Open-access Molecular data reveal multiple lineages of Scinax nebulosus (Spix, 1824) (Anura: Hylidae) with Plio-Pleistocene diversification in different Brazilian regions

Abstract

To understand the organism’s history, we can start assessing the complexity of the biome where they occur. In this study, we used a region of the mitochondrial genome, the rRNA 16S, to evaluate the genetic differentiation in Scinax nebulosus along with its geographical range highlighting important Brazilian biomes as Restinga, Cerrado, Amazon, and Atlantic Forest. Geographically structured genetic divergence was observed within the species S. nebulosus. The values of the fixation index (Фst) and the pairwise Fst index were high and significant regarding this structuring. Besides, the haplotype network corroborates these results with the haplotypes arrangement found by separating the S. nebulosus populations in two major groups: North and Northeast. The lineage delimitation analyses indicate the occurrence of several lineages with divergence mainly between the samples from the Northeast group. Thus, we can suggest that S. nebulosus may present itself as a group of cryptic species due to the genetic characteristics found. The existence of a mosaic of heterogeneous habitats may explain the genetic divergence found, which justifies the existence of cryptic species in this group. However, this hypothesis needs more detail in molecular studies, including large sample sizes and other population and demographic analyses.

Key words
Anurans; Biomes; Molecular biology; Population structuring

INTRODUCTION

The genus Scinax Wagler, 1830 (Anura: Hylidae) was included in the Scinaxinae subfamily after a new taxonomic and phylogenetic revision of the Hylidae family (Duellman et al. 2016). The genus comprises 72 species distributed throughout the American continent, occurring from southern Mexico to Argentina, Uruguay, Trinidad and Tobago, and Saint Lucia (Nunes et al. 2012, Duellman et al. 2016, Frost 2020). Its wide distribution and diversity are associated with different habitats where these species can be found, e.g. open areas of scarce vegetation, deciduous, semi-deciduous and ombrophilous forests, gallery and riparian forest (Faivovich 2002).

Some Scinax species are not yet well defined given the possibility of cryptic complexes among them (Fouquet et al. 2007, Ferrão et al. 2016, 2017), especially those with a wide range as Scinax nebulosus (Spix, 1824). Since its discovery, the species has been characterized and named several times. First, recognized as Hyla egleri (Lutz, 1968) for specimens collected in Belém, state of Pará (Lutz, 1968). Later, it was redescribed as Ololygon egleri (Fouquette & Delahoussaye 1977), then O. nebulosus (Hoogmoed & Gruber 1983), after that S. nebulosa (Duellman & Wiens 1992), until the current designation of S. nebulosus (Köhler & Böhme 1996).Scinax

nebulosus shows an arboreal lifestyle and wide geographical distribution. It is found in Brazil, Bolivia, Guianas, Suriname, and Venezuela. In Brazil, S. nebulosus is found in the Amazon Basin, Center-West, and in the Northeast (Dias et al. 2015). In general, the species is associated with temporary water bodies in the tropical forest. It is also found in open areas of Cerrado as well as in anthropogenic habitats like pastures and gardens (La Marca et al. 2004, Dias et al. 2015). These associations may drive the distribution of species with limited mobility characteristics such as amphibians (Lourenço et al. 2009, Sturaro & Peloso 2014).

Lutz (1973) morphologically described S. nebulosus as a species with a great number of glands all over the dorsum (in the head, upper eyelids, limb margins). However, these features are not enough to differentiate S. nebulosus from other species in the genus, such as S. pedromedinae (Henle 1991) occurring in the Brazilian Amazon and northern Peru. It is worth mentioning that specimens of S. nebulosus from the Center-West Brazil and Bolivia may be specimens of S. pedromedinae (Henle, 1991) (Hoogmoed & Avila-Pires 2011). Moreover, comparisons of S. nebulosus vocal repertory record with other sympatric congeners suggests the need for a careful assessment of this species taxonomic status along with its geographical distribution (Lima et al. 2004).

However, S. nebulosus is still considered as valid species with distribution in central and north of South America (Dias et al. 2015). In general, terrestrial organisms spread over this area may have discontinuities in its distribution in response to climate change and geological events that occurred during the Plio-Pleistocene (Bell et al. 2012, Menezes et al. 2016).

Bell et al. (2012) investigated how Pleistocene refugia interfered with genetic differentiation in continental and island populations, and the role of forest fragmentation in this differentiation. Pleistocene biogeographic events have been traditionally related to the process of population structuring and vertebrate speciation (Avise et al. 1998). Menezes et al. (2016) evaluated the genetic structure of Scinax eurydice (Bokermann, 1968) and they observed events of lineage segregation that occurred at the end of Pliocene to Pleistocene. Pleistocene climate fluctuations played a key role in the distribution of diversity and endemism in Brazilian biomes. For amphibians, these fluctuations may indicate new lineages spanning climatically distinct regions.

The wide geographical distribution of S. nebulosus is a constant subject of discussion, questioning the correct identification of populations, which has been made only from vocalization and morphological data (Duellman et al. 2016). Thus, this species may present inter-population variations associated with Plio-Pleistocene climate events. In this context, we tested this hypothesis using molecular data by performing an analysis of the genetic diversity of S. nebulosus from mitochondrial markers to increase the level of knowledge about its taxonomic status.

MATERIALS AND METHODS

Specimens sampling and DNA extraction, PCR and sequencing

The specimens of S. nebulosus were collected in fieldwork and obtained from zoological collections, totaling 52 specimens analyzed from 13 localities (Figure 1, Table I, Table SI – Supplementary Material). The collections of this project were carried out under authorization from the Instituto Chico Mendes de Conservação da Biodiversidade (ICMBio), through permanent license number 52593-3. Subsequently, we removed muscle tissue samples from hind limbs, placed in 1.5 ml microtubes, and stored in 100% ethanol. The specimens were fixed in 10% formaldehyde solution, stored in 70% ethanol, and deposited in the Herpetological Collection of the Universidade Federal do Maranhão (CHUFMA).

Figure 1
Map identifying the locations of origin of the Scinax nebulosus specimens used in this study.
Table I
Genetic diversity indices obtained for the 16S gene from Scinax nebulosus populations used in the present study. N = number of individuals, Hap = number of haplotypes, h = haplotype diversity, π = nucleotide diversity, sd = standard deviation.

The genomic DNA isolation followed Sambrook & Russel (2001) protocol. We utilized the rRNA 16S marker in the analyses; we amplified it by PCR, using the primers described by Palumbi et al. (1991): L1987–5’ GCCTCGCCTGTTTACCAAAAAC 3’ e H2609–5’-CCGGTCTGAACTCAGATCACGT 3’, under the followed amplification conditions: initial denaturation at 94°C for 5 min, 25 cycles of 1 min at 94°C, 1 min at 50°C and 2 min at 72°C and final extension at 72°C for 5 min. After amplification, the samples were subjected to sequencing reactions using the Big Dye Terminator Kit (Applied Biosystems), following the manufacturer’s recommendations, and then injected into the ABI 3500 automated sequencer.

Data analyses

We aligned the sequences in BioEdit (Hall 1999) using the automatic alignment tool ClustalW (Thompson et al. 1994), followed by visual inspection to detect identification base errors. To estimate the genetic variability of the possible populations, the pairwise genetic differentiation indices (Fst), fixation index (Φst), Analysis of Molecular Variance (AMOVA) and the number of haplotypes were estimated in the software Arquelin v. 3.5 (Excoffier & Lischer 2010). Haplotype diversity index (h) and nucleotide diversity (π) were estimated in DnaSP v.5 (Librado & Rozas 2009). We tested the hypotheses of selective neutrality using the D tests (Tajima 1989) and demographic expansion through Fs-statistics (Fu 1997).

We estimated genetic distance within and between populations in MEGA v. 7 (Kumar et al. 2016) using the evolutionary model K2P (Kimura 1980). Later, the genealogical relationship between haplotypes was obtained through a haplotype network created in the Haploviewer software (Salzburger et al. 2011) using the maximum likelihood algorithm determined in the jModelTest 2 (Darriba et al. 2012).

Bayesian Inference tree was constructed in Mr. Bayers on the CIPRES Science Gateway (Miller et al. 2010). The nucleotide substitution model was chosen from the analysis performed in jModeltest2 (Darriba et al. 2012), in which the GTR+G was indicated as the best model to fit the data set. Because S. nebulosus has doubts about its correct identification and geographical distribution, in which there are more than one species or population misidentification based on morphological and vocalization data (Lima et al. 2004, Hoogmoed & Avila-Pires 2011, Dias et al. 2015), we chose two analysis using genetic distance to classification and identification of lineage: Automatic Barcoding Gap Discovery (ABGD) (Puillandre et al. 2012) and Generalized Mixed Yule Coalescent (GMYC) (Pons et al. 2006).

The ABGD analysis (Puillandre et al. 2012) was performed on the web interface (https://bioinfo.mnhn.fr/abi/public/abgd/abgdweb.html) following the priors, according to Ferrão et al. (2016), Kimura 2 parameter (K2P) nucleotide substitution model, ten recursive steps, gap width of 1.0 and value of intraspecific divergence of 0.03 (3%). In general, a divergence of 3% in the 16S gene in neotropical frogs, in this analysis, is recommended to identify different lineages (Vences et al. 2005, Fouquet et al. 2007). GMYC analysis (Pons et al. 2006) was implemented in the SPLITS package in R (R Core Team 2019). This analysis requires an ultrametric genealogical tree, estimated in BEAST 2.3.6. (Bouckaret et al. 2014), available in CIPRES Science Gateway (Miller et al. 2010). To obtain the ultrametric genealogical tree, a lognormal relaxed clock with a substitution rate of 0.00735 was constructed (Ferrão et al. 2016), with 50 million generations and burn-in of 10%.

RESULTS

The sequences from the rRNA 16S marker were 543 pb. The generated haplotype network (Figure 2) showed a sub-structure of the sample in two large groups: North and Northeast. The presence of exclusives haplotypes corroborates the high haplotypic (h) and nucleotide (π) diversity (Table I). The selective neutrality tests (Fs and D) were not significant for the sampled populations. Populations from the Alagoas and Goiás showed only one haplotype, which was not enough to make inferences of any indices.

Figure 2
Haplotype network for Scinax nebulosus populations. The colors represent the following populations: White: Maranhão, Blue: Alagoas, Yellow: Pará; Green: Mato Grosso, Red: Goiás, Orange: Rio Grande do Norte.

The genetic distances obtained indicate the structure of the sample with a high divergence index between North and Northeast groups as well as the haplotype network. The largest genetic distances were calculated between the samples from the Rio Grande do Norte (RN) x Mato Grosso (MT), RN x Pará (PA), and RN x Goiás (GO) (6.9%, 5.9%, and 5.9% from divergence, respectively), GO and MT (5.7%) and MT and Maranhão (MA) (5.1%), while the distance between the samples of Alagoas (AL) and MA was only 1% (Table II). Rio Grande do Norte presented greater genetic distance when compared to MA and AL.

Table II
Estimated genetic distance (p-distance) for the 16S gene for Scinax nebulosus populations at the locations listed below. PA = Pará, MT = Mato Grosso, MA = Maranhão, AL = Alagoas, RN = Rio Grande do Norte, GO = Goiás.

The AMOVA results (Table III) showed that the accumulated genetic variance between the groups was greater than within the groups. Nevertheless, a significant structure (Фst= 0.62) was observed in the sample. The comparison of Fst values (Table IV) maintained the high values among all population pairs, being smaller only between the RN samples and the other localities.

Table III
AMOVA values of Scinax nebulosus populations used in the present study. Фst = Fixation index.
Table IV
Estimated pairwise Fst for the 16S gene for the Scinax nebulosus populations used in the present study. PA = Pará, MT = Mato Grosso, MA = Maranhão, AL = Alagoas, RN = Rio Grande do Norte, GO = Goiás.

Lineage delimitation analyses indicate the occurrence of 7 (ABGD) and 12 (GMYC) lineages, with divergences mainly between the samples from the Northeast group (Figure 3). In ABGD, samples from AL, MA, and RN are considered to belong to a single lineage, while GMYC delimited 4 lineages for these samples. Since S. nebulosus is a group with doubts about the correct identification along with its distribution and we do not have morphological data or vocalization to compare with our results, we chose to follow the most conservative result of these analyses, considering that we have 7 lineages in our sample.

Figure 3
Bayesian Inference Tree for the 16S gene from the sampled populations of Scinax nebulosus. Black bars represent the results of the two lineages delimitation analyses. Numbers in branches indicate posterior probability values. ABGD= Automatic Barcode Gap Discovery, GMYC= Generalized Mixed Yule Coalescent.

Molecular clock analysis (Figure 4) identified that a single sample from RN presents an 8.7 Ma divergence from the other samples and the GO samples presented 4.3 Ma divergence. Among the other samples, we identified a separation between the North and Northeast with 2.7 Ma groups, and within these groups, subsequent most recent separations.

Figure 4
Relaxed molecular clock for the 16S gene from the sampled populations of Scinax nebulosus.

DISCUSSION

Scinax nebulosus is a species with wide geographical distribution, ranging from Venezuela to Guiana, Suriname, Bolivia, and Brazil (Central-West, North, and Northeast) (Dias et al. 2015, Frost 2020). This wide geographical distribution has been a source of controversy over the correct identification of populations of this species, where some authors believe the populations of northeastern Brazil constitute a different species from the populations of northern and western Brazil and Bolivia, based on morphological and vocalization data (Lima et al. 2004, Hoogmoed & Avila-Pires 2011, Dias et al. 2015).

Our results indicated the occurrence of genetic structuring in the sampled populations, from these data is also possible to infer greater genetic proximity of the individuals from Northeast (MA, AL, and RN) concerning PA, GO, and MT populations. This corroborates the hypotheses that the Northeast and North groups constitute distinct species. São Pedro (2014) performing a phylogeographic analysis of Phyllomedusa (= Pithecopus) (Anura, Hylidae) with the objective of recognizing cryptic species, as well as the elements involved in the diversification processes, observed high haplotypic diversity, high Fst index among lineages, and the genetic distance calculations indicated a difference between and within the lineages, which results are similar to those found by us.

High genetic diversity and population structure were also found in other Brazilian anuran species like Proceratophrys boiei (Lynch 1971), (Prado & Pombal Jr 2008) (Odontophrynidae) and Ischnocnema gr. ramagii (Boulenger, 1888) (Brachycephalidae) in the highlands enclave in Northeast (Carnaval & Bates 2007); species of Phyllomedusa gr. burmeisteri (Boulenger, 1882) (Phyllomedusidae) in Atlantic Forest Atlântica and Brazilian Pampas (Brunes et al. 2010), Rhinella gr. crucifer (Wied-Neuwied, 1821) (Bufonidae) in Atlantic Forest (Thomé et al. 2010), and Hypsiboas albopunctatus (Spix, 1824) (Hylidae) in Cerrado (Prado et al. 2012).

Brunes et al. (2014) and São Pedro (2014) highlight that genetic differentiation found in many studies about anurans has its origin related to vicariant events occurring in the Neogen and Quarternary periods, specifically since the end of the Pliocene and during the Pleistocene. Pleistocene refugia hypothesis, first proposed to explain the Amazon diversity, attributes the speciation process to the expansion and retraction biome dynamics during the Plio-Pleistocene transition period (Haffer 1969, Haffer & Prance 2002)

Although these events are not sufficient to explain the structure among populations of S. nebulosus, they seem to be the key to explaining the diversification of this species. For this Menezes et al. (2016), in an analysis of S. eurydice (Bokermann, 1968) (Anura, Hylidae), used molecular data to reveal the Plio-Pleistocene diversification proposed by the Pleistocene refugia theory. Scinax eurydice shows high genetic divergences in the lineages analyzed and the formation of two major clades corresponding to Northeast and Southeast groups (Menezes et al. 2016), as well as our populations of S. nebulosus also presented this structure to Northeast and North groups.

Bell et al. (2012) investigated how Pleistocene refugia influenced the genetic diversification in some species from Scinax perpusillus group. Through the analysis of mitochondrial markers, they obtained structured lineages and high genetic diversity in the populations of the S. perpusillus species group. According to these authors, this structure is explained by the separation of populations between island and continent, since it deals with a fragment of Atlantic Forest. In addition, they also emphasize that this phylogeographic barrier is not known, but it occurs consistently. As presented by Bell et al. (2012), we could not identify the barrier responsible for the structuring found in the present study within S. nebulosus. These differences only demonstrate that species variation can occur in response to a shared climate history and indicate that further studies are needed to understand the roles of Pleistocene refugia and biogeographic barriers in anuran amphibian diversification.

Thus, we may suggest the existence of a mosaic of heterogeneous habitats that may be of great importance to anuran species, although this hypothesis needs further detail in molecular studies, including large sample sizes and other population and demographic analyses.

Besides, amphibians may be of particular interest in the investigation of diversification processes due to a tendency to present a strong genetic structure (Johns & Avise 1998), thus being considered excellent models in phylogeographic studies (Zeisset & Beebee 2008, Nuñez et al. 2011). Furthermore, they are more prone to the existence of cryptic species (Bickford et al. 2007, Fouquet et al. 2007), as already noted for some taxa in the Cerrado, Caatinga, and Atlantic Forest (Prado et al. 2012, Fouquet et al. 2013, Viega-Menoncello et al. 2014).

ACKNOWLEDGMENTS

We are especially grateful to all the scientific collections that provided samples for analysis in the present study and would also like to thank the students from Universidade Federal do Maranhão (UFMA) that collected specimens in the field, through permanent license number 52593–3. We thank J. Albert for revising the manuscript. We are also grateful to Fundação de Amparo à Pesquisa e ao Desenvolvimento Científico e Tecnológico do Maranhão (FAPEMA) for financial support through the Universal Research Program 0611/13. This study is part of TMBF’s doctoral thesis.

REFERENCES

  • AVISE JC, WALKER D & JOHNS GC. 1998. Speciation durations and Pleistocene effects on vertebrate phylogeography. Proc R Soc Lond B 265: 1707-1712.
  • BELL RC, BRASILEIRO CA, HADDAD CFB & ZAMUDIO KR. 2012. Evolutionary history of Scinax treefrogs on land-bridge islands in south-eastern Brazil. J Biogeog 39: 1733-1742.
  • BICKFORD D, LOHMAN DJ, SODHI NS, NG PK, MEIER R, WINKER K & DAS I. 2007. Cryptic species as a window on diversity and conservation. Trends Ecol Evol 22(3): 148-155.
  • BOUCKARET R, HELED J, KÜHNERT D, VAUGHAN T, WU CH & XIE D. 2014. BEAST 2: a software platform for Bayesian Evolutionary Analysis. PLoS Comput Biol 10: e1003537.
  • BRUNES TO, ALEXANDRINO J, BAÊTA D, ZINA J, HADDAD CFB & SEQUEIRA F. 2014. Species limits, phylogeographic and hybridization patterns in Neotropical leaf frogs (Phyllomedusinae). Zool Scr 43: 586-604.
  • BRUNES TO, SEQUEIRA F, HADDAD CFB & ALEXANDRINO J. 2010. Gene and species trees of a Neotropical group of treefrogs: Genetic diversification in the Brazilian Atlantic forest and the origin of a polyploid species. Mol Phylogenet Evol 57: 1120-1133.
  • CARNAVAL AC & BATES JM. 2007. Amphibian DNA shows marked genetic structure and tracks Pleistocene climate change in northeastern Brazil. Evolution 61: 2942-2957.
  • DARRIBA D, TOBOADA GL, DOALHO R & POSADA D. 2012. jModelTest 2: more models, new heuristics and high performance computing. Nat Methods 9(8): 772.
  • DIAS EJR, ALMEIDA RPS, XAVIER MA, MOTA ML, LIMA AC & ROSÁRIO IR. 2015. Scinax nebulosus (Spix, 1824) (Amphibia: Hylidae): review of distribution and new record from Sergipe, Brazil. Check List 11(3): 1660.
  • DUELLMAN WE, MARION AB & HEDGES SB. 2016. Phylogenetics, classification, and biogeography of the treefrogs (Amphibia: Anura: Arboranae). Zootaxa 4104(1): 1-109.
  • DUELLMAN WE & WIENS JJ. 1992. The status of the hylid frog genus Ololygon and the recognition of Scinax Wagler, 1830. Occas Pap Mus Nat Hist 51: 1-23.
  • EXCOFFIER L & LISCHER HEL. 2010. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour 10: 564-567.
  • FAIVOVICH J. 2002. A cladistic analysis of Scinax (Anura: Hylidae). Cladistics 18: 367-393.
  • FERRÃO M, COLATRELI O, FRAGA R, KAEFER IL, MORAVEC J & LIMA AP. 2016. High species richness of Scinax Treefrogs (Hylidae) in a threatened Amazonian Landscape revealed by an integrative approach. PLoS ONE 11(11): e0165679.
  • FERRÃO M, MORAVEC J, DE FRAGA R, ALMEIDA AP, KAEFER IL & LIMA AP. 2017. A new species of Scinax from the Purus-Madeira interfluve, Brazilian Amazonia (Anura, Hylidae). ZooKeys 706: 137-162.
  • FOUQUET A, CASSINI CS, HADDAD FBC, PECH N & TREFAUT MR. 2013. Species delimitation, patterns of diversification and historical biogeography of the Neotropical frog genus Adenomera (Anura, Leptodactylidae). J Biogeog 41: 855-870.
  • FOUQUET A, VENCES M & SALDUCCI MD. 2007. Revealing cryptic diversity using molecular phylogenetics and phylogeography in frogs of the Scinax ruber and Rhinella margaritifera species groups. Mol Phylogenet Evol 43: 567-582.
  • FROST DR. 2020. Amphibian Species of the World: an Online Reference. Version 6.0 [June, 2020], Accessible at https://amphibiansoftheworld.amnh.org/
    » https://amphibiansoftheworld.amnh.org/
  • FU YX. 1997. Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 147: 915-925.
  • HAFFER F. 1969. Speciation in Amazonian Forest Birds. Science 165: 3889.
  • HAFFER J & PRANCE GT. 2002. Impulsos climáticos da evolução na Amazônia durante o Cenozóico: sobre a teoria dos Refúgios da diferenciação genética. Estud Av 16: 46.
  • HALL TA. 1999. BIOEDIT: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Ac Symp Series 41: 95-98.
  • HOOGMOED MS & AVILA-PIRES TCS. 2011. On the presence of Scinax pedromedinae (Henle, 1991) (Amphibia: Anura: Hylidae) in Amazonian Brazil and northern Peru. Bol Mus Para Emilio Goeldi Cienc Naturais 6(3): 263-271.
  • JOHNS GC & AVISE JC. 1998. A comparative summary of genetic distances in the vertebrates from the mitochondrial cytochrome b gene. Mol Biol Evol 15: 1481-1490.
  • KIMURA M. 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16: 111-120.
  • KÖHLER J & BÖHME W. 1996. Anuran amphibians from the region of Pre-Cambrian rock outcrops (inselbergs) in northeastern Bolivia, with a note on the gender of Scinax Wagler, 1830 (Hylidae). Rev Fr Aquariol Herpetol 23: 133-140.
  • KUMAR S, STECHER G & TAMURA K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol 33(7): 1870-1874.
  • LA MARCA E, REYNOLDS R & AZEVEDO-RAMOS C. 2004. Scinax nebulosus. The IUCN Red List of Threatened Species 2004: e.T55981A11390516.
  • LIBRADO P & ROZAS J. 2009. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 1451-1452.
  • LIMA LP, BASTOS RP & GIARETTA AA. 2004. A new Scinax Wagler, 1830 of the rostratus group from Central Brasil (Amphibia, Anura, Hylidae). Arq Mus Nac 62: 505-512.
  • LOURENÇO ACC, NASCIMENTO LB & PIRES MRS. 2009. A new species of the Scinax catharinae species group (Anura: Hylidae) from Minas Gerais, Southeastern Brazil. Herpetologica 65(4): 468-479.
  • LUTZ B. 1973. Brazilian Species of Hyla. Austin, University of Texas Press, 260 p.
  • MENEZES L, CANEDO C, BATALHA-FILHO H, GARDA AA, GEHARA M & NAPOLI MF. 2016. Multilocus Phylogeography of the Treefrog Scinax eurydice (Anura, Hylidae) Reveals a Plio-Pleistocene Diversification in the Atlantic Forest. PLoS ONE 11(6): e0154626.
  • MILLER MA, PFEIER W & SCHWARTZ T. 2010. Creating the CIPRES science gateway for inference of large phylogenetic trees. In Proceedings of the 2010 Gateway Computing Environments Workshop (GCE), IEEE, New Orleans, p. 1-8.
  • NUNES I, KWET A & POMBAL JR JP. 2012. Taxonomic revision of the Scinax alter species complex (Anura: Hylidae). Copeia 2012(3): 554-569.
  • NUÑEZ JJ, WOOD NK, RABANAL FE, FONTANELA FM & SITES JR JW. 2011. Amphibian phylogeography in the Antipodes: Refugia and postglacial colonization explain mitocondrial haplotype distribution in the Patagonian frog Eupsophus calcaratus (Cycloramphidae). Mol Phylogenet Evol 58: 343-352.
  • PALUMBI S, MARTIN A, ROMANO S, MACMILLAN WO, STICE L & GRABOWSKI G. 1991. The simple fool’s guide to PCR, Version 2.0. Department of Zoology and Kewalo Marine Laboratoly, University of Hawaii, Honolulu.
  • PONS J, BARRACLOUGH TG & GOMEZ-ZURITA J. 2006. Sequence based species delimitation for the DNA taxonomy of undescribed insects. Syst Biol 55: 595-609.
  • PRADO CPA, HADDAD CFB & ZAMUDIO KR. 2012. Cryptic lineages and Pleistocene population expansion in a Brazilian Cerrado frog. Mol Ecol 21: 921-941.
  • PRADO GM & POMBAL JR JP. 2008. Espécies de Proceratophrys Miranda-Ribeiro, 1920 com apêndices palpebrais (Anura; Cycloramphidae). Arquivos de Zoologia 39(1): 1-85.
  • PUILLANDRE N, LAMBERT A, BROUILLET S & ACHAZ G. 2012. ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Mol Ecol 21: 1864-1877.
  • R CORE TEAM. 2019. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna.
  • SALZBURGER W, EWING GB & VON HAESELER A. 2011. The performance of phylogenetic algorithms in estimating haplotype genealogies with migration. Mol Ecol 20: 1952-1963.
  • SAMBROOK J & RUSSEL DW. 2001. Rapid isolation of yeast DNA. In: Sambrook J & Russel DW (Eds), Molecular cloning, a laboratory manual, Cold Spring Harbor Laboratory, New York, p. 631-632.
  • SÃO PEDRO VA. 2014. Filogeografia de anfíbios da diagonal de áreas abertas da América do Sul. Tese de doutorado, Universidade Federal do Rio Grande do Norte, Natal, 130 p.
  • STURARO MJ & PELOSO PL. 2014. New Species of Scinax Wagler, 1830 (Anura: Hylidae) From the Middle Amazon River Basin, Brazil. Pap Av Zool 54(2): 9-23.
  • TAJIMA F. 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123: 585-595.
  • THOMÉ MTC, ZAMUDIO KR, GIOVANELLI JGR, HADDAD CFB, BALDISSERA FA & ALEZANDRINO J. 2010. Phylogeography of endemic toads and post-Pliocene persistence of the Brazilian Atlantic Forest. Mol Phylogenet Evol 55: 1018-1031.
  • THOMPSON JD, HIGGINS DG & GIBSON TJ. 1994. CLUSTALW: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673-4680.
  • VENCES M, THOMAS M, VAN DER MEIJDEN A, CHIARI Y & VIEITES D. 2005. Comparative performance of the 16SrRNA gene in DNA barcoding of amphibians. Front Zool 2: 5.
  • VIEGA-MENONCELLO ACP, LOURENÇO LB, STRÜSMANN C, ROSSA-FERES DC, ANDRADE GV, GIARETTA AA & RECCO-PIMENTEL SM. 2014. A phylogenetic analysis of Pseudopaludicola (Anura) providing evidence of progressive chromosome reduction. Zool Scr 43: 261-272.
  • ZEISSET I & BEEBEE TJC. 2008. Amphibian phylogeography: a model for understanding historical aspects of species distributions. Nature 101: 109-119.

SUPPLEMENTARY MATERIAL

Publication Dates

  • Publication in this collection
    09 May 2022
  • Date of issue
    2022

History

  • Received
    16 May 2020
  • Accepted
    6 Sept 2020
location_on
Academia Brasileira de Ciências Rua Anfilófio de Carvalho, 29, 3º andar, 20030-060 Rio de Janeiro RJ Brasil, Tel: +55 (21) 2391-7901 - Rio de Janeiro - RJ - Brazil
E-mail: aabc@abc.org.br
rss_feed Stay informed of issues for this journal through your RSS reader
Go to top Report error