, pp. 68-73. https://doi.org/10.12911/22998993/145468
» https://doi.org/10.12911/22998993/145468 -
ISSAYEVA, A.U., SYZDYKOVA, M., AKHMET, A., BAKHOV, Z., OSPANOVA, Z., CHINGISBAYEV, B., KAMALOVA, M. and KARIMOVA, S., 2023. Use of Acidithiobacillus ferrooxidans for decontamination of explosive waste from oil refineries. Journal of Ecological Engineering, vol. 24, no. 7, pp. 19-24. https://doi.org/10.12911/22998993/163250
» https://doi.org/10.12911/22998993/163250 - KATZENOVICH, E.P., 1972. Biochemical fundamentals of using thionic bacteria in wastewater treatment processes containing hydrogen sulfide and sulfides. Microbiology, vol. 41, no. 3, pp. 437-443.
-
KURNIAWAN, S.B., ČÍŽKOVÁ, M., AHMAD, A., WIBOWO, Y.G., SAID, N.S.M., JUSOH, H.H.W., ISMAIL, A. and IMRON, M.F., 2025. Autotrophic vs. heterotrophic microalgae: juxtaposition of performances in treating organic-rich effluent. Desalination and Water Treatment, vol. 322, pp. 101159. https://doi.org/10.1016/j.dwt.2025.101159
» https://doi.org/10.1016/j.dwt.2025.101159 -
MA, X., CHEN, J.-Y., XU, J.-W., WU, X.-J., CHI, H.-D. and WEI, Y.-D., 2025. Study on influence factors and mechanism of floc-bubble interaction in the flotation treatment of drilling wastewater. Separation and Purification Technology, vol. 377, no. 1, pp. 134300. https://doi.org/10.1016/j.seppur.2025.134300
» https://doi.org/10.1016/j.seppur.2025.134300 -
RAHIMI, Z., ZINATIZADEH, A.A., ZINADINI, S., YOUNESI, H., VAN LOOSDRECHT, M. and AZIZI, S., 2025. Removal of organic matters and dyes from aqueous solutions and effluent of a hybrid airlift A2O bioreactor treating milk processing wastewater using chemically derived bituminous-based activated carbons. Journal of Water Process Engineering, vol. 70, pp. 107015. https://doi.org/10.1016/j.jwpe.2025.107015
» https://doi.org/10.1016/j.jwpe.2025.107015 - RUSSIA, 1991. GOST 26670-91: food products: microorganism cultivation methods. Moscow.
- RUSSIA, 2011. GOST 54667-2011: milk and milk products: methods for determination of sugars mass fraction. Moscow.
- SYZDYKOVA, M.N., ISSAYEVA, A.U., KIDIRBAYEVA, K.K., ABSATTAR, G.A. and BEATA, M., 2022. The possibility of using bacterial suspension Acidithiobacillus ferrooxidans Ach1 as a biocoagulant for wastewater treatment of milk processing enterprises. Industrial Technology and Engineering, vol. 1, no. 42, pp. 46-50.
-
TUNDISI, J.G., GARCIA, J.A., MATSUMURA-TUNDISI, T., TUNDISI, J.E.M., PATRIZZI, L.J. and GHIGLIENO, F., 2020. Monitoring wastewater for assessing community health in cities: perspectives and a proposal. Brazilian Journal of Biology, vol. 80, no. 4, pp. 946-947. https://doi.org/10.1590/1519-6984.242529 PMid:33027342.
» https://doi.org/10.1590/1519-6984.242529 - VOLKOVA, P.A. and SHIPUNOV, A.B., 2012. Statistical processing of data in educational research works. Moscow: Forum, 96 p.
-
WANG, J., CHEN, Y., GE, X.W. and YU, H.Q., 2007. Optimization of coagulation-flocculation process for a paper-recycling wastewater treatment using response surface methodology. Colloids and Surfaces. A, Physicochemical and Engineering Aspects, vol. 302, no. 1-3, pp. 204-210. https://doi.org/10.1016/j.colsurfa.2007.02.023
» https://doi.org/10.1016/j.colsurfa.2007.02.023 -
YAHYA, A., HALLBERG, K.B. and JOHNSON, D.B., 2008. Iron and carbon metabolism by a mineral-oxidizing Alicyclobacillus-like bacterium. Archives of Microbiology, vol. 189, no. 4, pp. 305-312. https://doi.org/10.1007/s00203-007-0319-5 PMid:18004545.
» https://doi.org/10.1007/s00203-007-0319-5 -
ZULQURNAIN, S.S., SULTANA, S., SULTANA, T. and MAHBOOB, S., 2024. Fatty acid profile variations after exposure to textile industry effluents in Indian Major Carps. Brazilian Journal of Biology, vol. 84, pp. e254252. https://doi.org/10.1590/1519-6984.254252 PMid:35019104.
» https://doi.org/10.1590/1519-6984.254252
Edited by
-
Editor:
Takako Matsumura Tundisi








