NADPH oxidase 5 is a novel susceptibility gene for type 2 diabetes mellitus

Azarova, Iuliia; Klyosova, Elena; Azarova, Valentina; Polonikov, Alexey

doi:10.20945/2359-4292-2023-0527

Tabla de contenido Anterior Actual Siguiente

Tabla de contenido

Original article • Arch. Endocrinol. Metab. 68 • 2024 • https://doi.org/10.20945/2359-4292-2023-0527 linkcopy

NADPH oxidase 5 is a novel susceptibility gene for type 2 diabetes mellitus

Authorship SCIMAGO INSTITUTIONS RANKINGS

Objective This pilot study investigated whether single nucleotide polymorphisms (SNP) in the NOX5 gene (NADPH oxidase 5) are associated with the type 2 diabetes (T2D) risk.

Subjects and methods A total of 1579 patients with T2D and 1627 age- and sex-matched healthy subjects were recruited for this study. Genotyping of common SNPs, namely rs35672233, rs3743093, rs2036343, rs311886, and rs438866, was performed using the MassArray-4 system.

Results SNP rs35672233 was associated with an increased risk of T2D (OR = 1.67, 95% CI 1.29-2.17, FDR = 0.003). The H3 haplotype (rs35672233T-rs3743093G-rs2036343A-rs311886C-rs438866C) increased T2D risk (OR = 1.65, 95% CI 1.27-2.13, FDR = 0.001). The rs35672233 polymorphism and H3 haplotype were found to have an association with T2D risk only in subjects with a body mass index greater than 25 kg/m² (FDR < 0.01). Environmental risk factors, such as chronic psycho-emotional stress, sedentary lifestyle, high-calorie diet and SNP rs35672233 were jointly associated with T2D susceptibility. A haplotype comprising the allele rs35672233-C and conferring protection against T2D, was associated with elevated levels of antioxidants such as total glutathione and uric acid, as well as reduced levels of two-hour postprandial glucose in the plasma of patients. The NOX5 polymorphisms showed no associations with diabetic complications.

Conclusion The present study is the first to establish associations between polymorphisms in NOX5 and the risk of type 2 diabetes mellitus, and provides a new line of evidence for the crucial role of oxidative stress-related genes in disease susceptibility.

Type 2 diabetes; oxidative stress; NADPH oxidase 5; single nucleotide polymorphism; risk factors; gene-environment interactions

NOX5 SNP ID		n (%)^a
NOX5 SNP ID	Genotype/allele	Controls (n=1,627)	T2D patients (n=1,579)	adj^P(Q)b	_adjOR (95% CI)^c
Entire group
rs35672233 C>T	C/C C/T	1,515 (93.1) 110 (6.8)	1,409 (89.2) 164 (10.4)	0.0002 (0.003)	1.00 1.67 (1.29-2.17)
rs35672233 C>T	T/T	2 (0.1)	6 (0.4)	0.0002 (0.003)	2.63 (0.52-13.28)
rs3743093 A>G	A/A	533 (32.8)	536 (34)	0.79 (0.98)	1.00
	A/G	809 (49.7)	764 (48.4)		0.95 (0.81-1.11)
	G/G	285 (17.5)	279 (17.7)		0.97 (0.78-1.20)
	A/A	1,523(93.6)	1,456 (92.2)		1.00
rs2036343 A>C	C/A	96 (5.9)	120 (7.6)	0.059 (0.17)	1.30 (0.97-1.73)
	C/C	8 (0.5)	3 (0.2)		0.36 (0.09-1.41)
rs311886 C>T	C/C	1,507 (92.6)	1,468 (93)	0.92 (0.98)	1.00
rs311886 C>T	T C	116 (7.1)	108 (6.8)	0.92 (0.98)	0.95 (0.72-1.26)
	T T	4 (0.2)	3 (0.2)		0.83 (0.18-3.91)
	T T	435 (26.7)	446 (28.2)		1.00
rs438866 T>C	T C	858 (52.7)	766 (48.5)	0.089 (0.22)	0.88 (0.75-1.05)
rs438866 T>C	C C	334 (20.5)	367 (23.2)	0.089 (0.22)	1.07 (0.87-1.32)
BMI < 25 kg/m²
	C C	279 (92.7)	184 (90.6)		1.00
rs35672233 C>T	C T	22 (7.3)	19 (9.4)	0.35 (0.65)	1.37 (0.71-2.67)
rs35672233 C>T	T T	0	0	0.35 (0.65)	-
	A A	102 (33.8)	77 (37.8)		1.00
rs3743093 A>G	A/G	152 (50.3)	93 (45.6)	0.61 (0.95)	0.82 (0.55-1.23)
	G/G	48 (15.9)	34 (16.7)		0.95 (0.55-1.64)
	A A	274 (92.3)	189 (95)		1.00
rs2036343 A>C	C A	21 (7.1)	10 (5)	0.19 (0.40)	0.65 (0.30-1.45)
	C C	2 (0.7)	0 (0)		0.00 (0.00-NA)
rs311886 C>T	C C	283 (93.7)	192 (94.1)	1.0 (1.0)	1.00
rs311886 C>T	T C	18 (6)	11 (5.4)	1.0 (1.0)	1.03 (0.47-2.27)
	T T	1 (0.3)	1 (0.5)		1.06 (0.06-17.63)
	T T	83 (27.7)	63 (31)		1.00
rs438866 T>C	T C	151 (50.3)	103 (50.7)	0.55 (0.91)	0.95 (0.62-1.45)
rs438866 T>C	C C	66 (22)	37 (18.2)	0.55 (0.91)	0.75 (0.44-1.28)
BMI > 25 kg/m²
	C/C	1,199 (93.2)	1,217 (89)		1.00
rs35672233 C>T	C T	85 (6.6)	144 (10.5)	0.0006 (0.0045)	1.70 (1.28-2.25)
rs35672233 C>T	T T	2 (0.2)	6 (0.4)	0.0006 (0.0045)	2.41 (0.48-12.18)
	A A	422 (32.5)	457 (33.4)		1.00
rs3743093 A>G	A G	643 (49.6)	668 (48.8)	0.90 (0.98)	0.96 (0.81-1.14)
rs3743093 A>G	G G	232 (17.9)	245 (17.9)	0.90 (0.98)	0.97 (0.77-1.21)
	A A	1,198 (93.9)	1,248 (91.8)		1.00
rs2036343 A>C	C A	72 (5.6)	108 (8)	0.021 (0.07)	1.49 (1.09-2.04)
rs2036343 A>C	C C	6 (0.5)	3 (0.2)	0.021 (0.07)	0.46 (0.11-1.86)
rs311886 C>T	C C	1,194 (92.3)	1,241 (92.8)	0.81 (0.98)	1.00
rs311886 C>T	T C	96 (7.4)	94 (7)	0.81 (0.98)	0.95 (0.70-1.28)
	T T	3 (0.2)	2 (0.2)		0.61 (0.10-3.71)
rs438866 T>C	T T	342 (26.5)	377 (27.8)	0.019 (0.07)	1.00
	T C	687 (53.3)	653 (48.2)		0.87 (0.72-1.04)
	C/C	261 (20.2)	325 (24)		1.14 (0.91-1.42)

Genotype combination	T2D patients		Controls		P-value	Q-value	OR (95% CI)
Genotype combination	n^a	%^b	_na	%^b	P-value	Q-value	OR (95% CI)
rs35672233-C/Txrs3743093-A/G	106	6.8	67	4.2	0.002	0.02	1.64 (1.19-2.24)
rs35672233-C/Cxrs2036343-A/A	1,271	81.9	1,353	87.0	0.000097	0.0068	0.68 (0.56-0.82)
rs35672233-C/Txrs2036343-A/A	153	9.9	99	6.4	0.00035	0.007	1.61 (1.24-2.09)
rs35672233-C/Txrs311886-C/C	153	10.0	103	6.5	0.0005	0.007	1.58 (1.22-2.05)
rs35672233-C/Cxrs438866-T/C	659	42.5	764	48.7	0.00047	0.007	0.78 (0.68-0.90)
rs2036343-A/Cxrs3743093-A/G	53	3.4	26	1.7	0.0019	0.02	2.09 (1.30-3.35)
rs2036343-A/Cxrs438866-C/C	56	3.6	25	1.6	0.0004	0.007	2.31 (1.43-3.72)

H \sNPs \	rs35672233	3 0 7 3 _rs	rs2036343	rs311886	₆6 8 8 ₄3 _rs	Controls	T2D Patients	OR (95% CI)b	P (Q)^c
Entire group Global haplotype association P-value: 0.0018
H1	C	A	A	C	T	0.5199	0.517	1.00	---
H2	C	G	A	C	C	0.3402	0.3213	0.95 (0.85-1.06)	0.34 (0.74)
H3	T	G	A	C	C	0.0346	0.0556	1.65 (1.27-2.13)	0.0001 (0.0018)
H4	C	A	C	C	C	0.0357	0.0396	1.09 (0.83-1.43)	0.54 (0.74)
H5	C	G	A	T	C	0.0383	0.0348	0.94 (0.71-1.24)	0.65 (0.78)
H6	C	A	A	C	C	0.0208	0.024	1.27 (0.89-1.82)	0.19 (0.60)
Rare¹	*	*	*	*	*	0.0083	0.0062	0.80 (0.43 - 1.49)	0.49 (0.74)
BMI<25 kg/m² Global haplotype association P-value: 0.75
H1	C	A	A	C	T	0.5189	0.5512	1.00	-
H2	C	G	A	C	C	0.3312	0.3068	0.87 (0.65 - 1.16)	0.35 (0.74)
H3	T	G	A	C	C	0.0352	0.0457	1.29 (0.65 - 2.55)	0.47 (0.74)
H4	C	A	C	C	C	0.0371	0.0257	0.59 (0.27 - 1.28)	0.18 (0.60)
H5	C	G	A	T	C	0.0316	0.0319	0.98 (0.48 - 2.00)	0.96 (0.96)
H6	C	A	A	C	C	0.0334	0.0285	0.85 (0.39 - 1.88)	0.70 (0.78)
Rare¹	*	*	*	*	*	0.0039	0.0090	0.91 (0.26 - 3.12)	0.88 (0.93)
BMI>25 kg/m² Global haplotype association P-value: 0.0013
H1	C	A	A	C	T	0.5202	0.5119	1.00	-
H2	C	G	A	C	C	0.3426	0.3238	0.96 (0.85-1.09)	0.54 (0.74)
H3	T	G	A	C	C	0.0344	0.0569	1.67 (1.27-2.20)	0.0003 (0.0027)
H4	C	A	C	C	C	0.0353	0.0416	1.21 (0.91-1.62)	0.20 (0.60)
H5	C	G	A	T	C	0.0396	0.0351	0.92 (0.69-1.24)	0.60 (0.77)
H6	C	A	A	C	C	0.0179	0.0233	1.43 (0.95-2.14)	0.085 (0.51)
Rare^a	*	*	*	*	*	0.0090	0.0055	0.77 (0.40-1.50)	0.44 (0.74)

		No risk factor (f-)				Presence of risk factor (f+)
Genotypes	Controls, n (%)^a	T2D patients, n (%)^a	OR (95% CI)^b	P (Q)	Controls, n (%)^a	T2D patients, n (%)^a	OR (95% CI)^b	P (Q)
1	2	3	4	5	6	7	8	9
Chronic psychological stress and rs35672233 NOX5
C/C	987(92.8)	526 (89.8)	1.00		491 (93.7)	604 (88.3)	1.00	0.015 (0.15)
C/T	76 (7.2)	58 (9.9)	1.57 (1.03-2.40)	0.054	31 (5.9)	77 (11.3)	1.95 (1.22-3.12)
T/T	0 (0)	2 (0.3)	NA (0.00-NA)	(0.31)	2 (0.4)	3 (0.4)	0.63 (0.09-4.30)
Sedentary lifestyle and rs35672233 NOX5
C/C	924(93)	366 (91.7)	1.00		554 (93.3)	1035 (88.4)	1.00	0.0002 (0.006)
C/T	69 (7)	33 (8.3)	1.16 (0.70-1.92)	0.56	38 (6.4)	130 (11.1)	2.27 (1.50-3.43)
T/T	-	-	-	(0.80)	- 2 (0.3)	6 (0.5)	0.84 (0.16-4.45)
High calorie diet and rs35672233 NOX5
C/C	983(92.8)	240 (89.2)	1.00		495 (93.8)	1061(89)	1.00	0.019
C/T	74 (7)	29 (10.8)	1.62 (1.03-2.55)	0.081	33 (6.2)	125 (10.5)	1.81 (1.15-2.86)	(0.21)
T/T	2 (0.2)	0 (0)	0.00 (0.00-NA)	(0.34)	0 (0)	6 (0.5)	NA (0.00-NA)
High calorie diet and rs438866 NOX5
T/T	282 (26.6)	85 (31.9)	1.00		143 (27)	323 (27.3)	1.00	0.02 (0.21)
T/C	555 (52.3)	136 (51.1)	0.81 (0.59-1.10)	0.12	283 (53.5)	572 (48.4)	0.96 (0.72-1.27)
C/C	224 (21.1)	45 (16.9)	0.66 (0.44-0.99)	(0.41)	103 (19.5)	288 (24.3)	1.46 (1.03-2.07)

Primer sequence 5'-*3"
SNP ID	Forward	Reverse	Extended
rs35672233 C>T	ACGTTGGATGTTAATGCCCTTGCCTACCTC	ACGTTGGATGGAACTGAGCATAGTTCCGGC	ACTGCCCTCCCAAGC
rs3743093 A>G	ACGTTGGATGGTCACCTGTCACCACTTTAG	ACGTTGGATGGAGAGCTGAGGAACATCTTC	gAGAGCACTGGCATTG
rs2036343 A>C	ACGTTGGATGCCTTAACTGGCCATAACTTG	ACGTTGGATGGTTCAGGAATAATATGTAGG	TGGCTTATTTCCTCAAAAG
rs311886 C>T	ACGTTGGATGCCAAAGGGTGGCTATAAGTC	ACGTTGGATGCTCATGTCCCTGAGCTGAAG	agacCTGCCCCCCCAAAGACATTCAC
rs438866 T>C	ACGTTGGATGGCATCAACTGGTTACCACTG	ACGTTGGATGTACCACAGCAGTGAATCTCC	ttttTCCATTAATGACACCCA

Gene SNP	Minor allele	'Central Russia	²UK Biobankl	³UK Biobank2	'EXTEND GWAS	"Go Darts lllumina Infinium GWAS	"Go Darts exome chip analysis	4FUSI0N GWAS	'Diabetic Cohort Singapore Prospective Study GWAS	'AMP T2D-GENES exome sequence analysis	'CAMP GWAS	'BioMe AMPT2D GWAS	'METSIM GWAS
1	2	3	4	5	6	7	8	9	10	11	12	13	14
N0X5	Τ	0.0002	0.19	0.53	0.0867	0.204	-	-	-	-	-	0.436	0.402
C>T
rs35672233
N0X5	G	0.79	0.77	0.89	0.569	0.0481	0.677	0.418	0.552	0.717	0.732	0.627	0.333
A>G
rs3743093
N0X5	Τ	0.92	0.19	0.0059	0.671	0.0862	-	-	-	-	-	-	-
C>T
rs311886
N0X5	C	0.089	0.97	0.89	0.416	0.0392	-	-	0.782	-	0.321	0.870	0.174
T>C
rs438866

Genotype combination	T2D patients		Controls		P-value	Q-value	OR 95% CI
Genotype combination	n¹	%²	n¹	%²	P-value	Q-value	OR 95% CI
rs35672233-C/Cxrs3743093-A/A	534	34.1	521	33.0	0.54	0.77	1.05 (0.90-1.21)
rs35672233-C/Cx rs3743093-A/G	650	41.5	716	45.4	0.03	0.17	0.85 (0.74-0.98)
rs35672233-C/Cx rs3743093-G/G	214	13.7	232	14.7	0.40	0.73	0.92 (0.75-1.12)
rs35672233-C/Tx rs3743093-A/G	106	6.8	67	4.2	0.002	0.02	1.64 (1.19-2.24)
rs35672233-C/Tx rs3743093-G/G	57	3.6	39	2.5	0.06	0.30	1.49 (0.98-2.25)
rs35672233-T/Tx rs3743093-G/G	6	0.4	2	0.1	0.28	0.72	2.62 (0.61-11.30)
rs35672233-C/Cxrs2036343-A/A	1271	81.9	1353	87.0	0.000097	0.0068	0.68 (0.56-0.82)
rs35672233-C/Cx rs2036343-A/C	109	7.0	89	5.7	0.14	0.49	1.25 (0.93-1.66)
rs35672233-C/Cx rs2036343-C/C	3	0.2	7	0.5	0.34	0.73	0.47 (0.13-1.66)
rs35672233-C/Tx rs2036343-A/A	153	9.9	99	6.4	0.00035	0.007	1.61 (1.24-2.09)
rs35672233-C/Tx rs2036343-A/C	9	0.6	4	0.3	0.26	0.72	2.12 (0.69-6.53)
rs35672233-C/Tx rs2036343-C/C	0	0.0	1	0.1	1.00	1.00	0.33 (0.01-8.21)
rs35672233-T/Tx rs2036343-A/A	6	0.4	2	0.1	0.29	0.72	2.61 (0.61-11.26)
rs35672233-C/Cxrs311886-C/C	1268	82.7	1351	85.8	0.02	0.13	0.79 (0.65-0.96)
rs35672233-C/Cx rs311886-C/T	97	6.3	111	7.1	0.42	0.73	0.89 (0.67-1.18)
rs35672233-C/Cx rs311886-T/T	3	0.2	4	0.3	0.97	1.00	0.80 (0.20-3.23)
rs35672233-C/Tx rs311886-C/C	153	10.0	103	6.5	0.0005	0.007	1.58 (1.22-2.05)
rs35672233-C/Tx rs311886-C/T	7	0.5	3	0.2	0.32	0.73	2.20 (0.62-7.86)
rs35672233-T/Tx rs311886-C/C	6	0.4	2	0.1	0.27	0.72	2.67 (0.62-11.52)
rs35672233-C/Cxrs438866-T/T	440	28.4	423	27.0	0.39	0.73	1.07 (0.92-1.25)
rs35672233-C/Cxrs438866-T/C	659	42.5	764	48.7	0.00047	0.007	0.78 (0.68-0.90)
rs35672233-C/Cxrs438866-C/C	287	18.5	275	17.5	0.48	0.75	1.07 (0.89-1.28)
rs35672233-C/Txrs438866-T/T	0	0.0	1	0.1	1.0	1.00	0.34 (0.01-8.27)
rs35672233-C/Txrs438866-T/C	92	5.9	60	3.8	0.01	0.08	1.58 (1.14-2.21)
rs35672233-C/Txrs438866-C/C	67	4.3	43	2.7	0.02	0.12	1.60 (1.08-2.36)
rs35672233-T/Txrs438866-C/C	6	0.4	2	0.1	0.28	0.72	2.64 (0.61-11.35)
rs3743093-A/Axrs2036343-A/A	459	29.5	439	28.1	0.38	0.73	1.07 (0.92-1.25)
rs3743093-A/Axrs2036343-A/C	64	4.1	65	4.2	0.95	1.00	0.99 (0.70-1.41)
rs3743093-A/Axrs2036343-C/C	2	0.1	6	0.4	0.29	0.72	0.39 (0.09-1.66)
rs3743093-A/Gxrs2036343-A/A	701	45.1	750	48.0	0.10	0.37	0.89 (0.77-1.02)
rs3743093-A/Gxrs2036343-A/C	53	3.4	26	1.7	0.0019	0.02	2.09 (1.30-3.35)
rs3743093-A/Gxrs2036343-C/C	1	0.1	0	0.0	1.0	1.00	3.02 (0.12-74.13)
rs3743093-G//Gxrs2036343-A/A	275	17.7	276	17.6	0.98	1.00	1.00 (0.83-1.20)
rs3743093-G/Gxrs2036343-A/C	1	0.1	1	0.1	0.48	0.74	1.01 (0.10-9.67)
rs3743093-G//Gxrs2036343-C/C	0	0.0	1	0.1	1.00	1.00	0.33 (0.01-8.23)
rs3743093-A/Ax rs311886-C/C	522	33.9	522	32.8	0.53	0.76	1.05 (0.90-1.22)
rs3743093-A/Gx rs311886-C/C	682	44.3	721	45.3	0.55	0.76	0.96 (0.83-1.10)
rs3743093-A/Gx rs311886-C/T	60	3.9	71	4.5	0.43	0.73	0.87 (0.61-1.23)
rs3743093-A/Gx rs311886-T/T	1	0.1	0	0.0	0.99	1.00	3.10 (0.13-76.14)
rs3743093-G/Gx rs311886-C/C	228	14.8	229	14.4	0.75	0.90	1.03 (0.85-1.26)
rs3743093-G/Gx rs311886-C/T	45	2.9	43	2.7	0.71	0.87	1.08 (0.71-1.65)
rs3743093-G/Gx rs311886-T/T	2	0.1	4	0.3	0.71	0.87	0.57 (0.12-2.69)
rs3743093-A/Ax rs438866-T/T	427	27.4	407	25.7	0.27	0.72	1.09 (0.93-1.28)
rs3743093-A/Ax rs438866-T/C	96	6.2	110	6.9	0.38	0.73	0.88 (0.66-1.17)
rs3743093-A/Ax rs438866-C/C	7	0.4	6	0.4	0.97	1.00	1.18 (0.41-3.37)
rs3743093-A/Gx rs438866-T/T	13	0.8	16	1.0	0.61	0.81	0.83 (0.40-1.72)
rs3743093-A/Gx rs438866-T/C	653	41.9	715	45.1	0.07	0.33	0.88 (0.76-1.01)
rs3743093-A/Gx rs438866-C/C	86	5.5	55	3.5	0.01	0.08	1.63 (1.15-2.30)
rs3743093-G/Gx rs438866-T/C	6	0.4	10	0.6	0.47	0.74	0.63 (0.24-1.68)
rs3743093-G/Gx rs438866-C/C	269	17.3	266	16.8	0.71	0.87	1.04 (0.86-1.25)
rs2036343-A/Ax rs311886-C/C	1305	85.7	1347	86.4	0.57	0.77	0.94 (0.77-1.16)
rs2036343-A/Ax rs311886-C/T	97	6.4	110	7.1	0.45	0.74	0.90 (0.68-1.19)
rs2036343-A/Ax rs311886-T/T	3	0.2	4	0.3	0.98	1.00	0.80 (0.20-3.22)
rs2036343-A/Cx rs311886-C/C	110	7.2	89	5.7	0.09	0.35	1.29 (0.96-1.72)
rs2036343-A/Cx rs311886-C/T	5	0.3	2	0.1	0.43	0.73	2.26 (0.51-10.08)
rs2036343-C/Cx rs311886-C/C	3	0.2	7	0.4	0.36	0.73	0.48 (0.13-1.70)
rs2036343-A/Axrs438866-T/T	432	28.1	422	27.1	0.57	0.76	1.05 (0.89-1.23)
rs2036343-A/Ax rs438866-T/C	694	45.1	748	48.1	0.09	0.35	0.89 (0.77-1.02)
rs2036343-A/Ax rs438866-C/C	296	19.2	286	18.4	0.56	0.76	1.06 (0.88-1.26)
rs2036343-A/Cx rs438866-T/T	0	0.0	1	0.1	1.0	1.00	0.34 (0.01-8.26)
rs2036343-A/Cxrs438866-T/£	59	3.8	66	4.2	0.56	0.76	0.90 (0.63-1.29)
rs2036343-A/Cx rs438866-C/C	56	3.6	25	1.6	0.0004	0.007	2.31 (1.43-3.72)
rs2036343-C/Cxrs438866-C/C	3	0.2	7	0.5	0.35	0.73	0.47 (0.13-1.67)
rs311886-C/Cxrs438866-T/T	431	28.2	424	26.8	0.39	0.73	1.07 (0.92-1.25)
rs311886-C/Cxrs438866-T/C	687	45.0	765	48.4	0.06	0.30	0.87 (0.76-1.00)
rs311886-C/Cxrs438866-C/C	303	19.8	275	17.4	0.08	0.35	1.17 (0.98-1.41)
rs311886-C/Txrs438866-T/C	52	3.4	69	4.4	0.17	0.56	0.77 (0.53-1.11)
rs311886-C/Txrs438866-C/C	52	3.4	44	2.8	0.32	0.73	1.23 (0.82-1.85)
rs311886-T/Txrs438866-T/C	1	0.1	0	0.0	0.99	1.00	3.11 (0.13-76.31)
rs311886-T/Txrs438866-C/C	2	0.1	4	0.3	0.71	0.87	0.57 (0.12-2.70)

SNP ID	rs35672233	rs3743093	rs2036343	rs311886	rs438866
rs35672233	-	0,0262	-0,0009	-0,0016	0,0236
rs35672233	-	0,9982	0,5059	0,9576	0,9888
rs3743093	-	-	-0,0143	0,0212	0,2146
rs3743093	-	-	0 9092	0,9878	0,9649
rs2036343	-	-	-	-0,0013	0,0193
rs2036343	-	-	-	0,9484	0,9846
rs311886	-	-	-	-	0,0193
rs311886	-	-	-	-	0,9846

location_on

Sociedade Brasileira de Endocrinologia e Metabologia Rua Botucatu, 572 - Conjuntos 81/83, CEP: 04023-061 , Tel: +55 (11) 5575-0311 / +55 (11) 9 9768-6933 - São Paulo - SP - Brazil
E-mail: aem.editorial.office@endocrino.org.br

rss_feed Acompañe los números de esta revista en su lector de RSS

[TFN1] ^a Absolute number and percentage of individuals/chromosomes with particular genotype/allele.

[TFN2] ^b Significance value of association (P) adjusted for age and gender with one degree of freedom (Significance value of association, Q adjusted for multiple testing). ^c Odds ratio with 95% confidence intervals adjusted for age and gender with one degree of freedom (codominant model). Bold is statistically significant P-and Q-values.