Increased NOX-dependent ROS production and proportionally enhanced antioxidant response in white adipose tissue of male rats

Nascimento, Jessica de Freitas; de Oliveira, Keciany Alves; de Freitas, Paula Alexandre; Falci, Júlia de Araújo Marques; Vasconcelos, Renata Prado; Magalhães, Saulo Chaves; Farias, Talita Mendes; Alonso-Vale, Maria Isabel Cardoso; Loureiro, Adriano Cesar Carneiro; de Carvalho, Denise Pires; Fortunato, Rodrigo Soares; de Oliveira, Ariclécio Cunha

doi:10.20945/2359-4292-2024-0136

person Jessica de Freitas Nascimento

participated in the research design · contributed to the writing of the manuscript

schoolLaboratório de Fisiologia Endócrina e Metabolismo, Instituto Superior de Ciências Biomédicas, Universidade Estadual do Ceará, Fortaleza, CE, Brasil

0009-0007-9960-2990

person Keciany Alves de Oliveira

performed the assays · performed the data analysis

schoolPrograma de Pós-graduação em Nutrição e Saúde, Universidade Estadual do Ceará, Fortaleza, CE, Brasil

0000-0002-9928-3826

person Paula Alexandre de Freitas

performed the assays

schoolLaboratório de Fisiologia Endócrina e Metabolismo, Instituto Superior de Ciências Biomédicas, Universidade Estadual do Ceará, Fortaleza, CE, Brasil

0000-0003-1791-280X

person Júlia de Araújo Marques Falci

performed the assays

schoolCentro de Ciências da Saúde, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ, Brasil

0009-0008-1631-9039

person Renata Prado Vasconcelos

performed the assays

schoolLaboratório de Fisiologia Endócrina e Metabolismo, Instituto Superior de Ciências Biomédicas, Universidade Estadual do Ceará, Fortaleza, CE, Brasil

0000-0002-0586-126X

person Saulo Chaves Magalhães

contributed to the writing of the manuscript

schoolLaboratório de Fisiologia Endócrina e Metabolismo, Instituto Superior de Ciências Biomédicas, Universidade Estadual do Ceará, Fortaleza, CE, Brasil

0000-0001-9224-0850

person Talita Mendes Farias

performed the assays

schoolDepartamento de Ciências Biológicas, Universidade Federal de São Paulo, Piracicaba, SP, Brasil

0000-0002-3307-2735

person Maria Isabel Cardoso Alonso-Vale

performed the data analysis

schoolDepartamento de Ciências Biológicas, Universidade Federal de São Paulo, Piracicaba, SP, Brasil

0000-0001-5847-8080

person Adriano Cesar Carneiro Loureiro

contributed with the reagents and the literature review

schoolLaboratório de Fisiologia Endócrina e Metabolismo, Instituto Superior de Ciências Biomédicas, Universidade Estadual do Ceará, Fortaleza, CE, Brasil

0000-0002-9681-1945

person Denise Pires de Carvalho

participated in the research design · contributed with the reagents and the literature review

schoolCentro de Ciências da Saúde, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ, Brasil

0000-0001-6933-6424

person Rodrigo Soares Fortunato

participated in the research design · contributed to the writing of the manuscript

schoolCentro de Ciências da Saúde, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ, Brasil

0000-0003-3497-8173

person Ariclécio Cunha de Oliveira

participated in the research design · contributed to the writing of the manuscript

schoolLaboratório de Fisiologia Endócrina e Metabolismo, Instituto Superior de Ciências Biomédicas, Universidade Estadual do Ceará, Fortaleza, CE, BrasilschoolPrograma de Pós-graduação em Nutrição e Saúde, Universidade Estadual do Ceará, Fortaleza, CE, Brasil

0000-0002-9295-8157

personCorrespondence to: Ariclécio Cunha de Oliveira Instituto Superior de Ciências Biomédicas, Universidade Estadual do Ceará Av. Dr. Silas Munguba, 1.700, Itaperi
60714903 – Fortaleza, CE, Brasil
ariclecio@hotmail.com.

Disclosure:

no potential conflict of interest relevant to this article was reported.

Figures (3)
Tables (3)

Thumbnail

Figure 1 Levels of NADPH oxidase mRNA in subcutaneous (SC) and retroperitoneal (RP) fat pads of male (n = 6) and female (n = 6) rats aged 16 weeks. (A) Expression levels of NADPH 1 (NOX1) mRNA. (B) Expression levels of NADPH 2 (NOX2) mRNA. (C) Expression levels of NADPH 4 (NOX4) mRNA. All PCR data were assessed using real-time PCR and normalized to β-actin mRNA expression. (D) Microsomal NOX activity. The H₂O₂ production was determined in the microsomal enriched fraction using the Amplex Red/horseradish peroxidase assay. *Sex differences in comparisons within the same tissue (p < 0.05) **Sex differences in comparisons within the same tissue (p < 0.001). #Tissue differences in comparisons within the same sex (p < 0.05). Repeated-measures two-way analysis of variance (ANOVA) followed by Bonferroni's multiple comparison test. The data are expressed as mean ± standard error of the mean.

Thumbnail

Figure 2 Activity and mRNA levels of antioxidant enzymes in subcutaneous (SC) and retroperitoneal (RP) fat pads of male (n = 6) and female (n = 6) rats aged 16 weeks. (A) Superoxide dismutase 1 (Sod1) mRNA levels. (B) Superoxide dismutase 2 (Sod2) mRNA levels. (C) Superoxide dismutase (SOD). (D) Glutathione peroxidase 1 (Gpx1) mRNA level. (E) Glutathione peroxidase (GPx) activity levels. (F) Catalase (Cat) mRNA levels. (G) CAT activity. The mRNA data were assessed using real-time PCR and normalized to β-actin mRNA expression and expressed as mean ± standard error of the mean. The activity of antioxidant enzymes was measured using spectrophotometry, and the results were expressed as mean ± standard error of the mean. *Sex differences in comparisons within the same tissue (p < 0.05). **Sex differences in comparisons within the same tissue (p < 0.001). #Tissue differences in comparisons within the same sex (p < 0.05). ##Tissue differences in comparisons within the same sex (p < 0.0001). Repeated-measures two-way analysis of variance (ANOVA) followed by Bonferroni's multiple comparison test.

Thumbnail

Figure 3 Total reduced thiol in subcutaneous (SC) and retroperitoneal (RP) fat pads of male (n = 6) and female (n = 6) rats aged 16 weeks. Reactive protein thiol levels in SC and RP fat pads were assessed by measuring total sulfhydryl groups from a reaction of thiols with DTNB spectrophotometry. The data are expressed as mean ± standard error of the mean. *Sex differences in comparisons within the same tissue (p < 0.05). ##Tissue differences in comparisons within the same sex (p < 0.0001). Repeated-measures two-way analysis of variance (ANOVA) followed by Bonferroni's multiple comparison test.

Thumbnail

Table 1 List of reverse and forward primers used in the real-time polymerase chain reaction (PCR) assay

Thumbnail

Table 2 Body weight and adiposity of the female (n = 6) and male (n = 6) rats analyzed in the study*

Thumbnail

Sex Fat Pad Retroperitoneal Subcutaneous p value Nox1 (mRNA NOX1/β-actin) Male 1.15 ± 1.03 1.45 ± 0.53 0.7001 Female 1.58 ± 0.76 0.78 ± 0.39 0.0045* p value >0.9999 0.8228 Nox2 (mRNA NOX2/β-actin) Male 2.83 ± 1.08 1.94 ± 0.68 0.9483 Female 1.51 ± 0.42 0.88 ± 0.54 0.0203* p value 0.0485* 0.1386 Nox4 (mRNA NOX4/β-actin) Male 3.09 ± 1.57 2.5 ± 0.78 >0.9999 Female 0.45 ± 0.35 0.73 ± 0.83 0.3962 p value 0.0012* 0.0308* Microsomal NOX activity nmol H2O2/h/mg protein Male 36.61 ± 13.76 44.44 ± 11.83 0.2524 Female 44.19 ± 10.35 28.43 ± 2.46 0.5383 p value 0.4014 0.0314* Sod1 (mRNA SOD1/β-actin) Male 2.03 ± 1.06 4.49 ± 2.79 0.7715 Female 2.10 ± 0.90 1.08 ± 0.47 0.9519 p value 0.9998 0.0075* Sod2 (mRNA SOD2/β-actin) Male 0.94 ± 0.23 0.93 ± 0.51 0.379 Female 1.19 ± 0.34 1.07 ± 0.41 0.0343* p value 0.7268 0.9356 U SOD/mg protein Male 25.4 ± 0.49 25.63 ± 0.83 0.0075* Female 12.12 ± 1.57 15.14 ± 2.57 0.6474 p value <0.0001* 0.0007* Gpx1 (mRNA GPx1/β-actin) Male 1.52 ± 0.12 1.35 ± 0.51 0.9999 Female 1.28 ± 0.85 1.08 ± 0.47 0.9439 p value 0.9156 0.8808 GPx (μmol oxidated NADPH/mg protein/min) Male 128.78 ± 11.41 134.4 ± 14.05 0.9996 Female 126.19 ± 8.99 133.53 ± 0.11 0.5416 p value 0.9985 >0.9999 Cat (mRNA CAT/β-actin) Male 3.32 ± 0.49 2.24 ± 1.15 0.9734 Female 3.92 ± 1.19 0.9421 p value 0.4646 0.0408* 0.89 U CAT/mg protein Male 0.73 ± 0.06 0.77 ± 0.02 0.9854 Female 0.78 ± 0.02 0.9686 p value 0.929 0.0213* 0.5 nmol reduced DTNB/mg protein Male 162.2 ± 67.98 45.64 ± 10.34 0.2496 Female 75.56 ± 58.55 61.34 ± 12.91 <0.0001 p value 0.0360* >0.9999 The values are expressed as mean ± standard error of the mean (SEM).

*

	Reverse	Forward
Actb	TCAGGTCATCACTATCGGAATG	TTTCATGGATGCCACAGGATTC
Gus	TGTCTGCGTCATATCTGGTATTG	GGTCGTGATGTGGTCCTGTC
Sod1	CTTCCAGCATTTCCAGTCTTTG	TGTGTCCATTGAAGATCGTGTG
Sod2	CAAAAGACCCAAAGTCACGC	GGACAAACCTGAGCCCTAAG
Gpx1	GAAGGTAAAGAGCGGGTGAG	AATCAGTTCGGACATCAGGAG
Cat	TTGAAAAGATCTCGGAGGCC	CAAGCTGGTTAATGCGAATGG
Nox1	ATTCGTCCATCTCTTGTTCCAG	AAGTGGCTGTACTGG
Nox2	CGAGTCACAGCCACATACAG	CAATTCACACCATTGCACATC
Nox4	GGTTTCCAGTCATCCAGTAGAG	TCCATCAAGCCAAGATTCTGAG

Variables		Male rats	Female rats
Body weight (g)		317.2 ± 11.71	211.2 ± 6.14***
RP fat pad	Weight (g)	0.6434 ± 0.038	0.6578 ± 0.059**
RP fat pad	Relative (%)	0.204 ± 0.012	0.313 ± 0.029**
SC fat pad	Weight (g)	0.8929 ± 0.059	0.7852 ± 0.07**
SC fat pad	Relative (%)	0.282 ± 0.017	0.373 ± 0.034**

	Sex	Fat Pad
	Sex	Retroperitoneal		Subcutaneous		p value
Nox1 (mRNA NOX1/β-actin)	Male	1.15	± 1.03	1.45	± 0.53	0.7001
	Female	1.58	± 0.76	0.78	± 0.39	0.0045*
	p value	>0.9999		0.8228
Nox2 (mRNA NOX2/β-actin)	Male	2.83	± 1.08	1.94	± 0.68	0.9483
	Female	1.51	± 0.42	0.88	± 0.54	0.0203*
	p value	0.0485*		0.1386
Nox4 (mRNA NOX4/β-actin)	Male	3.09	± 1.57	2.5	± 0.78	>0.9999
	Female	0.45	± 0.35	0.73	± 0.83	0.3962
	p value	0.0012*		0.0308*
Microsomal NOX activity nmol H₂O₂/h/mg protein	Male	36.61	± 13.76	44.44	± 11.83	0.2524
	Female	44.19	± 10.35	28.43	± 2.46	0.5383
	p value	0.4014		0.0314*
Sod1 (mRNA SOD1/β-actin)	Male	2.03	± 1.06	4.49	± 2.79	0.7715
	Female	2.10	± 0.90	1.08	± 0.47	0.9519
	p value	0.9998		0.0075*
Sod2 (mRNA SOD2/β-actin)	Male	0.94	± 0.23	0.93	± 0.51	0.379
	Female	1.19	± 0.34	1.07	± 0.41	0.0343*
	p value	0.7268		0.9356
U SOD/mg protein	Male	25.4	± 0.49	25.63	± 0.83	0.0075*
	Female	12.12	± 1.57	15.14	± 2.57	0.6474
	p value	<0.0001*		0.0007*
Gpx1 (mRNA GPx1/β-actin)	Male	1.52	± 0.12	1.35	± 0.51	0.9999
	Female	1.28	± 0.85	1.08	± 0.47	0.9439
	p value	0.9156		0.8808
GPx (μmol oxidated NADPH/mg protein/min)	Male	128.78	± 11.41	134.4	± 14.05	0.9996
	Female	126.19	± 8.99	133.53	± 0.11	0.5416
	p value	0.9985		>0.9999
Cat (mRNA CAT/β-actin)	Male	3.32	± 0.49	2.24	± 1.15	0.9734
	Female	3.92		± 1.19		0.9421
	p value	0.4646	0.0408*			0.89
U CAT/mg protein	Male	0.73	± 0.06	0.77	± 0.02	0.9854
	Female	0.78		± 0.02		0.9686
	p value	0.929	0.0213*			0.5
nmol reduced DTNB/mg protein	Male	162.2	± 67.98	45.64	± 10.34	0.2496
	Female	75.56	± 58.55	61.34	± 12.91	<0.0001
	p value	0.0360*		>0.9999

[TFN1] Abbreviations: Actb, actin beta (UGO Gene Nomenclature Committee abbreviation); Cat, catalase; Nox1, NADPH oxidase 1; Nox2, NADPH oxidase 2; Nox4, NADPH oxidase 4; Gpx1, glutathione peroxidase; Gus, β-glucuronidase reporter gene system; Sod1, superoxide dismutase 1; Sod1, superoxide dismutase 2.