LncRNA GSEC impedes the reprogramming of glucose metabolism in papillary thyroid carcinoma by inhibiting the IGF2BP2/GLUT1 axis

Abstract

Objective:  To investigate the expression pattern of lncRNA GSEC in papillary thyroid carcinoma (PTC) and elucidate its functional role and molecular mechanism in regulating glycolytic metabolism and malignant progression.

Materials and methods:  The expression levels of the GSEC gene in thyroid cancer were determined through bioinformatics analysis of the TCGA database, and potential downstream regulatory genes were predicted. GSEC mRNA levels in normal thyroid cells and thyroid cancer cells were detected by qRT-PCR. Cellular functions, including proliferation, invasion, and migration, were evaluated using CCK-8 assays, Annexin-V/PI staining, western blot, EdU staining, Transwell assays, and scratch tests. Glycolytic activity was assessed by western blot, glucose uptake assays, and measurements of extracellular lactate levels. Subcutaneous and metastatic papillary thyroid carcinoma (PTC) models were established in nude mice to investigate the effects of lncRNA GSEC expression on tumor growth and metastasis.

Results:  LncRNA GSEC expression was significantly downregulated in thyroid cancer. Overexpression of GSEC in PTC-1 cells effectively inhibited their proliferation, invasion, and migration. GSEC downregulated GLUT1 expression by inhibiting IGF2BP2, thereby disrupting glycolysis and suppressing tumor growth and invasion. In vivo assay demonstrated that GSEC overexpression significantly reduced tumor glycolysis, retarded tumor growth, and inhibited metastasis.

Conclusion:  LncRNA GSEC is a key factor in the progression of PTC. By modulating the IGF2BP2/GLUT1 axis, GSEC affects cancer cell glycolysis, presenting a new potential target for metabolic intervention strategies.

Keywords:
GLUT1; IGF2BP2; glucose metabolism; lncRNA GSEC; PTC

INTRODUCTION

The incidence of thyroid cancer, the most common endocrine malignancy, is sharply increasing worldwide (¹,²). Papillary thyroid carcinoma (PTC) is the most frequent subtype, accounting for nearly 80% of all thyroid cancer cases (³). Typically, PTC is viewed as a relatively indolent malignancy. Standard treatments include thyroidectomy, radioactive iodine ablation, and thyroid-stimulating hormone (TSH) suppression therapy. These approaches generally yield a 10-year survival rate exceeding 95% (⁴). However, clinical data reveal that 5-20% of patients may still experience recurrence or develop local or distant metastases posttreatment. This recurrence rate significantly complicates the challenge of achieving a complete cure for PTC (⁵). Thus, determining the underlying mechanisms that drive PTC progression is crucial for enhancing clinical outcomes and improving patient prognosis.

Cancer cells often rewire their metabolism to support rapid growth and spread. Even when oxygen is abundant, these cells tend to break down glucose through a process called aerobic glycolysis, which is known as the “Warburg effect” (⁶). This unusual metabolic strategy not only fuels the rapid division of cells but also helps them invade surrounding tissues and migrate to distant sites. By altering cellular signaling pathways and the tumor microenvironment, this metabolic shift ultimately drives cancer progression (⁷). In PTC cells, the upregulation of key glycolytic enzymes, including PKM2, and glucose transporters, such as GLUT1 and GLUT3, suggests robust glycolytic metabolism (⁸). This metabolic shift is likely driven by the overexpression of hypoxia-inducible factor 1α (HIF-1α), which promotes glycolytic activity and supports the manifestation of the Warburg effect in PTC (⁹). However, despite indications of unusually active glycolytic metabolism in PTC, the regulatory mechanisms at work remain unclear.

Long noncoding RNAs (lncRNAs) are RNA molecules with transcripts of approximately 200 base pairs that do not encode proteins; they can regulate gene expression at multiple levels and are closely related to the development, metastasis, and prognosis of many cancers (¹⁰,¹¹). Hence, lncRNAs have become a popular research topic in the field of cancer in recent years. Among the vast array of lncRNAs, GSEC has emerged as a molecule of significant interest. GSEC features a distinctive G-quadruplex structure that enables it to modulate gene expression and cellular functions through interactions with proteins or other RNA molecules (¹²-¹⁴). GSEC, an lncRNA, interacts with the RNA helicase DHX36 to influence cancer cell migration and invasion (¹³); it also upregulates PFKFB3, increasing glycolytic metabolism in sepsis and driving the activation of inflammation in neutrophils (¹⁵). These results highlight the potential regulatory function of GSEC in glycolysis. Research on the role of lncRNA GSEC in PTC is rather scarce, and how GSEC affects the development of PTC and whether it is involved in the regulation of glycolytic metabolism in PTC have not yet been determined.

Motivated by the gaps in knowledge regarding lncRNA GSEC, our research focused on its actions within the context of PTC and its effects on glycolytic processes. Our experiments demonstrated that GSEC levels are notably lower in PTC tissues. Upon overexpression of GSEC in PTC cells, we observed a significant decrease in the activity of the IGF2BP2/GLUT1 axis, which in turn halted glycolytic reprogramming and the malignant trajectory of cancer. In summary, our study not only highlights GSEC as a key player in PTC progression but also reveals its molecular links to cancer cell glycolysis, paving the way for the development of GSEC-targeted metabolic interventions for PTC.

MATERIALS AND METHODS

Sample collection

A total of 5 pairs of PTC tissue samples and adjacent noncancerous tissue samples were collected for this study. All the samples were obtained from The Affiliated Yixing Hospital of Jiangsu University between 2024.12 and 2025.5. The sample collection process strictly adhered to the guidelines of the hospital’s Ethics Committee, and informed consent was obtained from all patients. The inclusion criteria were as follows: patients pathologically diagnosed with PTC; patients aged between 18 and 80 years; patients with no history of other malignant tumors; and patients who had not undergone radiotherapy or chemotherapy prior to surgery. Adjacent noncancerous tissues were collected from sites >0.8 cm away from the tumor edge. All surgically resected PTC tissues and adjacent tissue samples were processed within 30 minutes after collection. Samples intended for western blot analysis were immediately frozen in liquid nitrogen and subsequently transferred to a -80 °C freezer for long-term storage. Samples for IHC (immunohistochemistry) were fixed in 4% paraformaldehyde (PFA) and stored at 4 °C.

Bioinformatics

We retrieved transcriptomic data for thyroid cancer (THCA) and normal thyroid tissues from the TCGA (https://portal.gdc.cancer.gov/) and GTEx (https://www.gtexportal.org) databases, which included 425 normal and 513 cancer samples. Differential expression analysis was executed using the “edgeR” package, with |logFC| > 1.5 and padj < 0.05 as the thresholds to detect differentially expressed mRNAs. The target gene GSEC was identified through an exhaustive literature review. The potential target genes of lncRNA GSEC were predicted using the starBase website. Pearson correlation analysis was subsequently used to evaluate the correlation between lncRNA GSEC and IGF2BP2 expression.

Cell culture

The normal human thyroid cell line Nthy-ori 3-1 (CL-0817) and the thyroid cancer cell lines HTh-7 (CL-0647), KTC-1 (CL-0649), and TPC-1 (CL-0643) were obtained from Procell Bio Co., Ltd. (China). The human thyroid squamous cell carcinoma cell line SW579 (SNL-451) was purchased from SUNNBIO (China). Nthy-ori 3-1 and KTC-1 cells were cultured in complete RPMI-1640 medium supplemented with 10% FBS and 1% penicillin/streptomycin (P/S). HTh-7 and TPC-1 cells were cultured in complete DMEM supplemented with 10% FBS and 1% P/S. SW579 cells were cultured in Leibovitz’s L-15 medium supplemented with 10% FBS and 1% P/S. Nthy-ori 3-1, HTh-7, KTC-1, and TPC-1 cells were cultured at 37 °C with 5% CO₂, while SW579 cells were cultured at 37 °C in 100% air.

Cell transfection

The pcDNA3.1 empty vector (Vector), pcDNA3.1-GSEC expression plasmid (LncRNA GSEC-OE), pcDNA3.1-IGF2BP2 expression plasmid (IGF2BP2-OE), pLKO.1-Puro empty vector (sh-NC), and pLKO.1-GLUT1 knockdown plasmid (sh-GLUT1) were designed and synthesized by GenePharma (China). In accordance with the manufacturer’s instructions, these plasmids were transfected into TPC-1 cells using Lipofectamine 2000 (Invitrogen, USA). After 48 hours of transfection, the culture medium was replaced with complete medium supplemented with 800 μg/mL G418 (overexpression group) or 1.5 μg/mL puromycin (knockdown group), and the medium was changed every 3 days. The screening was continued for 14 days until individual clones were visible. We selected individual clones for expansion culture and maintained the concentration at half (400 μg/mL G418 or 0.5 μg/mL puromycin). After wtable expression was verified by qRT-PCR and western blot analysis, the cells were used for subsequent experiments (passages ≤ 15 generations).

RNA extraction and qRT-PCR

To isolate total RNA from tissue samples and cultured cells, we used Ribozol RNA extraction reagent (Thomas Scientific, USA). For the reverse transcription step, a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA) was used. qRT-PCR was subsequently performed using SYBR Green PCR Master Mix (Applied Biosystems) on an Applied Biosystems real-time PCR system. β-Actin was selected as the reference gene, and the relative expression levels of the target genes were determined using the 2^-∆∆Ct method. The primers used are detailed in Table 1.

Table 1
Primer sequence

Gene	Sequence (5’-3’)
β-actin	Forward: GGCTGTATTCCCCTCCATCG
	Reverse: CCAGTTGGTAACAATGCCATGT
GSEC	Forward: CCCACCCTGCTCACCTAAAC
	Reverse: TTCAATTTGAGGCCCCAGGA
GLUT1	Forward: GGCCAAGAGTGTGCTAAAGAA
	Reverse: ACAGCGTTGATGCCAGACAG
IGF2BP2	Forward: AGTGGAATTGCATGGGAAAATCA
	Reverse: CAACGGCGGTTTCTGTGTC

CCK-8 assay

Cell viability was assessed using a CCK-8 kit (Dojindo, Japan). We seeded approximately 1×10⁴ TPC-1 cells into each well of a 96-well plate. To track cell proliferation, we added 100 μL of a 10% CCK-8 solution to the cells at 0, 24, and 48 hours and incubated them for 3 hours. We then measured the absorbance at 450 nm using a Power Wave XS microplate reader (Bio-Tek, USA).

Apoptosis analysis

Transfected TPC-1 cells were plated in 6-well plates at a density of 1×10⁶ cells per well and cultured for 48 hours at 37 °C. Apoptosis was assessed using an Annexin V-FITC/PI kit (Yeasen, China). The cells were resuspended in 100 μL of 1× binding buffer after the supernatant was removed. Afterward, 5 μL of Annexin V-FITC and 10 μL of PI were added, mixed gently, and incubated in the dark at room temperature for 10-15 minutes. Finally, 400 μL of 1× binding buffer was added, and the cells were analyzed using a BD Calibur flow cytometer.

Western blot analysis

We extracted total protein from tissue samples and cultured cells using a RIPA Lysis Buffer Kit (Santa Cruz, USA). The proteins were separated by SDS-PAGE and transferred to PVDF membranes. The membranes were incubated with primary antibodies overnight at 4 °C. The primary antibodies used were anti-Bcl-2 (Abcam; ab182858), anti-Bax (Abcam; ab32502), anti-cleaved caspase3 (Abcam; ab32042), anti-MMP2 (Abcam; ab92536), anti-MMP9 (Abcam; ab76003), anti-GLUT1 (Abcam; ab115730), anti-hexokinase II (Abcam; ab209847), anti-PKM2 (Thermo Fisher; PA5-28700), anti-IGF2BP2 (Abcam; ab124930), and anti-β-actin (Abcam; ab8226). The membranes were then incubated with an HRP-conjugated secondary antibody (Abcam; ab205718) for 2 hours at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) kit (Takara, Japan), and protein expression was quantified using Quantity One software.

EdU staining

Cell proliferation was assessed using an EdU Proliferation Kit (Abcam; ab19801). Transfected TPC-1 cells were seeded into 96-well plates at 1×10⁴ cells per well and cultured for 48 hours at 37 °C. The EdU reaction mixture provided in the kit was added to the cells, which were then incubated in the dark for 30 minutes. Excess dye was removed by washing with PBS, and cell proliferation was detected using a flow cytometer (BD Calibur, USA).

Cell migration assay

TPC-1 cells were plated in 48-well plates and grown to confluence. Sterile 200 μL pipette tips were used to introduce scratches into the monolayer. The wells were then washed with PBS to clear away cell debris. The cells were then maintained in serum-free or low-serum medium at 37 °C. The scratch areas were imaged at 0 and 48 hours using a microscope. The scratch width and healing area were measured using ImageJ software.

Transwell assay

Following starvation, the transfected TPC-1 cells were adjusted to an appropriate density and seeded into the upper chamber of Transwell inserts coated with Matrigel. The lower chamber contained a chemoattractant. After 48 hours of culture, the cells were fixed with 4% paraformaldehyde (PFA) for 30 minutes and stained with crystal violet for 10 minutes. The cells were subsequently washed 2-3 times with PBS. The number of cells that migrated to the lower side of the membrane was determined by counting the cells in 3-5 random fields under a microscope.

Glucose uptake determination

TPC-1 cells subjected to various transfection strategies were incubated with 100 μM 2NBDG (APExBIO, USA) at 37 °C for 30 minutes to assess glucose uptake. After incubation, the cells were centrifuged at 1000 rpm for 5 minutes, and excess 2NBDG was removed by washing with PBS. Glucose uptake was then analyzed using a flow cytometer (BD Calibur, USA).

Lactate concentration assessment

To determine the lactate levels in the supernatant of the transfected TPC-1 cells, we used a Lactate Assay Kit (Beyotime, China). We collected the supernatant and added 50 μL to each well of a 96-well plate. We then added 50 µL of WST-8 colorimetric working solution to each well, mixed well, and incubated the plate at 37 °C in the dark for 30 minutes. After incubation, we measured the absorbance at 450 nm and calculated the lactate concentration based on a standard curve.

In vivo assay

We obtained 12 male BALB/c nude mice (5-6 weeks old) from GemPharmatech (China) and acclimated them for two weeks under standard conditions (12-hour light/dark cycle; 55% relative humidity). Human PTC cells, transfected with either a control vector or lncRNA GSEC-OE, were injected subcutaneously into the flanks of the mice at a dose of 2 × 10⁷ cells per mouse to create a PTC xenograft model. The tumor volumes were measured every five days, and the mice were sacrificed after 20 days. The tumors were then excised, weighed, photographed, and fixed in 4% paraformaldehyde for histological analysis. For the metastasis model, luciferase-labeled PTC cells were injected into the tail veins of mice, and their in vivo growth and metastasis were tracked using a small-animal in vivo imaging system at designated time points.

Histological analysis

Patient samples or tumor tissues collected from tumor-bearing mice were fixed in 4% PFA for 24 hours, embedded in paraffin and cut into 5 μm sections. Hematoxylin and eosin (H&E) staining and TUNEL staining were conducted to explore pathological changes and proliferation in the tumors. IHC staining was performed to detect the expression of anti-cleaved caspase3 (Abcam; ab32042) and anti-IGF2BP2 (Abcam; ab124930) in the tumor tissue.

Statistical analysis

All experiments were conducted in triplicate to ensure reliability. The results are presented as the mean ± standard deviation (SD). Statistical analyses were performed using SPSS v.19.0 software (IBM, USA). Student’s t test was used to compare two groups, while one-way ANOVA was used for comparisons among multiple groups. Pearson correlation analysis was performed to evaluate the correlation between GSEC and IGF2BP2 expression levels. Significance was defined as P < 0.05 (*) or P < 0.01 (**).

RESULTS

Reduced expression of lncRNA GSEC in thyroid cancer

We initiated our research by leveraging bioinformatics tools to examine lncRNA GSEC expression in thyroid cancer. Compared with that in normal thyroid tissues, GSEC expression in thyroid cancer tissues was reduced (P<2.22e-16) (Figure 1A). Subsequent analysis of GSEC expression in normal human thyroid cells (Nthy-ori 3-1) and diverse thyroid cancer cell lines (HTh-7, KTC-1, TPC-1, and SW579) revealed a marked disparity. The percentage of GSEC was notably greater in Nthy-ori 3-1 cells but markedly lower in the cancer cell lines (Figure 1B). These results indicate that GSEC expression is generally downregulated in thyroid cancer cells. In this study, we focused on further investigating the potential role of lncRNA GSEC in TPC-1 cells.

Figure 1
Reduced expression of LncRNA GSEC in thyroid cancer. (A) Expression levels of LncRNA GSEC in thyroid cancer obtained from the TCGA database; (B) qRT-PCR was performed to detect LncRNA GSEC expression in human normal thyroid cells (Nthy-ori 3-1) and human thyroid cancer cell lines (HTh-7, KTC-1, SW579, and TPC-1). *P < 0.05; **P < 0.01.

Overexpression of lncRNA GSEC inhibits PTC progression

To elucidate the impact of GSEC on PTC progression, we overexpressed the GSEC gene in TPC-1 cells and successfully established a cell line with high GSEC expression, designated lncRNA GSEC-OE (Figure 2A). We first examined the effect of GSEC expression on the viability of TPC-1 cells. The results of the CCK-8 assay (Figure 2B) revealed that after the culture period exceeded 24 hours, the viability of TPC-1 cells overexpressing GSEC was significantly lower than that of the control and empty vector (Vector) groups. Additionally, apoptosis assays (Figures 2C-D) revealed that the apoptosis rate of TPC-1 cells increased significantly upon overexpression of GSEC, exceeding 10%. After GSEC was overexpressed, western blot analysis revealed a significant decrease in the expression of the antiapoptotic protein Bcl-2, along with a marked increase in the expression of the proapoptotic proteins Bax and cleaved caspase3 (Figure 2E). This shift in protein expression suggests that GSEC overexpression can trigger apoptosis. To further assess cell proliferation, we used EdU staining and flow cytometry. The results revealed that the percentage of EdU-positive cells was significantly lower in the lncRNA GSEC-OE group than in the control and vector groups (Figures 2F-G), indicating that GSEC overexpression inhibited cell proliferation. We also investigated the invasive and migratory capabilities of the cells. Using Transwell assays and western blot analysis, we observed that the invasive potential of cells with elevated GSEC expression substantially decreased (Figures 2H-I). This reduction was accompanied by a notable decrease in the expression of matrix metalloproteinase 2 (MMP2) and matrix metalloproteinase 9 (MMP9) (Figure 2J). Furthermore, wound-healing assays revealed that the migration rate of the lncRNA GSEC-OE group was only approximately 20% at 48 hours, whereas that of the control and vector groups was nearly 70% (Figures 2K-L). These results highlight the inhibitory effect of GSEC overexpression on cell invasion and migration.

Figure 2
Overexpression of LncRNA GSEC inhibits PTC progression. (A) qRT-PCR analysis showed increased LncRNA GSEC mRNA levels in TPC-1 cells transfected with LncRNA GSEC-OE; (B) CCK-8 assay revealed decreased cell viability in TPC-1 cells at different time points; (C-D) Annexin-V/PI staining showed increased apoptosis levels in TPC-1 cells transfected with LncRNA GSEC-OE; (E) WB analysis showed changes in Bcl-2, Bax, and Cleaved caspase-3 protein levels in TPC-1 cells; (F-G) EdU staining revealed reduced proliferation in TPC-1 cells; (H-I) Transwell assay showed decreased invasion ability in TPC-1 cells; (J) WB analysis showed changes in MMP2 and MMP9 protein levels in TPC-1 cells; (K-L) Wound healing assay showed reduced migration ability in TPC-1 cells; (M) qRT-PCR analysis showed changes in GLUT1 expression in TPC-1 cells transfected with LncRNA GSEC-OE; (N) WB analysis showed changes in GLUT1, HK, and PKM2 protein levels in TPC-1 cells; (O-P) Flow cytometry showed changes in glucose uptake ability in TPC-1 cells.; (Q) Lactate levels in the supernatant of TPC-1 cells were measured. *P < 0.05; **P < 0.01.

Given that metabolic reprogramming is a hallmark of cancer progression, we explored how GSEC expression affects glycolysis. Our qRT-PCR analysis revealed that overexpressing GSEC significantly reduced GLUT1 mRNA levels (Figure 2M). Western blot analysis further revealed that the protein levels of GLUT1, HK2, and PKM2 were notably lower in GSEC-overexpressing cells than in control and vector-transfected cells (Figure 2N). These proteins are pivotal for glycolysis, and their reduced expression suggests that GSEC overexpression may disrupt the glycolytic pathway in cancer cells. The overexpression of GSEC notably affected cancer cell metabolism. Specifically, flow cytometry using 2-NBDG revealed a significant reduction in glucose uptake by cancer cells (Figures 2O-P). This metabolic shift was further evidenced by a marked decrease in lactate production in the cell supernatant (Figure 2Q). Collectively, these results indicate that GSEC likely influences cancer progression by affecting glycolysis.

Overexpression of lncRNA GSEC downregulates IGF2BP2 expression

To elucidate the molecular underpinnings of how lncRNA GSEC affects cancer progression, we used the starBase platform to pinpoint IGF2BP2 as a likely target regulated by GSEC (Figure 3A). Further scrutiny via the GEPIA database revealed a pronounced negative correlation between GSEC and IGF2BP2 expression in PTC (P value = 5.4e-08; R = -0.24) (Figure 3B). Western blot analysis of 5 paired PTC samples and their adjacent nontumor tissues revealed significantly elevated expression of IGF2BP2 in tumor tissues (Figure 3C). We subsequently performed IHC staining on 5 pairs of samples and detected abnormal upregulation of IGF2BP2 in cancer tissues (Figure 3D). To corroborate this finding at the cellular level, we overexpressed GSEC and observed a substantial decrease in both the mRNA and protein levels of IGF2BP2 (Figures 3E-F). Collectively, these data suggest that the effects of lncRNA GSEC may involve targeting and suppressing IGF2BP2 expression.

Figure 3
Overexpression of LncRNA GSEC downregulates IGF2BP2 expression. (A) Predicted target genes of LncRNA GSEC identified via Starbase; (B) Correlation analysis between LncRNA GSEC and IGF2BP2 expression; (C-D) WB and IHC staining examined IGF2BP2 expression in tumor tissues and paired adjacent non-tumor tissues; (E-F) qRT-PCR and WB analysis revealed decreased IGF2BP2 mRNA and protein levels in TPC-1 cells overexpressing GSEC. **P < 0.01.

IGF2BP2 drives cancer progression via GLUT1 upregulation

IGF2BP2 can increase GLUT1 expression by stabilizing its mRNA (¹⁶). Based on this mechanism, we hypothesized that lncRNA GSEC might influence glycolytic levels through an IGF2BP2-mediated GLUT1 regulatory mechanism. To investigate whether IGF2BP2 regulates GLUT1 expression in PTC, we established IGF2BP2 overexpression and knockdown models in TPC-1 cells combined with intervention with the GLUT1 inhibitor BAY-876. Western blot results (Figure 4A) revealed that IGF2BP2 overexpression significantly upregulated GLUT1 protein levels, whereas GLUT1 knockdown in the context of IGF2BP2 overexpression markedly reduced its expression, suggesting that IGF2BP2 positively regulates GLUT1. Further functional assays demonstrated that IGF2BP2 overexpression significantly increased cell viability, whereas GLUT1 knockdown or BAY-876 treatment reversed this effect (Figure 4B), indicating that IGF2BP2 critically influences cancer cell activity via GLUT1 regulation. In the migration and invasion assays, the Transwell results (Figures 4C and D) revealed that compared with control cells, oe-IGF2BP2 cells exhibited significantly increased invasive capacity. However, GLUT1 knockdown or BAY-876 treatment substantially suppressed this pro-invasive effect in oe-IGF2BP2 cells. A similar trend was observed in the wound-healing assay (Figure 4E), where IGF2BP2 promoted cell migration, whereas GLUT1 knockdown or inhibition significantly attenuated this effect. In summary, these findings demonstrate that IGF2BP2 enhances the proliferation, migration, and invasion of TPC-1 cells by upregulating GLUT1 expression, suggesting that the IGF2BP2/GLUT1 axis plays a critical role in PTC progression.

Figure 4
IGF2BP2 promotes cancer progression by upregulating GLUT1 expression. (A) WB analysis of GLUT1 protein expression in treated cells; (B) CCK-8 assay measuring cell viability of TPC-1 cells under different treatments; (C, D) Transwell assay evaluating cell invasive capability; (E) Wound-healing assay assessing cell migratory ability. *P < 0.05; **P < 0.01.

LncRNA GSEC regulates cancer cell glucose uptake via IGF2BP2

Having established that lncRNA GSEC upregulates IGF2BP2 expression and that IGF2BP2 promotes cancer progression through GLUT1, we further investigated whether GSEC exerts its regulatory effects on glycolytic metabolism and malignant phenotypes in an IGF2BP2-dependent manner. We established four cellular models-vector1, lncRNA GSEC-OE, lncRNA GSEC-OE+vector2, and lncRNA GSEC-OE+IGFB2BP2-OE-and measured the expression levels of relevant genes using qRT-PCR (Figures 5A-C). We found that GSEC overexpression significantly reduced the expression of IGFB2BP2 and GLUT1. However, when we transfected these cells with IGFB2BP2-OE, the expression of both IGFB2BP2 and GLUT1 was significantly restored (Figures 5B-C). This trend was also confirmed at the protein level. Western blot analysis revealed that the protein levels of HK2 and PKM2, as well as those of IGF2BP2 and GLUT1, were restored after IGF2BP2-OE reconstitution (Figure 5D). Systemic lactate production and glucose uptake were enhanced following IGF2BP2-OE transfection (Figures 5E-F). These results suggest that lncRNA GSEC inhibits glycolysis by downregulating the expression of IGF2BP2.

Figure 5
LncRNA GSEC regulates cancer cell glucose uptake via IGF2BP2. (A-C) qRT-PCR analysis of mRNA levels of GSEC, IGF2BP2, and GLUT1 in TPC-1 cells; (D) WB analysis of protein expression levels of IGF2BP2, GLUT1, HK, and PKM2 in TPC-1 cells; (E) Lactate levels in the supernatant of TPC-1 cells; (F) Glucose uptake in TPC-1 cells assessed by flow cytometry; (G) Cell viability of TPC-1 cells at different time points assessed by CCK-8 assay; (H) Apoptosis levels in TPC-1 cells assessed by Annexin-V/PI staining; (I) WB analysis of Bcl-2, Bax, and Cleaved caspase-3 protein levels in TPC-1 cells; (J) Proliferation of TPC-1 cells assessed by EdU staining; (K) Invasion ability of TPC-1 cells assessed by Transwell assay; (L) WB analysis of MMP2 and MMP9 protein levels in TPC-1 cells; (M) Migration ability of TPC-1 cells assessed by wound healing assay. *P < 0.05; **P < 0.01.

We evaluated the malignancy of cancer cells by examining their proliferation, invasion, and metastasis capabilities. The results of the CCK-8 assay revealed that compared with the lncRNA GSEC-OE + IGFB2BP2-OE group, the lncRNA GSEC-OE group had significantly lower cell viability. These findings suggest that GSEC expression inhibits cell proliferation, whereas IGFB2BP2 expression can counteract this effect (Figure 5G). The results of apoptosis assays further revealed that IGFB2BP2 expression weakened GSEC-induced apoptosis (Figures 5H-I). These findings highlight the potential therapeutic implications of targeting GSEC and IGFB2BP2 in cancer treatment. EdU staining also revealed a similar trend, with the proliferation rate of cells in the lncRNA GSEC-OE group being significantly lower than that in the lncRNA GSEC-OE + IGFB2BP2-OE group (Figure 5J). Consistent with these findings, invasion assays (Figures 5K-L) and wound-healing experiments (Figure 5M) revealed that the invasive and migratory abilities of the lncRNA GSEC-OE + IGFB2BP2-OE cells were significantly enhanced. These results collectively suggest that lncRNA GSEC can inhibit cancer progression by downregulating the expression of IGFB2BP2, thereby affecting glycolysis in cancer cells.

Overexpression of lncRNA GSEC suppresses PTC progression in nude mice

To assess the in vivo effects of GSEC on cancer progression, we established a mouse PTC xenograft model. Nude mice were randomly assigned to one of two groups, and TPC-1 cells transfected with either vector or lncRNA GSEC-OE were injected subcutaneously into their right flanks. Tumor growth was closely monitored throughout the experiment. As shown in Figures 6A-D, tumors in the control group grew rapidly and were significantly larger, whereas those in the lncRNA GSEC-OE group grew more slowly and were smaller at the end of the experiment. H&E staining of tumor tissues revealed that while the tumor architecture was intact in the vector group, the tumor architecture was noticeably necrotic in the lncRNA GSEC-OE group (Figure 6E). These findings were corroborated by TUNEL staining, which revealed a higher incidence of apoptosis in the lncRNA GSEC-OE group (Figure 6E), suggesting that GSEC overexpression effectively inhibits PTC growth. Furthermore, GSEC mRNA expression was significantly upregulated in the lncRNA GSEC-OE group, verifying the successful overexpression of GSEC (Figure 6F). Moreover, the downregulation of IGF2BP2, GLUT1, HK2, and PKM2 expression in the lncRNA GSEC-OE group indicated that GSEC overexpression suppressed glycolysis in cancer cells (Figures 6G-I). To assess the impact of GSEC expression on cancer metastasis, we established an in vivo PTC metastasis model by intravenously injecting luciferase-labeled TPC-1 cells into mice. Live imaging revealed that the vector group exhibited robust lung metastasis, whereas the lncRNA GSEC group showed significantly reduced metastatic activity, as evidenced by lower avg counts (Figures 6J and K). These results indicate that GSEC overexpression can effectively diminish the metastatic potential of tumor cells in vivo.

Figure 6
Overexpression of LncRNA GSEC suppresses TPC progression in nude mice. (A) Changes in tumor volume in mice during treatment; (B) Representative images of tumors excised from mice; (C-D) Tumor volume (C) and weight (D) at the end of treatment; (E) Histological staining of tumor tissues with H&E, TUNEL, and Cleaved caspase-3; (F-H) qRT-PCR analysis revealed mRNA expression levels of LncRNA GSEC, IGF2BP2, and GLUT1 in tumor tissues; (I) WB analysis showed protein levels of IGF2BP2, GLUT1, HK2, and PKM2 in tumor tissues; (J-K) Representative bioluminescent images (J) and quantitative analysis of lung metastasis (K) in mice. *P < 0.05; **P < 0.01.

DISCUSSION

In our study, we initially noted a pronounced downregulation of lncRNA GSEC in PTC. We found that GSEC expression can curb cancer cell progression and glycolysis. Using starBase, we identified IGF2BP2 as a downstream target of GSEC. Our data show that GSEC could impede glycolytic reprogramming and malignant progression in cancer cells by inhibiting the IGF2BP2/GLUT1 axis. Our findings underscore the pivotal role of lncRNA GSEC in PTC progression and shed new light on the metabolic regulatory mechanisms in PTC.

LncRNA GSEC, also known as DCPS-AS1 or ST3GAL4-AS1, is a long noncoding RNA containing a G-quadruplex structure that was first identified by Matsumura and cols. (¹³) in colon cancer. Previous studies have shown that GSEC is highly expressed in various types of tumors, such as colon cancer and lung adenocarcinoma, and can participate in tumor occurrence and progression through multiple molecular mechanisms (¹²,¹³). Among them, GSEC can regulate the availability of miRNAs through a competitive endogenous RNA (ceRNA) mechanism, thereby affecting the expression and function of downstream target genes (¹⁴). For example, in triple-negative breast cancer (TNBC), GSEC upregulates the expression of AXL by adsorbing miR-202-5p, thereby promoting the proliferation, migration, and invasion of tumor cells (¹⁷). In addition, increasing evidence suggests that GSEC is involved in regulating cellular metabolic reprogramming. For example, in sepsis models, GSECs can promote inflammatory activation in neutrophils by regulating PFKFB3-mediated glycolytic metabolism (¹⁵). The results of this study suggest that GSEC-regulated glycolysis may be an important mechanism involved in disease progression. Notably, the above studies generally support the role of GSEC in promoting cancer or pathological progression in most diseases or tumors. However, an increasing number of studies have shown that the biological functions of lncRNAs often exhibit significant tissue specificity and tumor microenvironment dependence and that the same lncRNA may play vastly different regulatory roles in different tumor types (¹⁸). For example, the sialyltransferase ST3GAL4 can promote tumor progression by enhancing aerobic glycolysis (¹⁹). As the antisense transcript of ST3GAL4, lncRNA GSEC may interfere with the translation process of ST3GAL4 by forming a double-stranded RNA structure with its sense transcript (²⁰-²²), thereby inhibiting the activation effects of sialylation-related glucose metabolism. In this study, we observed a significantly low expression level of GSEC in PTC, and its overexpression significantly inhibited the proliferation, invasion, and migration abilities of cancer cells. Further mechanistic studies have shown that GSEC can weaken the glucose metabolism process in cancer cells by inhibiting the expression of IGF2BP2 and downregulating GLUT1 levels. These results indicate that the role of GSEC in PTC differs from its reported procancer function in other tumors, but that it exerts an anticancer effect by inhibiting the IGF2BP2/GLUT1 axis. This study not only reveals the unique biological function of GSEC in PTC but also provides a new perspective for understanding its functional differences in different tumor types and provides a potential molecular basis for metabolic targeted therapy for PTC.

IGF2BP2, an RNA-binding protein, is involved in multiple cellular processes (²³). It binds to and stabilizes various mRNAs, thereby influencing gene expression at the posttranscriptional level and affecting essential cellular functions such as proliferation, differentiation, and metabolism (²⁴). While IGF2BP2 is crucial for maintaining cellular homeostasis under normal conditions, its overexpression in cancer can drive tumor progression and malignancy. IGF2BP2 is often upregulated in various cancers and functions as an oncogene (²⁵,²⁶). In head and neck squamous cell carcinoma, it promotes tumor cell proliferation and growth through the miR-98-5p/PI3K/Akt signaling pathway. IGF2BP2 also appears to be a key regulator of glycolysis in cancer cells (²⁷). In pancreatic ductal adenocarcinoma, IGF2BP2 plays a significant role in enhancing cancer cell metabolism, as reported by Huang and cols. (¹⁶). Specifically, IGF2BP2 binds to GLUT1 mRNA and stabilizes it, leading to increased GLUT1 expression; this stabilization increases the degree of aerobic glycolysis in cells, which supplies them with the energy and metabolic precursors required for rapid proliferation; additionally, this mechanism alters the cellular metabolic microenvironment, driving tumor progression. A recent study by Wang and cols. (²⁸) has shed light on the role of IGF2BP2 in PTC. Their analysis of PTC transcriptome data from the TCGA revealed that IGF2BP2 is significantly overexpressed in PTC tissues and that its overexpression is strongly correlated with disease-free survival and clinical outcomes in PTC patients. These findings from the two studies suggest that IGF2BP2 may increase glycolysis in cancer cells, potentially fuelling PTC progression. Our investigation further illuminated this area. In terms of the role of lncRNA GSEC in PTC, we observed that GSEC expression could decrease IGF2BP2 levels. Its downregulation, in turn, destabilized GLUT1, ultimately curbing the glucose uptake of PTC cells. Our findings not only elucidate how IGF2BP2 is regulated in PTC but also paves the way for new cancer therapies targeting IGF2BP2.

In summary, our research revealed the critical role of lncRNA GSEC in the progression of PTC. Our findings show that the expression of GSEC is markedly downregulated in PTC. The overexpression of GSEC inhibits the IGF2BP2/GLUT1 axis, effectively blocking glycolytic reprogramming and the subsequent malignancy of cancer cells. This discovery offers a fresh perspective on metabolic regulation in PTC and points to a potential molecular target for treatment. However, this study has several limitations. First, although we have shown through functional experiments and molecular-level evidence that lncRNA GSEC can reduce glucose uptake and lactate production by inhibiting the IGF2BP2/GLUT1 axis, thereby inhibiting cancer cell glucose metabolism reprogramming, there is currently a lack of direct metabolic flow evidence for its regulation of anaerobic glycolysis, which still needs to be further validated through metabolomics or isotope tracing experiments. In addition, the specific molecular mechanism through which lncRNA GSEC inhibits IGF2BP2 expression, whether it plays a role through RNA-protein interactions, posttranscriptional regulation, or other indirect channels, remains to be further studied. Finally, as multifunctional regulatory molecules, lncRNAs often have a wide spectrum of target genes. Although this study focused on the key role of the IGF2BP2/GLUT1 axis in PTC glucose metabolism reprogramming, we did not systematically evaluate the regulatory effects of GSEC on other metabolic pathways, nor did we explore its functional differences across different PTC cell subtypes or tumor microenvironments. These are the research directions that we need to improve upon in the future.

Ethics approval and consent to participate: Experiments involving clinical samples were approved by the Medical Ethics Review Committee of The Affiliated Yixing Hospital of Jiangsu University, with the approval number 2025-111-02. Informed consent was obtained from all patients. Experiments involving animals were approved by the Lab of Animal Experimental Ethical Inspection of Dr. Can Biotechnology (Zhejiang) Co., Ltd., with the approval number: DRK20240226098.

Data availability:

datasets related to this article will be avail-able upon request to the corresponding author.

REFERENCES

• ¹ Haddad RI, Bischoff L, Ball D, Bernet V, Blomain E, Busaidy NL, et al. Thyroid Carcinoma, Version 2.2022, NCCN Clinical Practice Guidelines in Oncology. J Natl Compr Canc Netw. 2022 Aug;20(8):925-951. doi: 10.6004/jnccn.2022.0040.
  » https://doi.org/10.6004/jnccn.2022.0040.
• ² Filetti S, Durante C, Hartl D, Leboulleux S, Locati LD, Newbold K, Papotti MG, Berruti A; ESMO Guidelines Committee. Electronic address: [e-mail] Thyroid cancer: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up†. Ann Oncol. 2019 Dec 1;30(12):1856-1883. doi: 10.1093/annonc/mdz400.
  » https://doi.org/10.1093/annonc/mdz400.
• ³ Shi L, Duan R, Sun Z, Jia Q, Wu W, Wang F, et al. LncRNA GLTC targets LDHA for succinylation and enzymatic activity to promote progression and radioiodine resistance in papillary thyroid cancer. Cell Death Differ. 2023 Jun;30(6):1517-1532. doi: 10.1038/s41418-023-01157-6.
  » https://doi.org/10.1038/s41418-023-01157-6.
• ⁴ He Y, Lin L, Ou Y, Hu X, Xu C, Wang C. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer. Open Med (Wars). 2022 Aug 26;17(1):1376-1389. doi: 10.1515/med-2022-0529.
  » https://doi.org/10.1515/med-2022-0529.
• ⁵ He J, Tian Z, Yao X, Yao B, Liu Y, Yang J. A novel RNA sequencing-based risk score model to predict papillary thyroid carcinoma recurrence. Clin Exp Metastasis. 2020 Apr;37(2):257-267. doi: 10.1007/s10585-019-10011-4.
  » https://doi.org/10.1007/s10585-019-10011-4.
• ⁶ Warburg O, Wind F, Negelein E. THE METABOLISM OF TUMORS IN THE BODY. J Gen Physiol. 1927 Mar 7;8(6):519-30. doi: 10.1085/jgp.8.6.519.
  » https://doi.org/10.1085/jgp.8.6.519.
• ⁷ Li C, Zhang G, Zhao L, Ma Z, Chen H. Metabolic reprogramming in cancer cells: glycolysis, glutaminolysis, and Bcl-2 proteins as novel therapeutic targets for cancer. World J Surg Oncol. 2016 Jan 20;14(1):15. doi: 10.1186/s12957-016-0769-9.
  » https://doi.org/10.1186/s12957-016-0769-9.
• ⁸ Bao L, Xu T, Lu X, Huang P, Pan Z, Ge M. Metabolic Reprogramming of Thyroid Cancer Cells and Crosstalk in Their Microenvironment. Front Oncol. 2021 Dec 2;11:773028. doi: 10.3389/fonc.2021.773028.
  » https://doi.org/10.3389/fonc.2021.773028.
• ⁹ Ciavardelli D, Bellomo M, Consalvo A, Crescimanno C, Vella V. Metabolic Alterations of Thyroid Cancer as Potential Therapeutic Targets. Biomed Res Int. 2017;2017:2545031. doi: 10.1155/2017/2545031.
  » https://doi.org/10.1155/2017/2545031.
• ¹⁰ Anastasiadou E, Jacob LS, Slack FJ. Non-coding RNA networks in cancer. Nat Rev Cancer. 2018 Jan;18(1):5-18. doi: 10.1038/nrc.2017.99.
  » https://doi.org/10.1038/nrc.2017.99.
• ¹¹ Zhang Y. LncRNA-encoded peptides in cancer. J Hematol Oncol. 2024 Aug 12;17(1):66. doi: 10.1186/s13045-024-01591-0.
  » https://doi.org/10.1186/s13045-024-01591-0.
• ¹² Jiang X, Yuan Y, Tang L, Wang J, Zhang D, Duan L. Systematic Analysis and Validation of the Prognosis, Immunological Role and Biology Function of the Ferroptosis-Related lncRNA GSEC/miRNA-101-3p/CISD1 Axis in Lung Adenocarcinoma. Front Mol Biosci. 2022 Mar 7;8:793732. doi: 10.3389/fmolb.2021.793732.
  » https://doi.org/10.3389/fmolb.2021.793732.
• ¹³ Matsumura K, Kawasaki Y, Miyamoto M, Kamoshida Y, Nakamura J, Negishi L, et al. The novel G-quadruplex-containing long non-coding RNA GSEC antagonizes DHX36 and modulates colon cancer cell migration. Oncogene. 2017;36(9):1191-1199. doi:10.1038/onc.2016.284.
  » https://doi.org/10.1038/onc.2016.284.
• ¹⁴ Liu R, Ju C, Zhang F, Tang X, Yan J, Sun J, et al. LncRNA GSEC promotes the proliferation, migration and invasion by sponging miR-588/ EIF5A2 axis in osteosarcoma. Biochem Biophys Res Commun. 2020 Nov 5;532(2):300-307. doi: 10.1016/j.bbrc.2020.08.056.
  » https://doi.org/10.1016/j.bbrc.2020.08.056.
• ¹⁵ Liu D, Sun W, Zhang D, Yu Z, Qin W, Liu Y, et al. Long noncoding RNA GSEC promotes neutrophil inflammatory activation by supporting PFKFB3-involved glycolytic metabolism in sepsis. Cell Death Dis. 2021 Dec 14;12(12):1157. doi: 10.1038/s41419-021-04428-7.
  » https://doi.org/10.1038/s41419-021-04428-7.
• ¹⁶ Huang S, Wu Z, Cheng Y, Wei W, Hao L. Insulin-like growth factor 2 mRNA binding protein 2 promotes aerobic glycolysis and cell proliferation in pancreatic ductal adenocarcinoma via stabilizing GLUT1 mRNA. Acta Biochim Biophys Sin (Shanghai). 2019 Jul 10;51(7):743-752. doi: 10.1093/abbs/gmz048.
  » https://doi.org/10.1093/abbs/gmz048.
• ¹⁷ Zhang J, Du C, Zhang L, Wang Y, Zhang Y, Li J. lncRNA GSEC Promotes the Progression of Triple Negative Breast Cancer (TNBC) by Targeting the miR-202-5p/AXL Axis. Onco Targets Ther. 2021 Apr 20;14:2747-2759. doi: 10.2147/OTT.S293832.
  » https://doi.org/10.2147/OTT.S293832.
• ¹⁸ Bhan A, Soleimani M, Mandal SS. Long Noncoding RNA and Cancer: A New Paradigm. Cancer Res. 2017 Aug 1;77(15):3965-3981. doi: 10.1158/0008-5472.CAN-16-2634.
  » https://doi.org/10.1158/0008-5472.CAN-16-2634.
• ¹⁹ Chen X, Su W, Chen J, Ouyang P, Gong J. ST3GAL4 promotes tumorigenesis in breast cancer by enhancing aerobic glycolysis. Hum Cell. 2024 Oct 18;38(1):1. doi: 10.1007/s13577-024-01137-z.
  » https://doi.org/10.1007/s13577-024-01137-z.
• ²⁰ Munroe SH, Zhu J. Overlapping transcripts, double-stranded RNA and antisense regulation: a genomic perspective. Cell Mol Life Sci. 2006 Sep;63(18):2102-18. doi: 10.1007/s00018-006-6070-2.
  » https://doi.org/10.1007/s00018-006-6070-2.
• ²¹ Reis RS, Deforges J, Schmidt RR, Schippers JHM, Poirier Y. An antisense noncoding RNA enhances translation via localized structural rearrangements of its cognate mRNA. Plant Cell. 2021 May 31;33(4):1381-1397. doi: 10.1093/plcell/koab010.
  » https://doi.org/10.1093/plcell/koab010.
• ²² Rojo-Carrillo JJ, Garrido-Rodríguez P, Llamas-López M, Cifuentes-Riquelme R, Padilla J, Ramos-Molina B, et al. Landscape of antisense genes in the human genome and identification of new human hepatic antisense RNAs by long-read sequencing. BMC Genomics. 2024 Nov 27;25(1):1148. doi: 10.1186/s12864-024-11017-3.
  » https://doi.org/10.1186/s12864-024-11017-3.
• ²³ Wang J, Chen L, Qiang P. The role of IGF2BP2, an m6A reader gene, in human metabolic diseases and cancers. Cancer Cell Int. 2021 Feb 10;21(1):99. doi: 10.1186/s12935-021-01799-x.
  » https://doi.org/10.1186/s12935-021-01799-x.
• ²⁴ Dai N. The Diverse Functions of IMP2/IGF2BP2 in Metabolism. Trends Endocrinol Metab. 2020 Sep;31(9):670-679. doi: 10.1016/j.tem.2020.05.007.
  » https://doi.org/10.1016/j.tem.2020.05.007.
• ²⁵ Liu X, He H, Zhang F, Hu X, Bi F, Li K, et al. m6A methylated EphA2 and VEGFA through IGF2BP2/3 regulation promotes vasculogenic mimicry in colorectal cancer via PI3K/AKT and ERK1/2 signaling. Cell Death Dis. 2022 May 21;13(5):483. doi: 10.1038/s41419-022-04950-2.
  » https://doi.org/10.1038/s41419-022-04950-2.
• ²⁶ Cai H, Liang J, Jiang Y, Wang Z, Li H, Wang W, et al. KLF7 regulates super-enhancer-driven IGF2BP2 overexpression to promote the progression of head and neck squamous cell carcinoma. J Exp Clin Cancer Res. 2024 Mar 5;43(1):69. doi: 10.1186/s13046-024-02996-y.
  » https://doi.org/10.1186/s13046-024-02996-y.
• ²⁷ Yu D, Xiao Z, Zou Z, Lin L, Li J, Tan J, et al. IGF2BP2 promotes head and neck squamous carcinoma cell proliferation and growth via the miR-98-5p/PI3K/Akt signaling pathway. Front Oncol. 2023 Oct 23;13:1252999. doi: 10.3389/fonc.2023.1252999.
  » https://doi.org/10.3389/fonc.2023.1252999.
• ²⁸ Wang X, Fu X, Zhang J, Xiong C, Zhang S, Lv Y. Identification and validation of m⁶A RNA methylation regulators with clinical prognostic value in Papillary thyroid cancer. Cancer Cell Int. 2020 May 29;20:203. doi: 10.1186/s12935-020-01283-y.
  » https://doi.org/10.1186/s12935-020-01283-y.

Associated editor:

Maria Tereza Nunes https://orcid.org/0000-0003-3375-4020

Correspondence

Correspondence to: Yong Jiang, No. 185, Juqian Street, Tianning District, Changzhou City, Jiangsu Province, 213003, China [e-mail]

Disclosure:

no potential conflict of interest relevant to this ar-ticle was reported.

Publication Dates

• Publication in this collection
  10 Aug 2026
• Date of issue
  2026

History

• Received
  23 Oct 2025
• Accepted
  18 Mar 2026