Abstract
Tropical biomes such as Brazilian Cerrado and Amazon Forest have a great diversity of fungi and insects. Interactions between these organisms can be beneficial to both partners. In streams, these interactions contribute to litter decomposition. Studying the digestive tract (DT) of shredder insects as a habitat for fungal microorganisms is an opportunity to obtain fungal strains with biotechnological potential, which may help to understand the symbiotic relationships between these organisms in tropical forests. This study investigated the fungal community in the DT of larvae of Triplectides (Trichoptera: Leptoceridae) collected in low-order streams in the Cerrado and Amazon Forest biomes in Brazil. Forty-nine fungal isolates were obtained and identified among 32 species and 12 genera. The genus Roussoella was only found in the DT of insects in Amazon Forest streams, while 7 genera only occurred in the DT of insects in Cerrado streams. The genus Penicillium (40%) was the most frequent. In the Cerrado, 78% were producers of CMCase, more than two-fold that in the Amazon Forest (35%). And 62% were producers of xylanase, in the Cerrado and 71% in the Amazon Forest. In this context, the fungal community in the DT of Triplectides larvae may play an important role in the insect diet by breaking down lignocellulosic material.
Keywords:
Triplectides; Trichoptera; xylanase; cellulase
Resumo
Biomas tropicais como o Cerrado brasileiro e a Floresta Amazônica apresentam uma grande diversidade de fungos e insetos. As interações entre esses organismos podem ser benéficas para ambos os parceiros. Em riachos, essas interações contribuem para a decomposição da serapilheira. O estudo do trato digestório (TD) de insetos como um habitat para microrganismos fúngicos é uma oportunidade para obtenção de linhagens fúngicas com potencial biotecnológico, podendo trazer luz para o entendimento das relações simbióticas entre esses organismos em florestas tropicais. Esse estudo investigou a comunidade fúngica do TD de larvas de Triplectides (Trichoptera: Leptoceridae) coletados em riachos de baixa ordem nos biomas Cerrado e Floresta Amazônica no Brasil. Foram obtidos 49 isolados fúngicos e identificados entre 32 espécies de 12 gêneros. O gênero Roussoella foi encontrado apenas no DT de insetos em riachos da Floresta Amazônica, enquanto sete gêneros ocorreram apenas no DT de insetos em riachos do Cerrado. O gênero Penicillium (40%) foi o mais frequente. No Cerrado, 78% foram produtoras de CMCase, mais que o dobro da Floresta Amazônica (35%). E 62% foram produtoras de xilanase, no Cerrado, e 71% na Floresta Amazônica. Nesse contexto, a comunidade fúngica do TD de larvas Triplectides pode desempenhar um papel importante na dieta de insetos por quebrar o material lignocelulósico.
Palavras-chave:
Triplectides; Trichoptera; xilanase; celulase
1. Introduction
Brazilian Cerrado and Amazon Forest biomes are considered biodiversity hotspots. This high biodiversity, especially in neotropical regions, represents a great potential for organisms to be discovered (Almeida et al., 2017), as well as their specificities. Thus, these tropical forests hold a large part of the diversity of insects and fungi that coexist in several terrestrial and aquatic habitats, where potential interactions may occur between species of the two groups (Boucias et al., 2012; Douglas, 2015). Insects are colonized by microorganisms, in their body surface, in their digestive tract (DT) and interior of certain tissues. Bacteria and fungi prevail in insect microbiomes and they are essential for survival, maturation and nutritional functions of hosts among honey bees (Kwong and Moran, 2016; Raymann and Moran, 2018) and also in some species of moths (Chen et al., 2016).
The roles of the symbionts in relations between fungi and insects were found to be nutritional, for protection, or even for hormonal maturation of the insect (Mohammed et al., 2018), whereas the microorganisms receive protection and abundant food in the body of the insect. Fungi contribute nutrients to several insect groups (Gibson and Hunter, 2010), as with bark beetles (Six, 2012) and the carmine cochineal that fungi help in the nitrogen recycling process (León et al., 2016).
Fungi have been often found in the DT of several insects that feed on wood or detritus and, possibly, play a role in the digestion of such plant material (Engel and Moran, 2013; León et al., 2016; Santos et al., 2018; Belmont-Montefusco et al., 2020a, Belmont-Montefusco et al., 2020b). Shredder insects feed on senescent plant material in low-order streams (Graça et al., 2001; Jabiol and Chauvet, 2012) where they contribute to the breakdown of organic matter in aquatic ecosystems together with fungal groups such as Ascomycetes and Hyphomycetes (Graça et al., 2016). Insect species of the genus Triplectides (Trichoptera: Leptoceridae) are shredders during their aquatic larval stage, consuming substrates such as leaves and dead wood (Oliveira and Pes, 2014; Cortez and Gonçalves, 2015). Microbial colonization of those substrates improve palatability and increase nitrogen content of food (Graça et al., 2001). The genus is highly diverse in tropical streams where a variety of substrates are available for fungal colonization that may be ingested by these insects along with food. The hypothesis arises that there is a diversity of fungi associated with the DT of larvae of insects of the genus Triplectides in low-order streams in the Brazilian Cerrado and Amazon Forest.
The fungal composition and diversity in the DT of insects may clarify the role of fungi in the physiology of the host (Gao et al., 2018) and shed light onto the ecological role of symbiosis between the two groups and biotechnological potential of those fungal communities. Thus, this study aimed to verify whether there is a possible specificity of occurrence of fungi in the DT of those insects and to test the potential for the production of xylanases and cellulases, which also shows the potential nutritional role, in food digestion in the DT of the insect.
2. Material and Methods
2.1. Characterization of the study areas
The study was carried out in five streams located in a conservation area and its surroundings in the north part of the Brazilian Cerrado (Tocantins, Brazil) and in four streams in an Amazon Forest (Pará, Brazil) biomes (Figure 1). A 200 m stretch of the body of the stream was sampled using a D-frame net (0.500 mm mesh and 0.465 m2 area) in each stream selected. Larvae of Triplectides (Trichoptera: Leptoceridae) were collected in the substrate available (especially leaf packages) and identified by specialists based on the taxonomic descriptions by Hamada et al. (2014). Each individual larva was transferred to a sterile tube containing 1 mL sterile saline solution and stored for 2 to 4 h in ice until processing in the laboratory.
Maps with sampling sites of Triplectides (Trichoptera: Leptoceridae) in low-order streams in the Cerrado (Lajeado State Park and surroundings, state of Tocantins, Brazil) and low-order streams in the Amazon Forest (Tapajós National Forest, state of Pará, Brazil) biomes.
2.2. Fungal isolation and purification
In the laboratory, the individual larvae were aseptically dissected using a stereoscopic microscope. The intestinal tract was added to 1.0 mL sterile saline solution in an Eppendorf tube. Next, a 0.1 mL aliquot was seeded on a Petri dish containing potato-dextrose agar (PDA) supplemented with 100 μg mL-1 chloramphenicol in triplicates. The dishes were incubated at 28 °C for up to 60 days. The fungal isolates obtained were individually transferred to Petri dishes containing PDA and incubated at 25 °C for seven days for purification. Fungal strains were kept in storage according to adaptations of Castellani (1939).
2.3. DNA extraction, amplification and sequencing
The fungal isolates were transferred from storage to dishes containing PDA for 24-28 h and then transferred to 3% ME (Malt Extract) broth for cellular increase for seven days of growth in a rotating shaker (100 rpm) at room temperature. Next, approximately 40 mg of mycelium were collected for DNA extraction with the Wizard™ Genomic DNA Purification Kit (Promega, USA), following the modified protocol by Burghoorn et al. (2002). After extraction, the DNA was analyzed in a NanoDrop 2000 (Thermo Scientific, Brazil) spectrophotometer. Primers ITS1 (5’-TCCGTAGGTGAACCTGCGG-3’) and ITS4 (5’ TCCTCCGCTTATTGATATGC 3’) (White et al., 1990) were employed for amplification of the ITS (Internal Transcribed Spacer) region of rDNA (~600 bp) following the amplification conditions proposed by Santos et al. (2016). The amplified ITS fragments were submitted to electrophoresis in 1.0% agarose gel containing GelRed™ (Biotium Inc., USA) and visualized under ultraviolet light in a photo documentation system (Loccus Biotechnology, Brazil). The 1 kb DNA Ladder (Promega, USA) was used as a molecular weight marker.
The amplified products were sequenced in both directions using the same PCR starters in an ABI 3500 XL (Life Technologies, USA) automated sequencer according to the Sanger or chain termination method (Sanger et al., 1977) using a BigDye Terminator v3.1 sequencing kit (Life Technologies, USA). Sequencing was performed by the company Myleus Biotechnology, located in Belo Horizonte – MG, Brazil. Additionally, the amplification of the genes β-tubulin (Bt2a and Bt2b) was used for fungus taxa with low intraspecies variation according to the protocols established by Godinho et al. (2013). All sequences were compared with sequences deposited at the GenBank database using a local alignment algorithm for nucleotide sequences BLAST (Basic Local Alignment Search) (Altschul et al., 1990) and at the CBS (Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre) database (http://www.cbs.knaw.nl).
2.4. Xylanolytic and cellulolytic screening of the fungal community
The fungal community in the DT of Triplectides was tested for the production of xylanase and cellulase through screening in solid medium containing xylan or carboxymethylcellulose (CMC) as the only carbon source. The production of the enzyme was assessed via the growth of the strain on a dish and the revelation of hydrolysis halo using Congo red stain (Zhang et al., 2006). The strains were reactivated in PDA and then repeated in triplicate to a medium with xylan (Xylan, Beechwood purified) or carboxymethylcellulose (CMC) and trace elements composed of (C6H8O7 • H2O 50; ZnSO4 • 7H2O50; Fe (NH4) 2 (SO4) 2 • 6H2O 10; CuSO4 • 5H2O 2.5; MnSO4 • H2O 0.05; H3BO3 0.05; Na2MoO42H2O 0.05; Salt solution: Na3C6H5O7 • 5H2O 150; KH2PO4 250; NH4NO3 100; MgSO4 • 7H2O 10; CaCl2 • 2H2O 5) and biotin (0.1 mg ml-1) 5 mL; 0.2 mL chloroform (Vogel, 1956).
Next, staining was conducted with Congo red (0.25%) for 30 min and washing was performed with NaCl (1 M) for 15 min. The fungi that exhibited lighter color halos around the colony in the selective medium were considered producers of xylanase or cellulase. A digital caliper was used to measure the diameter of the colonies and the halos. The enzymatic index (EI) was determined by dividing the diameter of the halo by the diameter of the colony (Nogueira and Cavalcanti, 1996).
2.5. Statistical analysis
Diversity was measured via the indices of Simpson (1-D), Shannon (H '), Margalef, and Chao-1, which were calculated for the number of sampled larvae from streams in the Cerrado and Amazon Forest. The larvae were considered the sampling unit, being the biomes, and not the streams, the variable of interest. The indices were calculated with 95% confidence using the software PAST version 4.01 (Hammer et al., 2001).
3. Results
A total of 49 fungal isolates were obtained from 21 larvae of Triplectides (Trichoptera: Leptoceride) and identified among 32 species of 12 genera, besides two taxa with inconclusive taxonomy (Table 1). The average fungal isolates per DT was 2.14 CFU/DT in the Cerrado biome streams and 1.72 CFU/DT in the Amazon Forest streams. In the Cerrado, 32 strains were obtained belonging to 23 species of 11 genera, whereas in the Amazon Forest, 17 strains of 11 species of five genera were obtained. The genus Roussoella was only found in the DT of insects in Amazon Forest streams, while seven genera only occurred in the DT of insects in Cerrado streams. The genus Penicillium was the most frequent and occurred both in the Cerrado and in the Amazon Forest, with 20 strains (40%) isolated in different DTs. The genera Cladosporium (8%), Talaromyces (8%), and Trichoderma (8%) exhibited similar frequency of occurrence. The genera Aspergillus and Clonostachys, with one occurrence each, were isolated only in the Cerrado biome.
Identification of fungi from the DT of Triplectides (Trichoptera: Leptoceridae) larvae in Cerrado and Amazon Forest Biomes Brazil and their respective enzymatic indices (EI).
Among the species, Penicillium caseifulvum, Penicillium paxilli, and Neopestaloptiopsis formicarum occurred in the DT of larvae from streams in the Cerrado and Amazon Forest. All other species occurred in only one of the biomes, i.e., 20 species occurred exclusively in the Cerrado and eight, in the Amazon Forest. The most frequent species were P. paxilli in the Cerrado, with four strains, and T. palmae in the Amazon Forest, with three strains. Twenty-two species, including four species of the genus Cladosporium, seven species of Penicillium, three species of Trichoderma and Diaporthe, in addition to Aspergillus stellatus, Myxospora musae, Paraphaeosphaeria arecacearum, Clonostachys rosea, and Roussoella mexicana occurred as singletons.
The Chao-1 index showed that, in both biomes, the ideal sampling number was not reached. Due to the overvaluation of species considered singletons in the calculation of richness, the Cerrado biome (54 fungal species) showed a greater estimate of richness than the Amazon Forest (15 fungal species). The Margalef richness index was also higher in the Cerrado, as were the Simpson and Shannon diversity indices (Table 2).
Number of insects sampled (n) and richness and diversity of filamentous fungi in the DT of Triplectides (Trichoptera: Leptoceridae) in Cerrado and Amazon Forest Biomes, Brazil.
Differences in the physicochemical parameters of the water in the nine streams sampled were detected between the Cerrado and the Amazon Forest (Table 3). The mean altitude of Cerrado streams was above 400 m, while those in the Amazon Forest had a mean altitude of 99 m as they were in the Amazon plain. The mean temperature of the streams in the Cerrado was lower than in the Amazon Forest by about 2 °C. The waters in the Amazon Forest streams were acidic and had higher electric conductivity and turbidity.
A total of 62% (Figure 2A) of the fungal community in the Cerrado exhibited enzyme activity for xylanase and strains Cladosporium kenpeggii MT521711.1 and Cladosporium subuliforme MT521712.1 showed the highest values of enzymatic indices (EI) (Table 1). Seventy-eight percent strains exhibited cellulolytic activity and the highest EI values were shown by Cladosporium subuliforme MT521712.1 and Penicillium mallochii MN737739.1 (Table 1). In the Amazon Forest (Figure 2B), 71% of strains exhibited xylanolytic activity and 35% exhibited positive activity for cellulase. The highest EI values were shown by strains Penicillium maximae MN737732.1 to xylanase and Penicillium paxilli MN737731.1 to cellulase (Table 1).
Percentage of fungal isolates from the DT of Triplectides (Trichoptera: Leptoceridae) in Cerrado (A) and Amazon Forest (B) biomes producers and non-producers of xylanase (Xyl) and cellulase (CMCase).
4. Discussion
The DTs of Triplectides larvae found in streams in the Amazon Forest and Cerrado host a diversified community of fungi, as the diversity indices show (Table 2). Triplectides sp. larvae are usually found in patches of leaves located on the bed of streams and pools of water and are classified as a trophic group of leaf shredders (Kiffer et al., 2016). Therefore, it is expected that, when feeding on leaves, those larvae ingest a variety of microorganisms, including fungi colonizing such substrates, which may make up their mycobiome (Mohammed et al., 2018). That phenomenon is known as conditioning of the plant material and may occur by fungal colonization of the leaf litter in the environment. Those fungi may originate from the plant itself and from soil and water after the abscission of leaves. Seasonality affects the fall of leaf litter in tropical biomes (Atlantic Forest, Amazon Forest, and Cerrado), an effect that possibly impacts the quality and amount of substrates (Tonin et al., 2017). This might reflect on the distribution of shredder species in their microhabitat and also in the choice of the food (Abos et al., 2006). Since the present study did not select the type of leaf where the insect was collected (age, senescence, stage of decomposition, etc.), it is possible that the larvae had fed on leaves of different types that probably contain different microbial communities, thus forming a diverse microbiome.
Another possible origin of the high diversity of fungal groups in DT of larvae is the differences in diets of species and life cycles of the insects. There is strong evidence that substrates determine the intestinal microbiota of larvae and thus the diversity of the intestinal microbiota is fully related to the diet and life cycles of each insect species (Arias-Cordero et al., 2012; Mohammed et al., 2018; Alves Júnior et al., 2019). Recent studies show that the microbiomes differ in the stages of larval development (Chen et al., 2016; Gao et al., 2018; Yao et al., 2019), with higher diversity in the initial phase and greater richness in the adult phase (Gao et al., 2018). Since the larvae collected in this work were possibly at distinct larval stages, a diversified microbiome was expected. Also the physiology and physicochemical characteristics of the DTs of insects may vary between species and, thus, different larvae may host distinct microbial communities (Ceja-Navarro et al., 2014; Mason et al., 2017). In the field, it is not possible to distinguish larvae of different Triplectides species, specially in the two biomes where there are few thorough taxonomic studies of aquatic insects, and the distinction of species is accomplished by examination of adult stages (Pes et al., 2005).
The fungal community was composed mostly of singletons, i.e., with a low frequency of occurrence of a large number of species. One of the possible explanations for this fact is related to the diversity of substrates on which the larvae were collected. That is supported by the literature, the high frequency of singletons may be related to the high diversity of fungi associated with plant substrates (Martins et al., 2017; Malta et al., 2019; Ferreira et al., 2019). It also reinforces evidence that the diets of larvae of the same taxon of Trichoptera may vary due to the differences in riparian vegetation in their aquatic habitats.
A high number of filamentous fungi morphospecies per DT (6.2 ± 6.4) of larvae of Phylloicus was counted in streams of the Amazon Forest (Santos et al., 2018). In the present study, the mean number of taxa per DT was 2.33, much lower than the value reported by Santos et al. (2018). That is likely due to the high diversity of the insect genus Phylloicus that presents 25 spp described for Brazil (Santos et al., 2019). This study, in turn, investigated the mycobiome of Triplectides, which has about 14 species described in Brazil (Pes et al., 2014). It is highly probable that the set of Triplectides larvae collected belonged to a narrower group of species. Studies (Clair, 1994; Pimentel et al., 2020) report both Phylloicus and Triplectides as little selective and the availability of food items is the greatest influence on their diet. Phylloicus are detritivores, being shredders only for breaking down leaves for shelter construction (Pimentel et al., 2020), another explanation for the higher diversity of fungi in DT of this genus as compared to Triplectides.
The present results indicated common taxa in both biomes, as is the case of the genus Penicillium, which was the most frequent in this research (40%) and occurred both in the Cerrado and in the Amazon Forest. The genus Penicillium was also found in the DT of larvae of Phylloicus in the same sites of Cerrado and Amazon Forest biomes (Santos et al., 2018) as also in larvae of Triplectides, Phylloicus and Stenochironomus aquatic insects in streams sampled in another site of the Amazon Forest in the State of Amazonas, Brazil, together with Aspergillus and Trichoderma (Belmont-Montefusco et al., 2020a; Belmont-Montefusco et al., 2020b). In addition, the species Paraphaeosphaeria arecacearum, found in the DT of Triplectides in Cerrado, was also isolated in the DT of Phylloicus in the same Cerrado sites by Santos et al. (2018). Thus, despite the differences among the environmental factors of each biome and even among the larval species studied, such species may have a mycobiome in common, formed by fungi ubiquitous in the environment, which reinforces the possibility that those fungi are important to the insects.
Many of the fungal taxa found in the DT of Triplectides are of broad occurrence in aquatic and terrestrial environments (Gutiérrez et al., 2015; Song et al., 2018). The genus Penicillium is found widely in nature in soil and plants, in the air, and in decaying vegetation (Godinho et al., 2015; Mohammadian et al., 2017). The genus Cladosporium is very diverse, common, and widespread, including endophytic, pathogenic, phytopathogenic, and saprophytic species (Bensaci et al., 2015).
The most frequent species were Penicillium paxilli in the Cerrado and Talaromyces palmae in the Amazon Forest. The species T. palmae belongs to an endophytic group (Sette et al., 2006), which includes P. paxilli that was first isolated from leaves (Rukachaisirikul et al., 2007). Based on those findings and considering the diet of insect larvae is based on leaves, it can be suggested that some of the fungi in the insects diet may be of endophytic or epiphytic origin. Endophytic fungi are a very diversified group present in most plants (Marques et al., 2018; Ramírez-Camejo, 2024) and, according to Peay et al. (2016), the diversity of endophytic fungi associated with leaves is higher in tropical forests when compared with larger spatial scales. And some endophytic fungi may be good producers of enzymes, such as cellulases and xylanases (Amirita et al., 2012; Corrêa et al., 2014).
The community of fungi associated with the DT of Triplectides in Cerrado has higher richness and diversity than those in the Amazon forest, which may be influenced by several factors. Particularities of streams such as current velocity, width, and depth (Landeiro et al., 2010) and leaf characteristics are important and must be taken into account in studies on tropical streams (Li et al., 2009; Landeiro et al., 2010). Current velocity may also influence the feeding of insects inhabiting streams (Boyero et al., 2006). Moreover, the taxonomy and functionality of the composition of communities of Trichoptera in Cerrado streams may be determined by factors such as physical structure of the streams and water quality (Ferreira et al., 2017). That may explain the differences in composition of the fungal community of Triplectides DT between those two biomes. Streams in the Amazon Forest and Cerrado, besides having distinct abiotic characteristics and plant physiognomies, can host different species of Triplectides, thus resulting in different mycobiomes. In the Cerrado, a higher diversity of species of Triplectides may have been sampled, since fourteen insects were sampled in the Cerrado whereas only seven were collected in the Amazon Forest. In addition to those, factors such as altitude, which was different in the streams studied, may have an influence. According to Camacho et al. (2009), the abundance and richness of shredder species vary with the altitude due to the variation in temperature. According to Casotti et al. (2015), the characteristics of the leaves may induce the behavior of shredders, such as Triplectides, as these organisms are able to choose the most palatable resources. The Cerrado vegetation has leaves with waxes, hair, and other characteristics (Fank-de-Carvalho et al., 2010) that make them less palatable than forest vegetation (Landeiro et al., 2010; Reis et al., 2019). Triplectides larvae may feed preferably in leaves heavily conditioned by fungi in Cerrado streams, explaining the higher fungal diversity in Cerrado than Amazon Forest.
The occurrence of filamentous fungi producers of cellulases and xylanases in the DT of Triplectides larvae indicates that those organisms may play a role in the breakdown of lignocellulosic matter ingested by the larva. The percentage of CMCase-producing strains in the Cerrado (78%) was more than two-fold that in the Amazon Forest (35%). The differences in vegetation composition may have influenced the enzymatic profile of the fungal community in the biomes studied since different plant species host different fungal species (Ferreira et al., 2015). Also, the lower palatability of leaves from Cerrado vegetation may account for differences in fungal enzymatic capabilities in leaves of these two biomes. The percentages of strains that broke down xylan in the Cerrado (62%) and in the Amazon Forest (71%) indicate that the fungal community is more xylanolytic than cellulolytic. That is certainly due to the characteristic of the Triplectides insect that feeds both on leaves and on wood (Oliveira and Pes, 2014; Cortez and Gonçalves, 2015). And, as plant cell walls are composed of cellulose, hemicellulose (mainly xylan), and lignin (Walia et al., 2017), xylan requires several xylanolytic enzymes for full hydrolysis (Okeke, 2014).
In this work, it was observed that some taxa are potentially higher enzyme-producers than others. The genera Cladosporium and Penicillium exhibited the highest enzymatic indexes for xylanase and cellulase, having, in this case, greater extracellular enzyme activity (Oliveira et al., 2006). The species that had the highest indices were Cladosporium kenpeggii, which is considered a new, little-studied species (Marin-Felix et al., 2017), as well as Cladosporium subuliforme (Ramos-García et al., 2016) and Penicillium malochii (Rivera et al., 2012). According to the literature, Penicillium species may produce enzymes able to break down lignocellulosic material (Andersen et al., 2016; Mohammed et al., 2018), as well as species of Cladosporium (Andersen et al., 2016; Marques et al., 2018).
It is likely that the larvae acquire the fungi from their diet, which, along with the environment where they live, impact the formation of the mycobiome of the larvae (Yao et al., 2019). In that case, fungi may represent an additional food item so that many fungi can be considered a reasonable source of amino acids and nitrogen in insect diets (Mason et al., 2017). In addition to being part of larva diet, the symbiotic role of that fungal community may be related to the action of enzymes able to delignify the material made up of, mainly, cellulose, hemicellulose (Gao et al., 2018; Alves Júnior et al., 2019), and xylans, enriching the diet of the insect, thus exerting a nutritional role (Mohammed et al., 2018). Our results point to the hypothesis that the fungal community found in DT of Triplectides larvae helps in processing the food both during conditioning in the ecosystem and in the DT. The presence of xylanolytic and cellulolytic fungi in the DT of aquatic shredder insects supports the hypothesis of a nutritional role of fungi as a symbiont and reinforces the importance of ecological studies for the discovery of biotechnological potential for enzyme production of fungal strains new to science.
Acknowledgements
The authors thank the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) for funding the project Edital Chamada MCTI/CNPq/FNDCT Ação Transversal - Redes Regionais de Pesquisa em Ecossistemas, Biodiversidade e Biotecnologia No. 79/2013; the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) for the scholarship provided to Mayra F. N. P. Teixeira; the staff of the LAMBIO - Federal University of Tocantins for the technical support; the staff of the Laboratory of Citotaxonomy and Aquatic Insects – LACIA of the Instituto Nacional de Pesquisas da Amazônia - INPA, especially Dr Neusa Hamada, Jeferson Oliveira da Silva and Dr Gizelle Amora Gusmão for the field work on collection and identification of Triplectides larvae.
References
-
ABOS, C.P., LEPORI, F., MCKIE, B.G. and MALMQVIST, B., 2006. Aggregation among resource patches can promote coexistence in stream-living shredders. Freshwater Biology, vol. 51, no. 3, pp. 545-553. http://dx.doi.org/10.1111/j.1365-2427.2006.01509.x
» http://dx.doi.org/10.1111/j.1365-2427.2006.01509.x -
ALMEIDA, P.Z., PEREIRA, M.G., CARVALHO, C.C., HEINEN, P.R., ZIOTTI, L.S., MESSIAS, J.M., JORGE, J.A. and POLIZELI, M.L.T.M., 2017. Bioprospection and characterization of the amylolytic activity by filamentous fungi from Brazilian Atlantic Forest. Biota Neotropica, vol. 17, no. 3, p. e20170337. http://dx.doi.org/10.1590/1676-0611-bn-2017-0337
» http://dx.doi.org/10.1590/1676-0611-bn-2017-0337 -
ALTSCHUL, S.F., GISH, W., MILLER, W., MYERS, E.W. and LIPMAN, D.J., 1990. Basic local alignment search tool. Journal of Molecular Biology, vol. 215, no. 3, pp. 403-410. http://dx.doi.org/10.1016/S0022-2836(05)80360-2 PMid:2231712.
» http://dx.doi.org/10.1016/S0022-2836(05)80360-2 -
ALVES JÚNIOR, S.L., MÜLLER, C., BONATTO, C., SCAPINI, T., CAMARGO, A.F., FONGARO, G. and TREICHEL, H., 2019. Bioprospection of enzymes and microorganisms in insects to improve second-generation ethanol production. Industrial Biotechnology, vol. 15, no. 6, pp. 336-349. http://dx.doi.org/10.1089/ind.2019.0019
» http://dx.doi.org/10.1089/ind.2019.0019 - AMIRITA, A., SINDHU, P., SWETHA, J., VASANTHI, N.S. and KANNAN, K.P., 2012. Enumeration of endophytic fungi from medicinal plants and screening of extracellular enzymes. World Journal of Science and Technology, vol. 2, no. 2, pp. 13-19.
-
ANDERSEN, B., POULSEN, R. and HANSEN, G.H., 2016. Cellulolytic and xylanolytic activities of common indoor fungi. International Biodeterioration & Biodegradation, vol. 107, pp. 111-116. http://dx.doi.org/10.1016/j.ibiod.2015.11.012
» http://dx.doi.org/10.1016/j.ibiod.2015.11.012 -
ARIAS-CORDERO, E., PING, L., REICHWALD, K., DELB, H., PLATZER, M. and BOLAND, W., 2012. Comparative evaluation of the gut microbiota associated with the below- and above-ground life stages (Larvae and Beetles) of the Forest Cockchafer, Melolontha hippocastani. PLoS One, vol. 7, no. 12, p. e51557. http://dx.doi.org/10.1371/journal.pone.0051557 PMid:23251574.
» http://dx.doi.org/10.1371/journal.pone.0051557 -
BELMONT-MONTEFUSCO, E.L., NACIF-MARÇAL, L., ASSUNÇÃO, E.N., HAMADA, N. and NUNES-SILVA, C.G., 2020a. Cultivable cellulolytic fungi isolated from the gut of Amazonian aquatic insects. Acta Amazonica, vol. 50, no. 4, pp. 346-354. http://dx.doi.org/10.1590/1809-4392202000902
» http://dx.doi.org/10.1590/1809-4392202000902 -
BELMONT-MONTEFUSCO, E.L., OLIVEIRA, J.B., MAR, H.B., SANTA-ROSA, P.S., HAMADA, N. and NUNES-SILVA, C.G., 2020b. Isolamento e potencial enzimático de fungos associados ao intestino de larvas de Stenochironomus Kieffer (Insecta: Diptera: Chironomidae). Brazilian Journal of Development, vol. 6, no. 5, pp. 28644-28651. http://dx.doi.org/10.34117/bjdv6n5-347
» http://dx.doi.org/10.34117/bjdv6n5-347 -
BENSACI, O.A., DAOUD, H., LOMBARKIA, N. and ROUABAH, K., 2015. Formulation of the endophytic fungus Cladosporium oxysporum Berk. & M.A. Curtis, isolated from Euphorbia bupleuroides subsp. luteola, as a new biocontrol tool against the black bean aphid (Aphis fabae Scop.). Journal of Plant Protection Research, vol. 55, no. 1, pp. 80-87. http://dx.doi.org/10.1515/jppr-2015-0011
» http://dx.doi.org/10.1515/jppr-2015-0011 -
BOUCIAS, D.G., LIETZE, V.U. and TEAL, P., 2012. Chemical signals that mediate insect-fungal interactions. In: G. WITZANY, ed. Biocommunication of fungi Dordrecht: Springer, pp. 305-336. http://dx.doi.org/10.1007/978-94-007-4264-2_20
» http://dx.doi.org/10.1007/978-94-007-4264-2_20 -
BOYERO, L., PEARSON, R.G. and CAMACHO, R., 2006. Leaf breakdown in tropical streams: the role of different species in ecosystem functioning. Archiv für Hydrobiologie, vol. 166, no. 4, pp. 453-466. http://dx.doi.org/10.1127/0003-9136/2006/0166-0453
» http://dx.doi.org/10.1127/0003-9136/2006/0166-0453 -
BURGHOORN, H.P., SOTEROPOULOS, P., PADERU, P., KASHIWAZAKI, R. and PERLIN, D.S., 2002. Molecular evaluation of the plasma membrane proton pump from Aspergillus fumigatus. Antimicrobial Agents and Chemotherapy, vol. 46, no. 3, pp. 615-624. http://dx.doi.org/10.1128/AAC.46.3.615-624.2002 PMid:11850239.
» http://dx.doi.org/10.1128/AAC.46.3.615-624.2002 -
CAMACHO, R., BOYERO, L., CORNEJO, A., IBÁÑEZ, A. and PEARSON, R.G., 2009. Local variation in shredder distribution can explain their oversight in tropical streams. Biotropica, vol. 41, no. 5, pp. 625-632. http://dx.doi.org/10.1111/j.1744-7429.2009.00519.x
» http://dx.doi.org/10.1111/j.1744-7429.2009.00519.x - CASOTTI, C.G., KIFFER JUNIOR, W.P. and MORETTI, M.S., 2015. Leaf traits induce the feeding preference of a shredder of the genus Triplectides Kolenati, 1859. (Trichoptera) in an Atlantic Forest stream, Brazil: a test with native and exotic leaves. International Journal of Freshwater Entomology, vol. 36, pp. 43-52.
- CASTELLANI, A., 1939. The viability of some pathogenic fungi in sterile distilled water. The American Journal of Tropical Medicine and Hygiene, vol. 42, pp. 65-72.
- CEJA-NAVARRO, J.A., NGUYEN, N.H., KARAOZ, U., GROSS, S.R., HERMAN, D.J., ANDERSEN, G.L., BRUNS, T.D., PETT-RIDGE, J., BLACKWELL, M. and BRODIE, E.L., 2014. Compartmentalized microbial composition, oxygen gradients and nitrogen fixation in the gut of Odontotaenius disjunctus. The ISME Journal, vol. 8, no. 1, pp. 6-18. PMid:23985746.
-
CHEN, B., TEH, B.S., SUN, C., HU, S., LU, X., BOLAND, W. and SHAO, Y., 2016. Biodiversity and activity of the gut microbiota across the life history of the insect herbivore Spodoptera littoralis. Scientific Reports, vol. 6, no. 1, p. 29505. http://dx.doi.org/10.1038/srep29505 PMid:27389097.
» http://dx.doi.org/10.1038/srep29505 -
CLAIR, R.M., 1994. Diets of some larval Leptoceridae (Trichoptera) in South-eastern Australia. Australian Journal of Marine and Freshwater Research, vol. 45, pp. 1023-1032. http://dx.doi.org/10.1071/MF9941023
» http://dx.doi.org/10.1071/MF9941023 -
CORRÊA, R.C.G., RHODEN, S.A., MOTA, T.R., AZEVEDO, J.L., PAMPHILE, J.A., SOUZA, C.G.M., POLIZELI, M.L.T.M., BRACHT, A. and PERALTA, R.M., 2014. Endophytic fungi: expanding the arsenal of industrial enzyme producers. Journal of Industrial Microbiology & Biotechnology, vol. 41, no. 10, pp. 1467-1478. http://dx.doi.org/10.1007/s10295-014-1496-2 PMid:25117531.
» http://dx.doi.org/10.1007/s10295-014-1496-2 - CORTEZ, V.G. and GONÇALVES, R.B., 2015. Guia da biodiversidade de Palotina Palotina: Editora UFPR.
-
DOUGLAS, A.E., 2015. Multiorganismal insects: diversity and function of resident microorganisms. Annual Review of Entomology, vol. 60, no. 1, pp. 17-34. http://dx.doi.org/10.1146/annurev-ento-010814-020822 PMid:25341109.
» http://dx.doi.org/10.1146/annurev-ento-010814-020822 -
ENGEL, P. and MORAN, N.A., 2013. The gut microbiota of insects – diversity in structure and function. FEMS Microbiology Reviews, vol. 37, no. 5, pp. 699-735. http://dx.doi.org/10.1111/1574-6976.12025 PMid:23692388.
» http://dx.doi.org/10.1111/1574-6976.12025 -
FANK-DE-CARVALHO, S.M., GOMES, M.R.A., SILVA, P.I.T. and BÁO, S.N., 2010. Leaf surfaces of Gomphrena spp. (Amaranthaceae) from Cerrado biome. Biocell, vol. 34, no. 1, pp. 23-36. http://dx.doi.org/10.32604/biocell.2010.34.023 PMid:20506628.
» http://dx.doi.org/10.32604/biocell.2010.34.023 -
FERREIRA, E.M.S., SOUSA, F.M.P., ROSA, L.H. and PIMENTA, R.S., 2019. Taxonomy and richness of yeasts associated with angiosperms, bryophytes, and meltwater biofilms collected in the Antarctic Peninsula. Extremophiles, vol. 23, no. 1, pp. 151-159. http://dx.doi.org/10.1007/s00792-018-1069-9 PMid:30499002.
» http://dx.doi.org/10.1007/s00792-018-1069-9 -
FERREIRA, W.R., HEPP, L.U., LIGEIRO, R., MACEDO, D.R., HUGHES, R.M., KAUFMANN, P.R. and CALLISTO, M., 2017. Partitioning taxonomic diversity of aquatic insect assemblages and functional feeding groups in neotropical savanna headwater streams. Ecological Indicators, vol. 72, pp. 365-373. http://dx.doi.org/10.1016/j.ecolind.2016.08.042
» http://dx.doi.org/10.1016/j.ecolind.2016.08.042 -
FERREIRA, W.R., LIGEIRO, R., MACEDO, D.R., HUGHES, R.M., KAUFMANN, P.R., OLIVEIRA, L.G. and CALLISTO, M., 2015. Is the diet of a typical shredder related to the physical habitat of headwater streams in the Brazilian Cerrado? International Journal of Limnology, vol. 51, no. 2, pp. 115-127. http://dx.doi.org/10.1051/limn/2015004
» http://dx.doi.org/10.1051/limn/2015004 -
GAO, G., GAO, J., HAO, C., DAI, L. and CHEN, H., 2018. Biodiversity and activity of gut fungal communities across the life history of Trypophloeus klimeschi (Coleoptera: Curculionidae: Scolytinae). International Journal of Molecular Sciences, vol. 19, no. 7, p. 2010. http://dx.doi.org/10.3390/ijms19072010 PMid:29996485.
» http://dx.doi.org/10.3390/ijms19072010 -
GIBSON, C.M. and HUNTER, M.S., 2010. Extraordinarily widespread and fantastically complex: comparative biology of endosymbiotic bacterial and fungal mutualists of insects. Ecology Letters, vol. 13, no. 2, pp. 223-234. http://dx.doi.org/10.1111/j.1461-0248.2009.01416.x PMid:20015249.
» http://dx.doi.org/10.1111/j.1461-0248.2009.01416.x -
GODINHO, V.M., FURBINO, L.E., SANTIAGO, I.F., PELLIZZARI, F.M., YOKOYA, N.S., PUPO, D., ALVES, T.M.A., SALES JÚNIOR, P.A., ROMANHA, A.J., ZANI, C.L., CANTRELL, C.L., ROSA, C.A. and ROSA, L.H., 2013. Diversity and bioprospecting of fungal communities associated with endemic and cold-adapted macroalgae in Antarctica. The ISME Journal, vol. 7, no. 7, pp. 1434-1451. http://dx.doi.org/10.1038/ismej.2013.77 PMid:23702515.
» http://dx.doi.org/10.1038/ismej.2013.77 -
GODINHO, V.M., GONÇALVES, V.N., SANTIAGO, I.F., FIGUEREDO, H.M., VITORELI, G.A., SCHAEFER, C.E.G.R., BARBOSA, E.C., OLIVEIRA, J.G., ALVES, T.M.A., ZANI, C.L., SALES JÚNIOR, P.A., MURTA, S.M.F., ROMANHA, A.J., KROON, E.G., CANTRELL, C.L., WEDGE, D.E., DUKE, S.O., ALI, A., ROSA, C.A. and ROSA, L.H., 2015. Diversity and bioprospection of fungal community present in oligotrophic soil of continental Antarctica. Extremophiles, vol. 19, no. 3, pp. 585-596. http://dx.doi.org/10.1007/s00792-015-0741-6 PMid:25809294.
» http://dx.doi.org/10.1007/s00792-015-0741-6 -
GRAÇA, M.A.S., CRESSA, C., GESSNER, M.O., FEIO, M.J., CALLIES, K.A. and BARRIOS, C., 2001. Food quality, feeding preferences, survival and growth of shredders from temperate and tropical streams. Freshwater Biology, vol. 46, no. 7, pp. 947-957. http://dx.doi.org/10.1046/j.1365-2427.2001.00729.x
» http://dx.doi.org/10.1046/j.1365-2427.2001.00729.x -
GRAÇA, M.A.S., HYDE, K. and CHAUVET, E., 2016. Aquatic hyphomycetes and litter decomposition in tropical – subtropical low order streams. Fungal Ecology, vol. 19, pp. 182-189. http://dx.doi.org/10.1016/j.funeco.2015.08.001
» http://dx.doi.org/10.1016/j.funeco.2015.08.001 -
GUTIÉRREZ, M.H., GALAND, P.E., MOFFAT, C. and PANTOJA, S., 2015. Melting glacier impacts community structure of Bacteria, Archaea and Fungi in a Chilean Patagonia fjord. Environmental Microbiology, vol. 17, no. 10, pp. 3882-3897. http://dx.doi.org/10.1111/1462-2920.12872 PMid:25856307.
» http://dx.doi.org/10.1111/1462-2920.12872 - HAMADA, N., NESSIMIAN, J.L. and QUERINO, R.B., 2014. Insetos aquáticos na Amazônia brasileira: taxonomia, biologia e ecologia Manaus: Editora do INPA.
- HAMMER, O., HARPER, D.A.T. and RYAN, P.D., 2001. PAST: Paleontological Statistics software package for education and data analysis. Palaeontologia Electronica, vol. 4, pp. 1-9.
-
JABIOL, J. and CHAUVET, E., 2012. Fungi are involved in the effects of litter mixtures on consumption by shredders. Freshwater Biology, vol. 57, no. 8, pp. 1667-1677. http://dx.doi.org/10.1111/j.1365-2427.2012.02829.x
» http://dx.doi.org/10.1111/j.1365-2427.2012.02829.x -
KIFFER, W.P., MENDES, F., RANGEL, J.V., BARBOSA, P., SERPA, K. and MORETTI, M.D.A.S., 2016. Size-mass relationships and the influence of larval and case size on the consumption rates of Triplectides sp. (Trichoptera, Leptoceridae). Archiv für Hydrobiologie, vol. 188, no. 1, pp. 73-81. http://dx.doi.org/10.1127/fal/2016/0855
» http://dx.doi.org/10.1127/fal/2016/0855 -
KWONG, W.K. and MORAN, N.A., 2016. Gut microbial communities of social bees. Nature Reviews. Microbiology, vol. 14, no. 6, pp. 374-384. http://dx.doi.org/10.1038/nrmicro.2016.43 PMid:27140688.
» http://dx.doi.org/10.1038/nrmicro.2016.43 -
LANDEIRO, V.L., HAMADA, N., GODOY, B.S. and MELO, A.S., 2010. Effects of litter patch area on macroinvertebrate assemblage structure and leaf breakdown in Central Amazonian streams. Hydrobiologia, vol. 649, no. 1, pp. 355-363. http://dx.doi.org/10.1007/s10750-010-0278-8
» http://dx.doi.org/10.1007/s10750-010-0278-8 - LEÓN, A.V.-P., SANCHEZ-FLORES, A., ROSENBLUETH, M. and MARTÍNEZ-ROMERO, E., 2016. Fungal community associated with Dactylopius (Hemiptera: Coccoidea: Dactylopiidae) and its role in uric acid metabolism. Frontiers in Microbiology, vol. 7, p. 954. PMid:27446001.
-
LI, A.O.Y., NG, L.C.Y. and DUDGEON, D., 2009. Effects of leaf toughness and nitrogen content on litter breakdown and macroinvertebrates in a tropical stream. Aquatic Sciences, vol. 71, no. 1, pp. 80-93. http://dx.doi.org/10.1007/s00027-008-8117-y
» http://dx.doi.org/10.1007/s00027-008-8117-y -
MALTA, C.M., FERREIRA, E.M.S., SILVA, T.H., OLIVEIRA, D.A.B., SILVA, F.M.P., SILVA, J.F.M. and PIMENTA, R.S., 2019. Isolation of epiphytic yeasts from Eugenia dysenterica DC. fruits and evaluation of their antimicrobial activity against phytopathogenic fungi. Boletim do Museu Paraense Emílio Goeldi. Ciências Naturais, vol. 14, no. 2, pp. 223-231. http://dx.doi.org/10.46357/bcnaturais.v14i2.176
» http://dx.doi.org/10.46357/bcnaturais.v14i2.176 -
MARIN-FELIX, Y., GROENEWALD, J.Z., CAI, L., CHEN, Q., MARINCOWITZ, S., BARNES, I., BENSCH, K., BRAUN, U., CAMPORESI, E., DAMM, U., BEER, Z.W., DISSANAYAKE, A., EDWARDS, J., GIRALDO, A., HERNÁNDEZ-RESTREPO, M., HYDE, K.D., JAYAWARDENA, R.S., LOMBARD, L., LUANGSA-ARD, J., MCTAGGART, A.R., ROSSMAN, A.Y., SANDOVAL-DENIS, M., SHEN, M., SHIVAS, R.G., TAN, Y.P., VAN DER LINDE, E.J., WINGFIELD, M.J., WOOD, A.R., ZHANG, J.Q., ZHANG, Y. and CROUS, P.W., 2017. Genera of phytopathogenic fungi: GOPHY 1. Studies in Mycology, vol. 86, no. 1, pp. 99-216. http://dx.doi.org/10.1016/j.simyco.2017.04.002 PMid:28663602.
» http://dx.doi.org/10.1016/j.simyco.2017.04.002 -
MARQUES, N.P., PEREIRA, J.C., GOMES, E., SILVA, R., ARAÚJO, A.R., FERREIRA, H., RODRIGUES, A., DUSSÁN, K.J. and BOCCHINI, D.A., 2018. Cellulases and xylanases production by endophytic fungi by solid state fermentation using lignocellulosic substrates and enzymatic saccharification of pretreated sugarcane bagasse. Industrial Crops and Products, vol. 122, pp. 66-75. http://dx.doi.org/10.1016/j.indcrop.2018.05.022
» http://dx.doi.org/10.1016/j.indcrop.2018.05.022 -
MARTINS, R.T., MELO, A.S., GONÇALVES JÚNIOR, J.F., CAMPOS, C.M. and HAMADA, N., 2017. Effects of climate change on leaf breakdown by microorganisms and the shredder Phylloicus elektoros (Trichoptera: calamoceratidae). Hydrobiologia, vol. 789, no. 1, pp. 31-44. http://dx.doi.org/10.1007/s10750-016-2689-7
» http://dx.doi.org/10.1007/s10750-016-2689-7 -
MASON, C.J., LONG, D.C., MCCARTHY, E.M., NAGACHAR, N., ROSA, C., SCULLY, E.D., TIEN, M. and HOOVER, K., 2017. Within gut physicochemical variation does not correspond to distinct resident fungal and bacterial communities in the tree-killing xylophage, Anoplophora glabripennis. Journal of Insect Physiology, vol. 102, pp. 27-35. http://dx.doi.org/10.1016/j.jinsphys.2017.08.003 PMid:28823530.
» http://dx.doi.org/10.1016/j.jinsphys.2017.08.003 -
MOHAMMADIAN, E., AHARI, A.B., ARZANLOU, M., OUSTAN, S. and KHAZAEI, S.H., 2017. Tolerance to heavy metals in filamentous fungi isolated from contaminated mining soils in the Zanjan province, Iran. Chemosphere, vol. 185, pp. 290-296. http://dx.doi.org/10.1016/j.chemosphere.2017.07.022 PMid:28700958.
» http://dx.doi.org/10.1016/j.chemosphere.2017.07.022 -
MOHAMMED, W.S., ZIGANSHINA, E.E., SHAGIMARDANOVA, E.I., GOGOLEVA, N.E. and ZIGANSHIN, A.M., 2018. Comparison of intestinal bacterial and fungal communities across various xylophagous beetle larvae (Coleoptera: cerambycidae). Scientific Reports, vol. 8, no. 1, p. 10073. http://dx.doi.org/10.1038/s41598-018-27342-z PMid:29968731.
» http://dx.doi.org/10.1038/s41598-018-27342-z - NOGUEIRA, E.B.S. and CAVALCANTI, M.A.Q., 1996. Cellulolytic fungi isolated from processed oats. Revista de Microbiologia, vol. 27, pp. 7-9.
-
OKEKE, B.C., 2014. Cellulolytic and xylanolytic potential of high β-glucosidase-producing Trichoderma from decaying biomass. Applied Biochemistry and Biotechnology, vol. 174, no. 4, pp. 1581-1598. http://dx.doi.org/10.1007/s12010-014-1121-x PMid:25129039.
» http://dx.doi.org/10.1007/s12010-014-1121-x -
OLIVEIRA, A.N., OLIVEIRA, L.A., ANDRADE, J.S. and CHAGAS JÚNIOR, A.F., 2006. Enzimas hidrolíticas extracelulares de isolados de rizóbia nativos da Amazônia Central, Amazonas, Brasil. Food Science and Technology, vol. 26, no. 4, pp. 853-860. http://dx.doi.org/10.1590/S0101-20612006000400022
» http://dx.doi.org/10.1590/S0101-20612006000400022 - OLIVEIRA, V.C. and PES, A.M.O., 2014. Inventário da fauna de insetos aquáticos: coleta, preservação e criação. In: N. HAMADA, J.L. NESSIMIAN and R.B. QUERINO, eds. Insetos aquáticos na Amazônia brasileira: taxonomia, biologia e ecologia Manaus: Editora do INPA, pp. 155-171.
-
PEAY, K.G., KENNEDY, P.G. and TALBOT, J.M., 2016. Dimensions of biodiversity in the Earth mycobiome. Nature Reviews. Microbiology, vol. 14, no. 7, pp. 434-447. http://dx.doi.org/10.1038/nrmicro.2016.59 PMid:27296482.
» http://dx.doi.org/10.1038/nrmicro.2016.59 -
PES, A.M.O., HAMADA, N. and NESSIMIAN, J.L., 2005. Chaves de identificação de larvas para famílias e gêneros de Trichoptera (Insecta) da Amazônia Central, Brasil. Revista Brasileira de Entomologia, vol. 49, no. 2, pp. 181-204. http://dx.doi.org/10.1590/S0085-56262005000200002
» http://dx.doi.org/10.1590/S0085-56262005000200002 - PES, A.M.O., SANTOS, A.P.M., BARCELOS-SILVA, P. and CAMARGOS, L.M., 2014. Ordem Trichoptera. In: N. HAMADA, J.L. NESSIMIAN and R.B. QUERINO, eds. Insetos aquáticos na Amazônia brasileira: taxonomia, biologia e ecologia Manaus: Editora do INPA, pp. 391-433.
-
PIMENTEL, D.R., COUCEIRO, S.R.M. and SALCEDO, A.K.M., 2020. Diet of Phylloicus (Trichoptera: Calamoceratidae) caddisfly larvae in forest streams of western Pará, central Brazilian Amazonia. Acta Limnologica Brasiliensia, vol. 32, p. e13. http://dx.doi.org/10.1590/s2179-975x0119
» http://dx.doi.org/10.1590/s2179-975x0119 -
RAMÍREZ-CAMEJO, L.A., 2024. Diversity of culturable endophytic fungi vary through time in Manihot esculenta Crantz. Brazilian Journal of Biology = Revista Brasileira de Biologia, vol. 84, p. e253156. http://dx.doi.org/10.1590/1519-6984.253156 PMid:35019095.
» http://dx.doi.org/10.1590/1519-6984.253156 -
RAYMANN, K. and MORAN, N.A., 2018. The role of the gut microbiome in health and disease of adult honey bee workers. Current Opinion in Insect Science, vol. 26, pp. 97-104. http://dx.doi.org/10.1016/j.cois.2018.02.012 PMid:29764668.
» http://dx.doi.org/10.1016/j.cois.2018.02.012 -
REIS, D.F., MACHADO, M.M.D., COUTINHO, N.P., RANGEL, J.V., MORETTI, M.S. and MORAIS, P.B., 2019. Feeding preference of the shredder Phylloicus sp for plant leaves of Chrysophyllum oliviforme or Miconia chartacea after conditioning in streams from different biomes. Brazilian Journal of Biology = Revista Brasileira de Biologia, vol. 79, no. 1, pp. 22-28. http://dx.doi.org/10.1590/1519-6984.170644 PMid:29694562.
» http://dx.doi.org/10.1590/1519-6984.170644 -
RUKACHAISIRIKUL, V., KAEOBAMRUNG, J., PANWIRIYARAT, W., SAITAI, P., SUKPONDMA, Y., PHONGPAICHIT, S. and SAKAYAROJ, J., 2007. A new pyrone derivative from the endophytic fungus Penicillium paxilli PSU-A71. Chemical & Pharmaceutical Bulletin, vol. 55, no. 9, pp. 1383-1384. http://dx.doi.org/10.1248/cpb.55.1383 PMid:17827767.
» http://dx.doi.org/10.1248/cpb.55.1383 -
SANGER, F., NICKLEN, S. and COULSON, A.R., 1977. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America, vol. 74, no. 12, pp. 5463-5467. http://dx.doi.org/10.1073/pnas.74.12.5463 PMid:271968.
» http://dx.doi.org/10.1073/pnas.74.12.5463 -
SANTOS, A.P.M., CALOR, A.R., DUMAS, L.L., PES, A.M.O., SOUZA, W.R.M., HENRIQUES-OLIVEIRA, A.L. and CAMARGOS, L.M., 2019 [viewed 27 April 2022]. Trichoptera [online]. Catálogo Taxonômico da Fauna do Brasil. Available from: http://fauna.jbrj.gov.br/fauna/faunadobrasil/278
» http://fauna.jbrj.gov.br/fauna/faunadobrasil/278 -
SANTOS, T.T., LEITE, T.S., QUEIROZ, C.B., ARAÚJO, E.F., PEREIRA, O.L. and QUEIROZ, M.V., 2016. High genetic variability in endophytic fungi from the genus Diaporthe isolated from Common Bean (Phaseolus vulgaris L.) in Brazil. Journal of Applied Microbiology, vol. 120, no. 2, pp. 388-401. http://dx.doi.org/10.1111/jam.12985 PMid:26541097.
» http://dx.doi.org/10.1111/jam.12985 -
SANTOS, T.T., OLIVEIRA, K.A., VITAL, M.J.S., COUCEIRO, S.R.M. and MORAIS, P.B., 2018. Filamentous fungi in the digestive tract of Phylloicus larvae (Trichoptera: Calamoceratidae) in streams of the Brazilian Amazon. Boletim do Museu Paraense Emílio Goeldi. Ciências Naturais, vol. 13, no. 3, pp. 317-325. http://dx.doi.org/10.46357/bcnaturais.v13i3.340
» http://dx.doi.org/10.46357/bcnaturais.v13i3.340 -
SETTE, L.D., PASSARINI, M.R.Z., DELARMELINA, C., SALATI, F. and DUARTE, M.C.T., 2006. Molecular characterization and antimicrobial activity of endophytic fungi from coffee plants. World Journal of Microbiology & Biotechnology, vol. 22, no. 11, pp. 1185-1195. http://dx.doi.org/10.1007/s11274-006-9160-2
» http://dx.doi.org/10.1007/s11274-006-9160-2 -
SIX, D.L., 2012. Ecological and evolutionary determinants of bark beetle-fungus symbioses. Insects, vol. 3, no. 1, pp. 339-366. http://dx.doi.org/10.3390/insects3010339 PMid:26467964.
» http://dx.doi.org/10.3390/insects3010339 -
SONG, P., TANABE, S., YI, R., KAGAMI, M., LIU, X. and BAN, S., 2018. Fungal community structure at pelagic and littoral sites in Lake Biwa determined with high-throughput sequencing. Limnology, vol. 19, no. 2, pp. 241-251. http://dx.doi.org/10.1007/s10201-017-0537-8
» http://dx.doi.org/10.1007/s10201-017-0537-8 -
TONIN, A.M., GONÇALVES JÚNIOR, J.F., BAMBI, P., COUCEIRO, S.R.M., FEITOZA, L.A.M., FONTANA, L.E., HAMADA, N., HEPP, L.U., LEZAN-KOWALCZUK, V.G., LEITE, G.F.M., LEMES-SILVA, A.L., LISBOA, L.K., LOUREIRO, R.C., MARTINS, R.T., MEDEIROS, A.O., MORAIS, P.B., MORETTO, Y., OLIVERIA, P.C.A., PEREIRA, E.B., FERREIRA, L.P., PÉREZ, J., PETRUCIO, M.M., REIS, D.F., REZENDE, R.S., ROQUE, N., SANTOS, L.E.P., SIEGLOCH, A.E., TONELLO, G. and BOYERO, L., 2017. Plant litter dynamics in the forest-stream interface: precipitation is a major control across tropical biomes. Scientific Reports, vol. 7, no. 1, p. 10799. http://dx.doi.org/10.1038/s41598-017-10576-8 PMid:28883445.
» http://dx.doi.org/10.1038/s41598-017-10576-8 - VOGEL, H.J., 1956. A convenient growth medium for Neurospora crassa (medium N). Microbiology Genetics Bulletin, vol. 13, pp. 42-43.
-
WALIA, A., GULERIA, S., MEHTA, P., CHAUHAN, A. and PARKASH, J., 2017. Microbial xylanases and their industrial application in pulp and paper biobleaching: a review. 3 Biotech, vol. 7, no. 1, p. 11. http://dx.doi.org/10.1007/s13205-016-0584-6 PMid:28391477.
» http://dx.doi.org/10.1007/s13205-016-0584-6 - WHITE, T.J., BURNS, T.D., LEE, S.B. and TAYLOR, J.W., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: M.A. INNIS, D.H. GELFAND, J.J. SNINSKY and T.J. WHITE, eds. PCR protocols: a guide to methods and applications London: Academic Press, pp. 315-322.
-
YAO, Z., MA, Q., CAI, Z., RAZA, M.F., BAI, S., WANG, Y., ZHANG, H., MA, H. and ZHANG, H., 2019. Similar shift patterns in gut bacterial and fungal communities across the life stages of Bactrocera minax larvae from two field populations. Frontiers in Microbiology, vol. 10, p. 2262. http://dx.doi.org/10.3389/fmicb.2019.02262 PMid:31649629.
» http://dx.doi.org/10.3389/fmicb.2019.02262 -
ZHANG, Y.-H.P., HIMMEL, M.E. and MIELENZ, J.R., 2006. Outlook for cellulase improvement: screening and selection strategies. Biotechnology Advances, vol. 24, no. 5, pp. 452-481. http://dx.doi.org/10.1016/j.biotechadv.2006.03.003 PMid:16690241.
» http://dx.doi.org/10.1016/j.biotechadv.2006.03.003




