Open-access Isolation and characterization of the most abundant rhizobacterial species associated with Vuralia turcica (Fabaceae: Papilionoideae)

Abstract

Vurali turcica is naturally grown in a limited area in Central Anatolia in Turkey and was categorized as a critically endangered plant in the Red Data Book of Turkish Plants. This study aimed to analyze whether the symbiotic and mutualistic relation between V. turcica rhizomes and present microflora in the habitat can be active on its distribution. Plant growth-promoting rhizobacteria (PGPRs) colonize the rhizosphere and promote plant growth and physiology. In this paper, the diversity of PGPRs of rhizomes of V. turcica was analyzed. Rhizome samples were obtained from the natural habitats of V. turcica by the workers of Nezahat Gökyiğit Botanical Garden, and bacterial isolation was conducted on the collected samples. MIS analysis, 16S rRNA, and 16S-23S rRNA ITS region sequencing were implemented, and as a result, Bacillus megaterium was found to be one of the most abundant bacterial species of the rhizomes of V. turcica based on nucleotide homology. This study is the first report on the identification of rhizobacterial species in V. turcica.

Key words
MIS; Nezahat Gökyiğit Botanical Garden; 16S rRNA; 16S-23S rRNA ITS region; V. turcica

INTRODUCTION

Plant growth-promoting rhizobacteria (PGPR) affect plant growth positively through plant growth regulator production, nutrient mobilization in the soil, plant growth regulator production, inhibition, and toxic compound degradation, and plant-pathogen control (Ahemad et al. 2009, Ahemad & Kibret 2014). Plant roots facilitate nutrient and water uptake and provide mechanical support to the plant. Besides, plant roots synthesize and secrete compounds that contribute to metabolizing microbial populations (Walker et al. 2003). Secondary metabolites produced by PGPRs may have a role in facilitating nutrient uptake of plants as those metabolites convert into available forms for plant roots to absorb (Glick et al. 2007).

Vuralia turcica (Tan et al. 1983) Uysal et al. 2014 belongs to the Fabaceae family and is naturally distributed in Konya province in Turkey. This species is a rare and endemic plant species. The habitat of V. turcica is limited to an area in Central Anatolia in Turkey (Vural 2009). The symbiotic and mutualistic relation between V. turcica rhizomes and microflora may be a reason for the distribution of the plant in a very narrow area. To date, microbial activity at the rhizomes of V. turcica has not been studied. To close this gap in the literature, PGPRs living on the rhizomes of V. turcica were isolated and identified.

MATERIALS AND METHODS

Collection of rhizome samples from various habitats of V. turcica

Rhizome samples were collected from 6 different locations of the habitats of V. turcica in April 2017 by the workers of Nezahat Gökyiğit Botanical Garden (NGBG) (Figure S1 – Supplementary Material). The coordinates of each sample collected were identified with a Global Positioning System (GPS; Magellan eXplorist 310) (Table I). Each rhizome sample was taken into sterile cups containing sterile distilled water. Samples were labeled according to the collected location and kept at +4°C until further analysis.

Table I
The coordinates of each rhizome sample collected from six locations of the Central Anatolia Region of Turkey.

Nodule sampling and the isolation of plant growth-promoting rhizobacteria

The collected rhizome samples were used for bacterial isolation. Nodules were removed from the rhizomes of each plant and grinded in liquid Yeast Malt (YM) medium described by Vincent (1970). The diluted rhizome-liquid YM medium mix was taken on a YM agar medium and incubated at 28°C until bacterial colonies were obtained. For the pre-selection of PGPRs, YM agar medium containing either Bromothymol blue or Congo red was used. Gram staining of the isolates was also conducted. To obtain single colonies, suspensions of bacteria were diluted in liquid medium as 1 in 6 serial dilutions and reseeded on solid medium.

Molecular analysis of the isolates

After bacteria were isolated according to their color and morphology, the isolates were characterized by amplifying 16S rRNA and 16 S-23S rRNA Internal Transcribed Spacer (ITS) region. 16S rDNA genes were amplified using D1F (5’ AGAGTTTGATCCTGGCTCAG -3’) and D1R (5’ AAGGAGGTGATCCAGCC -3’) primers and 16S-23S rDNA ITS region was identified using FGPS1490-72 (5’ TGCGGCTGGATCCCCTCCTT -3’) and FGPL132-38 (5’ CCGGGTTTCCCCATTCGG -3’) primers. Polymerase Chain Reaction (PCR) was implemented in a 25-μL reaction volume by mixing the final concentration of 5 ng DNA extract with the polymerase reaction buffer (1X), Taq DNA polymerase (0.125 U/µL), dNTPs (0.2 mM), and each primer (0.8 μM). PCR amplification was performed in a C100 Touch (Bio-Rad Laboratories, Segrate, Milan, Italy) thermal cycler adjusted to the following PCR conditions: initial denaturation at 95 °C for 7 min, 35 amplification cycles (denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 1 min), and final extension at 72°C for 5 min. Negative control (H2O; containing no template) was also used to check for experimental contamination. PCR products were checked by agarose (1%, w/v) gel electrophoresis. Isolated and purified PCR products were directly sequenced. The sequencing service was commercially provided by BM Laboratory Systems, Ankara, Turkey (https://www.bmlabosis.com/).

Sequence analysis and phylogenetic analysis

The consensus sequences of 16S rRNA and 16S-23S rRNA ITS region were used to search for similar sequences in GenBank at the National Center for Biotechnology Information (NCBI), Bethesda, USA, using the BLAST search program (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (Altschul et al. 1990). Phylogenetic analysis of the isolated bacteria was carried out by analyzing consensus sequences obtained from the amplification of 16S rRNA and 16 S-23 S rRNA ITS regions. Phylogenetic analysis was performed by the Molecular Evolutionary Genetics Analysis (MEGA) program version 7.0 (https://www.megasoftware.net/). Multiple sequence alignments were developed for both 16S and 16S-23S ITS sequences, separately. Phylogenetic trees were generated from these nucleotide sequences in the dataset using the Neighbor-Joining method based on the Kimura 2 parameter (Kimura 1980). Aligned 16S rDNA and 16S-23S rDNA ITS sequences were evaluated with bootstrap analysis (1000 replicates) (Felsenstein 1985). 2 outer sequences of Bacillus megaterium and Agrobacterium tumefaciens obtained from NCBI GenBank were included sequence dataset for sequence comparison and were aligned with both 16S rRNA gene sequence and 16S-23S ITS region sequence of isolates.

Microbial identifıcation system (MIS) analysis

MIS analysis of the bacterial isolates was implemented using gas chromatography (6890N GC, Agilent Technologies INC., USA) and MIS software (Sherlock 6.0 MIDI, Inc., Newark, DE, 2005). The resulting data were compared with the commercial database (RTSBA6). Fatty acid methyl ester (FAME) groups were identified by MIS software. The unit with the highest score between the diagnosis results was considered as the ideal result.

The 16S-23S sequences of the isolates Vt1N1, Vt1N2, Vt1N3, Vt1N4, Vt3N1, Vt3N2, Vt6N1, and Vt6N2 were submitted to GenBank under accession numbers MN565946, MN565947, MN565948, MN565949, MN565950, MN565951, MN565952, and MN565953, respectively. Also, the GenBank accession numbers of 16S sequences of the isolates Vt1N1, Vt1N2, Vt1N3, Vt1N4, Vt3N1, Vt3N2, Vt6N1, and Vt6N2 are MN561035, MN561036, MN565037, MN565038, MN565039, MN565040, MN565041, and MN565042, respectively.

RESULTS

Pre-selection of the bacteria isolated from V. turcica rhizomes

Bacterial colonies were detected at dilutions until 10-5 from the rhizome samples taken from locations 1, 3, and 6 of V. turcica. Pre-selective studies resulted in 4 isolates from location 1, and 2 isolates from locations 3, and 6.

The reaction results of isolates against Congo red, Bromothymol blue, and gram-staining were given in Table II. Images of isolates in mediums containing Congo red and Bromothymol blue were presented in Figure S2, and gram-staining results can be seen in Figure S3. The results of the Gram staining experiment of the isolates showed that all isolates were Gram-positive.

Table II
Morphological and physiological characteristics of isolated bacterial species from rhizomes of V. turcica.

Phylogenetic analysis of rhizome-isolated bacteria

After pre-selection of 8 bacteria, MIS analysis, 16S-23S rDNA ITS region, and 16S rRNA gene sequence analysis were implemented on these isolates. gDNAs were extracted from the bacterial isolates for molecular analysis. 16S rRNA and 16S-23S rDNA ITS regions of each isolate gDNAs were amplified and sequenced using the primers mentioned above. Consensus sequences (Tables SI and SII – Supplementary Material) were used for the identification of the isolates using the BLAST search program. According to the BLAST result, the 16S rDNA sequences of isolates, high sequence similarities with Bacillus aryabhattai (≥99 coverage and identity) was found in all isolates (Table III). The BLAST result also showed that isolate Vt6N1 has a 100% sequence similarity with B. aryabhattai and B. megaterium (Table III). On the other hand, BLAST results based on the 16S-23S rDNA ITS region sequences of isolates showed high sequence similarities with Bacillus megaterium (≥99 coverage and identity) were found in all isolates.

Table III
Sequence similarities according to the BLAST search against NCBI database based on identified 16S rRNA and 16S-23S rDNA ITS sequences.

The phylogenetic trees generated using 16S rRNA and 16S-23S ITS analysis results of the isolates were shown in Figure 1 and Figure 2, respectively. The 8 isolates were clustered into three branches by comparison of the sequences identified from the 16S rDNA PCR profiles (Figure 1). Isolates Vt1N1, Vt1N2, Vt1N3, Vt1N4, Vt3N1, and Vt3N2 were pooled together into the same branch, but Vt6N1 and Vt6N2 were grouped into the different branches (Figure 1). According to the phylogenetic tree constructed based on the 16S-23S rDNA ITS region sequence, Vt1N3 was clustered into different branches, and other isolates were clustered with GenBank sequences (FJ969767.1) of B. megaterium (Figure 2). In both phylogenetic constructs based on the sequences of 16S rDNA and 16S-23S rDNA ITS region of isolates with two out-groups, Agrobacterium tumefaciens was clustered on different sub-branches.

Figure 1
Neighbor-joining tree based on partial sequences of 16S rDNA region of the isolates with each other for phylogenetic inference. The evolutionary history was inferred using the N-J method (Saitou & Nei 1987) with the Kimura-2 parameter method (Kimura 1980). NR_117473.1 (Bacillus megaterium) and DQ458962.1 (Agrobacterium tumefaciens) were used as an out-group.
Figure 2
Neighbor-joining tree based on partial sequences of 16S-23S rDNA ITS region of the isolates with each other for phylogenetic inference. The evolutionary history was inferred using the N-J method (Saitou & Nei 1987) with the Kimura-2 parameter method (Kimura 1980). FJ969767.1 (Bacillus megaterium) and AF271644.1 (Agrobacterium tumefaciens) were used as an out-group.

MIS results

The bacterial identity of the isolates was tried to be revealed by analyzing their FAME groups with MIS. As a result of MIS analysis, B. megaterium was the most dominantly colonized bacteria on the rhizomes of V. turcica (Table IV).

Table IV
MIS results of the bacteria isolated from rhizomes.

DISCUSSION

Microorganism identification is essential for various applications, such as industrial and environmental studies. In this study, to identify which bacterial species are useful for the growth of V. turcica, rhizomes of the plant were obtained from the plants grown in 6 different natural habitats given in Table I. YM medium is a selective medium for the reproduction of Rhizobium sp. and Agrobacterium sp. Since Agrobacterium sp. can absorb Congo red dye, the color of the colonies of this bacterial genus is red and shades when grown on YM medium, including Congo red dye, whereas Rhizobium sp. colonies are white and orange on that of medium (Kado & Heskett 1970). Also, yellow color formation in a medium containing Bromothymol blue is indicative of acid formation in a medium; thus, this medium acts as a pH indicator, and isolates can be classified as alkalizers or acid producers. For nitrogen fixation and nodulation, acid producers are essential (Boakye et al. 2016). Since to identify various types of rhizobacteria which are active in the growth and physiology of V. turcica was aimed in this study, 8 isolates that differed from each other in terms of their color, shape, and morphology were chosen from many colonies (~100 colonies) according to their reactions in selective media mentioned above. No laboratory contaminants were detected on the bacterial strains. Bacterial colonies from the samples belonging to locations 2, 4, and 5 were not obtained. It could be possible due to chemical usage during surface sterilization. Morphological and physiological analysis indicated that four isolates (Vt1N1, Vt1N2, Vt3N1, and Vt3N2) were acid producers, and all isolates were Gram-positive.

In order to identify a bacterial species, the rRNA sequence-based analysis is mostly preferred. 16S rRNA gene of bacterial species contains highly conserved regions; therefore, 16S rRNA analysis is used for the characterization of new strains. On the other hand, since both the sequence and the length of the 16S-23S rDNA ITS region can vary considerably between bacterial species, this region is also essential for the identification of microorganisms (Hoffmann et al. 2010).

The BLAST result of the 16S-23S rDNA ITS region sequence showed that the isolates have ≥99% sequence similarity (Table III). Also, 16S-23S rDNA ITS region sequence and 16S rDNA gene sequence-based phylogenetic trees were generated, which show the relationship between the isolates and selected outer groups (Figures 1 and 2). As a result of MIS analysis and 16S-23S rRNA ITS region sequence to identify the bacterial isolates from rhizomes of V. turcica, Bacillus megaterium was the dominant bacterial species (Tables III and IV). On the other hand, according to BLAST analysis of the 16S rDNA sequences of the isolates, B. aryabhattai was the dominant bacterial species. It is known that the colony color of B. megaterium is white/cream, and B. aryabhattai is peach-colored from the previous study (Shivaji et al. 2009). In this study, the isolates were identified as B. megaterium as a result of the colony colors of the isolates and molecular studies (Figure S4).

The ability of B. megaterium to metabolize different root exudates as a carbon source might have put this species one step forward than other bacteria while competing for colonization. More chances to find nutrition can result in better colonization. As this bacteria enhances the photosynthetic activity by accumulating the N in the plant, higher amounts of photosynthates would be produced and utilized by the bacteria as a carbon source. This mutualistic loop might be one of the reasons why the microflora on the V. turcica rhizomes is dominated by B. megaterium. Plants have a significant role in controlling the bacterial community and the diversity of the root-associated bacteria (Germida et al. 1998). V. turcica has rhizome and nitrogen fixation (acetylene reduction) associated with rhizomes. Various plants with B. megaterium root-inoculation showed significant growth with increased total plant N and N-fixing activities compared to control plants (Elkoca et al. 2007). B. megaterium has been found to contain nitrogenase iron protein (NifH) genes, which encode essential enzymes taking a role in N-fixing mechanisms, and those genes are widely used as marker genes to identify N-fixing bacteria (Ding et al. 2005, Gaby & Buckley 2012). In light of this information, it is assumed that B. megaterium has growth-promoting effects on V. turcica plants by fixing or helping to fixate N.

Plant growth-promoting activity between B. megaterium and host plants was reported many times in the literature (López-Bucio et al. 2007, Liang et al. 2011, Chakraborty et al. 2012). It was known from the previous study that B. megaterium was endophytic bacterial species in legume plants and promotes plant growth (Khalifa & Almalki 2015). It has been shown that B. megaterium application on tea plants leads to the accumulation of phenolic compounds in the leaves, a compound reported to be related to plant resistance against various stresses (Chakraborty et al. 2012). Curcuma longa has a rhizomic root structure like V. turcica, and turmeric plants had shown an increase in compounds related to induced systemic resistance (ISR) and prevention from fungal infections when B. megaterium were present at their rhizomes (Uthandi & Sivakumaar 2013). Expression levels of superoxide dismutase and catalase, together with the previously mentioned ISR-related enzymes, were observed to be higher in B. megaterium inoculated cucumber plants in means of defense against fungal infection (Liang et al. 2011). This endophytic presence of this bacterium might have protective effects on the rhizomes against invasive pathogens. B. megaterium is also found in the natural habitat of V. turcica, but V. turcica is only found in a restricted area in Central Anatolia (Tekdal et al. 2018). This bacterium probably plays a crucial role in the survival of this plant. The indirect growth-promoting ability of B. megaterium consists of antibiotic production. It has been previously shown that this bacterium is capable of producing antibiotics such as bacimethrin, cytidines, oxetanocin, iturin, bacillomycin, zwittermycin A, surfactin and other fungitoxins (Malanicheva et al. 2012, Uthandi & Sivakumaar 2013). B. megaterium might contribute to V. turcica growth indirectly with this antimicrobial activity, and this might explain the colonial dominance of this bacterium at V. turcica rhizomes.

CONCLUSION

Identification of beneficial rhizobacterial species promoting V. turcica growth in this study has shown that there was a strong dominance of B. megaterium at the rhizomes of V. turcica. The finding of this study might be a clue for further explanations on the endemism of V. turcica.

Further investigations on testing the direct PGPR effect on V. turcica and on secondary metabolite production ability, which is essential to convert soil minerals into available forms for plant roots to absorb, should be carried out.

ACKNOWLEDGMENTS

The authors are grateful to Ali Nihat Gökyiğit and Prof. Dr. Adil Güner (Nezahat Gökyiğit Botanical Garden - NGBG) and would like to thank Ömer Demir (Nezahat Gökyiğit Botanical Garden - NGBG) for helping with the collecting samples. This work was supported by the Ali Nihat Gökyiğit Foundation of Turkey.

REFERENCES

  • AHEMAD M, KHAN S, ZAIDI A & WANI PA. 2009. Remediation of herbicides contaminated soil using microbes in sustainable agriculture. In: Khan MS, Zaidi A & Musarrat J (Eds), Microbes in Sustainable Agriculture, Nova Science Publishers, New York, USA.
  • AHEMAD M & KIBRET M. 2014. Mechanisms and applications of plant growth promoting rhizobacteria: Current perspective. J King Saud Univ – Sci 26: 1-20.
  • ALTSCHUL SF, GISH W, MILLER W, MYERS EW & LIPMAN D. 1990. Basic local alignment search tool. J Mol Biol 215: 403-410.
  • BOAKYE EY, LAWSON IYD, DANSO SKA & OFFEI SK. 2016. Morphological, physiological, cultural characteristics, and IAA production of PGPR bacterial strains isolated from the wheat rhizosphere. Symbiosis 69: 89-99.
  • CHAKRABORTY U, CHAKRABORTY BN & CHAKRABORTY AP. 2012. Induction of plant growth Promotion in Camellia sinensis by Bacillus megaterium and its bioformulations. World J Agric Sci 8: 104-112.
  • DING Y, WANG J, LIU Y & CHEN S. 2005. Isolation and identification of nitrogen-fixing Bacilli from plant rhizospheres in Beijing Region. J Appl Microbiol 99: 1271-1281.
  • ELKOCA E, KANTAR F & SAHIN F. 2007. Influence of nitrogen fixing and phosphorus solubilizing bacteria on the nodulation, plant growth, and yield of chickpea. J Plant Nutr 31: 157-171.
  • FELSENSTEIN J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evol 39: 783-791.
  • GABY JC & BUCKLEY DH. 2012. A comprehensive evaluation of PCR primers to amplify the nifH gene of nitrogenase. PLoS ONE 7: e42149. doi: 10.1371/journal.pone.0042149.
  • GERMIDA JJ, SICILIANO SD, RENATO DE FREITAS J & SEIB AM. 1998. Diversity of root-associated bacteria associated with fieldgrown canola (Brassica napus L.) and wheat (Triticum aestivum L.). FEMS Microbiol Ecol 26: 43-50.
  • GLICK BR, CHENG Z, CZARNY J & DUAN J. 2007. Promotion of plant growth by ACC deaminase-producing soil bacteria. Eur J Plant Pathol 119: 329-339.
  • HOFFMANN ET AL. 2010. PCR-based method for targeting 16S-23S rRNA intergenic spacer regions among Vibrio species. BMC Microbiol 10: 90.
  • KADO CI & HESKETT MG. 1970. Selective media for isolation of Agrobacterium, Corynebacterium, Erwinia, Pseudomonas and Xanthomonas. Phytopathology 60: 969-976.
  • KHALIFA AYZ & ALMALKI MA. 2015. Isolation and characterization of an endophytic bacterium, Bacillus megaterium BMN1, associated with root-nodules of Medicago sativa L. growing in Al-Ahsaa Region, Saudi Arabia. Ann Microbiol 65: 1017-1026.
  • KIMURA M. 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16: 111-120.
  • LIANG JG, TAO RX, HAO Z, WANG LP & ZHANG X. 2011. Induction of resistance in cucumber against seedling damping-off by plant growth-promoting rhizobacteria (PGPR) Bacillus megaterium Strain L8. Afr J Biotechnol 10: 6920-6927.
  • LÓPEZ-BUCIO ET AL. 2007. Bacillus megaterium rhizobacteria promote growth and alter root-system architecture through an auxin-and ethylene-independent signaling mechanism in Arabidopsis thaliana. Mol Plant Microbe In 20: 207-217.
  • MALANICHEVA IA, KOZLOV DG, SUMARUKOVA IG, EFREMENKOVA OV & ZENKOVA VA. 2012. Antimicrobial activity of Bacillus megaterium strains. Microbiol 81: 178-185.
  • SAITOU N & NEI M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406-425.
  • SHIVAJI S, CHATURVEDI P, BEGUM Z, PINDI PK & MANORAMA R. 2009. Janibacter hoylei sp. nov., Bacillus isronensis sp. nov. and Bacillus aryabhattai sp. nov., isolated from cryotubes used for collecting air from the upper atmosphere. Int J Sys Evol Microbiol 59: 2977-2986.
  • TAN K, VURAL M & KUCUKODUK M. 1983. An unusual new Thermopsis from Turkey. Notes Roy Bot Gard, Edinburgh.
  • TEKDAL D, CINGAY B & CETINER MS. 2018. Determination of soil nutrient status in Vuralia turcica populations growing at different locations in the Central Anatolia Region of Turkey. Turk J Bot 42: 317-326.
  • UTHANDI B & SIVAKUMAAR PK. 2013. Bacillus megaterium (AUM72)-mediated induction of defense related enzymes to enhance the resistance of turmeric (Curcuma longa L.) to Pythium aphanidermatum causing rhizome rot. Agr Sci J 10: 1-8.
  • UYSAL T, ERTUĞRUL K & BOZKURT M. 2014. A new genus segregated from Thermopsis (Fabaceae: Papilionoideae): Vuralia. Plant Syst Evol 300: 1627-1637.
  • VINCENT JM. 1970. A manual for practical study of root nodule bacteria. IBP Handbook No. 15, Blackwell Scientific Publishers, Oxford, 164 p.
  • VURAL M. 2009. Piyan (Thermopsis turcica). Bağbahçe 25: 14-16.
  • WALKER TS, BAIS HP, GROTEWOLD E & VIVANCO JM. 2003. Root exudation and rhizosphere biology. Plant Physiol 132: 44-51.

Publication Dates

  • Publication in this collection
    07 Jan 2022
  • Date of issue
    2022

History

  • Received
    26 Nov 2019
  • Accepted
    29 Jan 2020
location_on
Academia Brasileira de Ciências Rua Anfilófio de Carvalho, 29, 3º andar, 20030-060 Rio de Janeiro RJ Brasil, Tel: +55 (21) 2391-7901 - Rio de Janeiro - RJ - Brazil
E-mail: aabc@abc.org.br
rss_feed Acompañe los números de esta revista en su lector de RSS
Ir para arriba Notificar error