Abstract
Vaccine development is a rapidly advancing field, with recombinant strains emerging as safer, more effective, and versatile immunogenic platforms. In this context, the use of Bacillus subtilis as a recombinant vector presents a promising strategy, particularly in the development of vaccines targeting viral pathogens. This study aimed to construct recombinant Bacillus subtilis clones expressing the Major Capsid Protein (MCP) of ranavirus, a significant pathogen in aquatic animal diseases. To achieve this, a gene fusion between CotC and MCP, derived from Brazilian ranavirus isolates, was engineered and inserted into the pDG1662 plasmid. The recombinant plasmid was subsequently transformed into competent B. subtilis cells. The resulting clones, designated pDGCMCP, were confirmed via polymerase chain reaction (PCR) and validated through sequencing, thereby verifying the successful and novel construction of recombinant B. subtilis harboring the CotC::MCP fusion gene. These clones hold strong potential as candidates for future vaccine development against ranaviral infections. The application of B. subtilis as a vaccine delivery system offers several advantages, including safety, genetic stability, and the ability to elicit immune responses. Thus, the constructs developed in this study lay the groundwork for further investigations into effective prophylactic strategies against ranavirus-related diseases in aquaculture settings.
Keywords:
Recombinant strain; Bacillus subtilis; Ranavirus.
HIGHLIGHTS
This study innovatively constructed recombinant Bacillus subtilis clones with the CotC::MCP genes.
Obtention of a new plasmid (pDGCMCP) for the Bacillus subtilis strain.
Contribution towards the development of a vaccine vector against ranavirus utilizing Bacillus subtilis spores.
INTRODUCTION
Aquaculture is a practice focused on the cultivation of aquatic organisms, including aquatic plants and fish. It is currently one of the fastest-growing sectors within animal-based food production. In this context, Brazil recorded significant growth in 2023, with a 6.2% increase in production, largely attributed to the country's vast land availability [1].
Within this scenario, frog farming stands out. In Brazil, frog cultivation is primarily based on the farming of the species Lithobates catesbeianus, commonly known as the American bullfrog. This agro-industrial activity has shown promising potential due to technological advancements, improved farming infrastructure, and better management practices adopted by production units. Additionally, the high market value of frog meat and its by-products contributes to the growth and consolidation of the sector [2].
In this scenario, we can highlight the increasing production of frogs, which leads to the generation and dissemination of data related to zootechnical management and the health of these animals. This results in the accumulation of information about the main pathogens affecting frogs, with particular emphasis on the Ranavirus belonging to the family Iridoviridae. This virus is capable of infecting only amphibians, and currently, the only preventive method against ranavirus diseaes is through prophylactic measures [3,4,5].
Ranavirus is a notifiable and highly virulent virus, associated with high mortality rates in infected populations [6,7]. The introduction of this pathogen into different regions may be linked to the pet trade, initially through ornamental fish and, more recently, through the international movement of live amphibians such as the American bullfrog (Lithobates catesbeianus). This species can be infected by ranavirus without exhibiting clinical signs of disease, thus acting as a vector for viral dissemination [8].
In this context, the search for preventive measures to ensure the biosecurity of breeding stocks has intensified. One such strategy is the development of vaccines, with special attention given to the use of Bacillus subtilis in vaccine formulation protocols [9]. B. subtilis is a non-pathogenic, gram-positive bacterium classified as GRAS (Generally Recognized As Safe) by the FDA. It is commonly found in soil, does not colonize tissues, and is widely used as a probiotic. Moreover, it is naturally competent for transformation, capable of uptaking exogenous DNA, and forms highly resistant endospores [10].
The endospores of B. subtilis possess surface proteins such as CotC, which are synthesized during sporulation and anchored to the spore surface. CotC has been used as a carrier for heterologous antigens, both in human and veterinary applications, due to its surface localization [11]. Within this framework, the development of a recombinant B. subtilis strain expressing the Major Capsid Protein (MCP) of ranavirus represents a promising prophylactic strategy against ranaviral infections.
Therefore, the objective of the present study is to develop recombinant Bacillus subtilis clones through the fusion of the CotC gene from B. subtilis with the MCP gene from a Brazilian ranavirus isolate (FV3), aiming to ultimately obtain a recombinant B. subtilis strain expressing the MCP protein.
MATERIAL AND METHODS
The present study employed two methodologies: the fusion of the CotC and MCP genes using fusion PCR, and the cloning of the fused genes to achieve chromosomal integration.
Fusion of the CotC::MCP Genes
To obtain the CotC::MCP gene fusion, the CotC and MCP genes were first amplified. For the amplification of the CotC gene, genomic DNA was extracted from vegetative cells of Bacillus subtilis using thermal extraction, as described by Sambrook[12], with the primers CotCF/BamHI (CGGGATCCGCCGTGCAgCAGGAAAA) and CotCR/MCP (AGAAGACATTGACCAAGTAGTGTTTTTTATgCTTTTTATACTCTACAAC). The underlined nucleotides in the forward primer indicate the BamHI restriction site, while the underlined nucleotides in the reverse primer indicate the MCP fusion sequence.
The full MCP gene was amplified from a Brazilian strain of ranavirus (FV3), isolated and maintained at the Laboratory of Animal Hygiene, FZEA-USP, using BF-2 cells (bluegill fry, ATCC CCL 91) in MEM medium (Minimal Essential Medium - Gibco®, Life Technologies/Thermo Fisher Scientific, USA), following the protocol described by Mazzoni. The primers used were MCP/CotC (AAAAGCATAAAAAACACTACTCTTCTGTAACTGGTTC) and MCP/EcoRI (GAATTCTTACAAGATTGGGAATCC), modified with fusion sites for the CotC gene (forward) and an EcoRI restriction site (reverse).
For the gene fusion reaction, a preliminary PCR (PCR start) was carried out using 3μL of the CotC PCR product and 4μL of the MCP PCR product, both at a concentration of 10ng/μL. These were mixed with 12.5μL of GoTaq® Colorless Master Mix 2X and 5.5μL of nuclease-free water (GE Healthcare, USA), resulting in a final volume of 25μL. The thermal cycling protocol used for DNA strand annealing included incubation at 95°C for 5 minutes, followed by 13 cycles of 95°C for 1 minute, 60°C for 1 minute, and 72°C for 2 minutes.
The amplification PCR was performed using the GoTaq® Colorless Master Mix kit (Promega, USA). In brief, 3μL of the PCR start product were mixed with 12.5μL of GoTaq® Colorless Master Mix 2X, 1.0 μL of the specific forward primer (CotCF/BamHI) at 10μM, 1.0μL of the specific reverse primer (MCPR/EcoRI) at 10μM, and 7.5μL of nuclease-free water (GE Healthcare, USA), totaling 25μL. The thermal cycling protocol for gene fusion (CotC::MCP) included an initial denaturation at 95°C for 5 minutes, followed by 27 cycles of 95°C for 1 minute, 57°C for 1 minute, and 72°C for 2 minutes, with a final extension at 72°C for 10 minutes.
Following this amplification PCR, the products were subjected to electrophoresis on a 1.5% agarose gel in TAE buffer, and the expected fragment size of approximately 1600 bp was confirmed.
Cloning of CotC::MCP Gene Fusions for Chromosomal Integration
Digestion and Ligation
The gene fusion (CotC::MCP) and the plasmid pDG1662 (ECE113) were digested with the BamHI and EcoRI enzymes (Invitrogen™, Thermo Fisher Scientific, USA), using the following reactions: 12µl of nuclease-free water, 2µl of 2X Buffer Tango, 4µl of the BamHI enzyme, 2µl of the EcoRI enzyme, and 1µl of plasmid DNA at a concentration of 1µg/µl. The mixture was gently mixed and incubated at 37ºC for 4 hours, followed by inactivation at 80ºC for 20 minutes. For the fusion PCR product, 14µl of nuclease-free water, 2µl of 2X Buffer Tango, 4µl of the BamHI enzyme, 2µl of the EcoRI enzyme, and 10µl of the PCR product at a concentration of 0.5µg/µl were used. The mixture was gently mixed and incubated at 37ºC for 4 hours, followed by inactivation at 80ºC for 20 minutes. Verification of the cleaved fragments was performed on a 1% agarose gel stained with SYBR® Safe DNA gel stain (Invitrogen™, Thermo Fisher Scientific, USA). The map of the cloning vector pGG1662 is shown in Figure 1, with the insertion site of the gene of interest highlighted.
pGG1662 Cloning Vector Map. Characteristics of the pDG1662 vector: 6982 base pairs; promotes ectopic interaction at the amyE locus of 1A771, replacing the MLS resistance cassette. Source: Bacillus Genetic Stock Center Catalog Vol. 4.
Preparation of Competent Cells and Transformation of Bacillus subtilis
Competence of the KO7A strain of B. subtilis was induced following the protocol outlined in the Bacillus Genetic Stock Catalog. Once the cultures reached high competence, 1µg of the ligation product was added and incubated at 37ºC with aeration for 30 minutes. Following this, duplicate plating on selective media was performed, and the plates were then incubated at 37ºC overnight.
Analysis of Chromosomal Interaction
For the confirmation of chromosomal interaction, seven clones were selected and inoculated in 5 mL of LB supplemented with 5µg/mL of chloramphenicol at 37°C, overnight, with agitation at 200 rpm. Miniprep for plasmid DNA extraction was carried out using the Omega EZNA Plasmid DNA mini kit (Omega Bio-Tek, USA), following the manufacturer's recommendations. The pDGCMCP plasmids underwent a fusion PCR reaction to confirm the chromosomal interaction. The primers used were cotCF/BamHI (CGGGATCCGCCGTGCAgCAGGAAAA) and MCPR/EcoRI (GAATTCTTACAAGATTGGGAATCC) with the following thermocycling conditions. PCR start: incubation at 95°C for 5 min, followed by 13 cycles of 95°C for 1 min, 60°C for 1 min, and 72°C for 2 minutes; PCR amplification: incubation at 95°C for 5 min, followed by 27 cycles of 95°C for 1 min, 57°C for 1 min, and 72°C for 2 minutes, and a final extension at 72°C for 10 minutes. The illustration of the chromosomal interaction is show in Figure 2.
Representation of Chromosomal Interaction. A) Fusions of cotC::MCP genes in the pDG1662 plasmid. (B) Chromosomal integration in Bacillus subtilis through a double crossover recombination event in the coding sequence of the amyE gene. Source:[13] Modified.
RESULTS
Chromosomal Interaction
Ligation and Transformation in Bacillus subtilis Strain
For a more efficient ligation, a 1:1 ratio of pDG1662 vector (ECE113) and insert was used. After 18 hours of incubation, the recombinant vector (CotC/MCP) and the PCR control were introduced into the highly competent Bacillus subtilis strain (KO7A). Ligation and transformation can be seen in Figure 3.
Plate A, containing LB medium with the addition of spectinomycin (100 µg/mL), showed no colony growth. Plate B, containing LB medium with the addition of chloramphenicol (5 µg/mL), showed the growth of transformed colonies. Source: Own.
Analysis of Chromosomal Interaction
For confirmation of the Chromosomal Interaction, fusion gene CotC::MCP was amplified via PCR and analyzed on an agarose gel. Out of the 7 recombinant clones analyzed, only six (87%) displayed the expected 1,600 bp fragment corresponding to the CotC::MCP fusion gene (Figure 4). The fragment was purified and sent for Sanger sequencing, which confirmed the chromosomal interaction between the Bacillus subtilis KO7A strain and the CotC::MCP gene fusion, indicating that the fusion gene is successfully inserted into the pDG1662 plasmid. This result demonstrates that the natural ability of wild-type Bacillus subtilis strains to recombine with other genes can be enhanced through the use of recombinant plasmids.
Result of the 1.5% agarose gel electrophoresis showing the amplification of the CotC::MCP gene fusion. M: molecular weight marker (100 bp Ladder, Promega); lanes 1 to 6: cotC::MCP gene amplicons. Source: Own."
DISCUSSION
The growth of frog farming in Brazil has driven the need for improvements in management practices, particularly regarding animal health. Among the main challenges faced by producers is the emergence of viral diseases, such as those caused by iridoviruses-especially ranaviruses. These pathogens not only compromise productivity but also pose serious threats to biodiversity and the sanitary safety of production systems, and are classified as notifiable diseases [1,4,5,7]. These characteristics underscore the urgency of developing effective prophylactic strategies, since no specific therapies are currently available for the treatment of ranaviral infections.
In this context, biotechnology applied to vaccine development has proven to be a promising tool. In particular, the use of Bacillus subtilis spores as a platform for heterologous antigen presentation represents a significant advancement. These spores are highly stable, resistant to adverse environmental conditions, and capable of surviving passage through the gastrointestinal tract, making them ideal candidates for oral vaccine formulations. The CotC protein, naturally found on the spore surface, has been widely used as an anchoring system for the display of recombinant antigens [13,14,15].
A pivotal study first demonstrated the feasibility of using recombinant B. subtilis spores expressing toxin fragments as immunizing agents [16]. Since then, multiple studies have confirmed the immunogenic efficacy of this approach. For instance, the expression of tetanus toxin on spores elicited a significantly stronger immune response in orally immunized mice compared to control groups [13]. These findings indicate the platform’s potential to induce both systemic and, potentially, mucosal immunity-a critical aspect for infections affecting epithelial surfaces such as skin and the digestive tract, as is the case with ranaviruses.
Moreover, some studies have already developed recombinant B. subtilis spores containing the MCP gene of the Largemouth bass virus (LMBV), a member of the Ranavirus genus, showing that immunization with this formulation provided significant protection to fish against viral infection [17]. In parallel, another research group used surface display technology in Saccharomyces cerevisiae to express the B subunit of Escherichia coli heat-labile enterotoxin (LTB) together with the MCP protein from ranavirus (LMBV) in fish [18]. The results demonstrated not only systemic immune responses but also significant activation of mucosal immunity, highlighting the value of surface antigen presentation as a strategy for mucosal vaccines.
Building on these advances, the present study represents a pioneering contribution to the field by proposing the construction of a recombinant B. subtilis strain (CotC::MCP) using a Brazilian isolate of ranavirus. The significance of this approach lies not only in the novelty of employing a locally circulating isolate-which may enhance the specificity and efficacy of the immune response against national strains-but also in the potential to develop a cost-effective oral vaccine suited to the realities of Brazilian aquaculture.
From a critical perspective, it is important to acknowledge that, although the literature strongly supports the use of B. subtilis as a vaccine vector, several limitations remain. The immunogenicity demonstrated in murine and fish models still needs to be validated in amphibians, especially under field conditions. Additionally, factors such as antigen stability, optimal immunization dose, and the required frequency of booster doses remain unresolved and require further experimental investigation.
This study is grounded in a solid foundation of scientific evidence and proposes an innovative and context-specific approach to combatting ranaviral infections in frogs. The use of B. subtilis as a vaccine platform represents a strategic opportunity for developing oral vaccines capable of inducing both systemic and mucosal immunity-particularly relevant given the nature of ranavirus infections. The continuation of this work, including in vivo validation of immunological efficacy and optimization of the recombinant strain’s expression systems, will be essential for establishing this approach as an effective sanitary control tool in frog farming.
CONCLUSION
This study represents a significant advancement in the research on ranavirosis, standing out for the unprecedented construction of the recombinant strain pDGCMCP derived from a Brazilian isolate of Ranavirus, FV3-like. This construction was achieved using the plasmid pDG1662, which was transformed into Bacillus subtilis, resulting in a recombinant strain with promising characteristics. The obtained strain shows high potential for application in the development of an oral vaccine against ranavirosis, offering an innovative and effective approach for controlling these infections, particularly in aquaculture environments. These results pave the way for future in vivo efficacy studies and the development of sustainable and accessible vaccination strategies.
-
Funding:
This research received no external funding.
-
Institutional Review Board Statement: The study was conducted in accordance with the Declaration of Helsinki, and approved by the Institutional Review Board (or Ethics Committee) of Faculty of Animal Science and Food Engineering, University of São Paulo (protocol code 5639050221 and date of approval 08/03/2022).
-
Informed Consent Statement:
Not applicable.
Acknowledgments:
To the Coordination for the Improvement of Higher Education Personnel - Brazil (CAPES) and to the Bacillus Genetic Stock Center (BGCS) for the donation of Bacillus subtilis strains.
Use of Generative Artificial Intelligence
The authors declare that large language models and other generative artificial intelligence (AI) or AI-assisted technologies cannot be credited as authors and have not been listed as authors of this paper.
The authors declare that no generative artificial intelligence (AI) or AI-assisted technologies were used to generate or modify the scientific content of this manuscript, including the conception of the study, data collection, data analysis, interpretation of results, or creation of original text, figures, tables or graphical abstracts, apart from routine tools for spelling, grammar checking and reference management that do not create original scholarly content.
Data Availability Statement:
Research data are available in the repository https://www.teses.usp.br/teses/disponiveis/74/74135/tde-29022024-092129/pt-br.php
REFERENCES
- 1 Brasil. Ministério da Pesca e Aquicultura. [Aquaculture Bulletin in Federal Waters]. Brasília: MPA; 2024.
- 2 Stéfani MV, Mansano CFM, Camargo ACS, Rodrigues AT, Pereira MM. [Production of Bullfrogs in Brazil]. São Paulo: Editora Ideias; 2023.
- 3 Daszak P, Berger L, Cunningham AA, Hyatt AD, Green DE, Speare R. Emerging infectious diseases and amphibian population declines. Emerg Infect Dis. 1999 Nov-Dec;5(6):735-48.
- 4 Hipólito M, Bach EE. Pathologies in American bullfrog (Rana catesbeiana Shaw, 1802): first review of Brazilian literature. Arq Inst Biol (São Paulo). 2002;69(2):113-20.
- 5 Schloegel LM, Ferreira CM, James T, Hipólito M, Longcore J, Hyatt A, et al. The North American Bullfrog (Rana catesbeiana) as a reservoir for the spread of Batrachochytrium dendrobatidis in Brazil. Anim Conserv. 2009;12(6):1-7.
- 6 Galli L, Pereira A, Marquez A, Mazzoni R. Ranavirus detection by PCR in cultured tadpoles (Rana catesbeiana, Shaw 1802) from South America. Aquaculture. 2006;257(1-4):78-82.
- 7 World Organisation for Animal Health (OIE). Infection with Ranavirus. In: Manual of Diagnostic Tests for Aquatic Animals. Paris: OIE; 2012. p. 1-21.
- 8 Ruggeri J, Ribeiro LP, Pontes MR, Toffolo C, Cândido M, Carreiro MM, et al. Discovery of wild amphibians infected with Ranavirus in Brazil. J Wildl Dis. 2019;55(3):e00000.
- 9 Paccez JD. [Application of genetically modified Bacillus subtilis strains in the development of mucosal vaccines against enteric pathogens]. [Dissertation, in Portuguese]. São Paulo: University of São Paulo, Institute of Biomedical Sciences; 2007.
- 10 Nayak SK. Multifaceted applications of probiotic Bacillus species in aquaculture with special reference to Bacillus subtilis Rev Aquac. 2020;12(1):1-20.
- 11 Nicholson WL, Munakata N, Horneck G, Melosh HJ, Setlow P. Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiol Mol Biol Rev. 2000;64(3):548-72.
- 12 Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1989.
- 13 Machado BF, Chirotto Filho LR. [Genetic Manipulation: Applications of Gene Therapy Techniques]. Foco: Cad Est Pesqui. 2018;(14):1-12.
- 14 Kim J, Schumann W. Display of proteins on Bacillus subtilis endospores. Cell Mol Life Sci. 2009;66(19):3127-36.
- 15 Ning D, Leng X, Li Q, Xu W. Surface-displayed VP28 on Bacillus subtilis spores induces protection against white spot syndrome virus in crayfish by oral administration. J Appl Microbiol. 2011;111(6):1327-36.
- 16 Du LH, Hong HA, Cutting SM. Germination of the spore in the gastrointestinal tract provides a novel route for heterologous antigen delivery. Vaccine. 2003;21(27-30):4215-24.
- 17 Wang Q, Liang X, Ning Y, Liu S, Liang Z, Zhang Z, et al. Surface display of major capsid protein on Bacillus subtilis spores against largemouth bass virus (LMBV) for oral administration. Fish Shellfish Immunol. 2023;135:1-10.
- 18 Zhang M, Chen XY, Xue M, Jiang N, Li Y, Yuding F, et al. Oral vaccination of largemouth bass (Micropterus salmoides) against largemouth bass ranavirus (LMBV) using yeast surface display technology. Animals (Basel). 2023;13(3):1-12
-
Editor-in-Chief:
Paulo Vitor Farago
-
Associate Editor:
Jaiesa Zych Nadolny








